A fast-growing and high-quality breeding method for grouper

Abstract

The present invention provides a method for breeding fast-growing high-quality grouper. The method comprises the following steps: identifying the genotype of the grouper SNP site, the SNP site being located at the 79th position of the gene sequence shown in SEQ ID NO.1, and if the genotype of the site is TT type, the grouper is a candidate parent; selecting candidate parents with symmetrical body shape and strong physique as broodstock; inducing spawning of male and female grouper; collecting eggs and sperm for artificial insemination; and evenly putting fertilized eggs into an indoor nursery pool for hatching and seedling raising. The grouper bred by the present invention not only has a fast growth and development speed, but also has a high content of crude fat and crude protein in muscle, a higher content of umami amino acids, a delicious taste, is more popular with consumers, and has a good market prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of aquatic biological breeding, and particularly relates to a breeding method for fast-growing high-quality grouper. Background Art

[0002] The grouper (scientific name: Leopard gill perch) is a marine fish with extremely high economic value. Its meat is delicious and nutritious, and it is deeply loved by consumers and has a large market demand. However, in the natural environment, the growth rate of the grouper is relatively slow and the growth cycle is long, which is difficult to meet market demand. In order to solve this problem, the growth of the grouper can be promoted by optimizing feed and breeding conditions. Although this method can increase the weight of the grouper, it often affects the meat quality and taste.

[0003] Selecting fast-growing and high-quality grouper through breeding is an effective way to solve the above problems from the source. There are two main methods for breeding. One is the traditional artificial selection method. Based on the growth traits of grouper, broodstock with excellent growth performance are artificially selected for breeding to obtain seedlings with superior growth performance. The disadvantage of this method is slow genetic progress and low breeding efficiency. The second is to select fast-growing and high-quality grouper through modern biotechnology means such as genomic selection breeding. However, this method is technically difficult and difficult to make new progress.

[0004] In short, the current breeding technology of grouper cannot effectively solve the problems of slow growth and poor quality at the same time. A new breeding method is urgently needed to improve this situation. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention carefully selects excellent broodstock through SNP molecular markers during the breeding process, and strictly controls the environmental conditions during the seedling raising process to ensure that the offspring grouper has better growth potential and quality from the source.

[0006] The technical solution of the present invention is as follows:

[0007] A fast-growing and high-quality breeding method for grouper, comprising the following steps:

[0008] Step S1: Identify the genotype of the SNP site of the eastern grouper, the SNP site is located at the 79th position of the gene sequence shown in SEQ ID NO.1, if the genotype of the site is TT type, then it is a candidate parent; select candidate parents with symmetrical body shape and strong physique as broodstock;

[0009] Step S2: inducing spawning of male and female grouper fish;

[0010] Step S3: collecting eggs and sperm for artificial insemination;

[0011] Step S4: evenly placing the fertilized eggs into an indoor nursery pool for hatching and seedling raising.

[0012] Preferably, during the incubation and seedling raising process, the water temperature is 22-30°C, the salinity is 12-25‰, the pH is 7.8-8.6, and the light cycle is 3000-9000 lx with 12-16 h light: 8-12 h dark.

[0013] Preferably, the environmental conditions during hatching and seedling raising are selected from any one of the following (1) to (5):

[0014] (1) Maintain water temperature at 28-30°C, salinity at 20-25‰, pH at 7.8-8.6, 3000-4000 lx, photoperiod of 12 h light: 12 h dark;

[0015] (2) Before the fry hatch, the water temperature is 28-30°C, the salinity is 20-25‰, and the pH is 7.8-8.6. After the fry hatch, the salinity decreases at a rate of 0.5-0.6‰ / day to 12-15‰ and then maintains the same level, while other conditions remain unchanged.

[0016] (3) Before the fry hatch, the water temperature is 28-30°C, the salinity is 20-25‰, and the pH is 7.8-8.6. After the fry hatch, the temperature drops at a rate of 0.8-1°C / day to 22-24°C and then maintains the same, while other conditions remain unchanged.

[0017] (4) Before the fry hatch, the water temperature was 28-30℃, the salinity was 20-25‰, and the pH was 7.8-8.6. After the fry hatched, the light intensity was increased from 3000-4000 lx to 7000-9000 lx at a rate of 200-300 lx per day and then maintained at that time. The photoperiod was adjusted from 10 h light: 14 h dark to 16 h light: 8 h dark at a rate of 0.5-0.6 h per day and then maintained at that time. Other conditions remained unchanged.

[0018] (5) Before the fry hatched, the water temperature was 28-30℃, the salinity was 20-25‰, and the pH was 7.8-8.6. After the fry hatched, the salinity decreased at a rate of 0.5-0.6‰ / day to 12-15‰ and then maintained at that rate. The temperature decreased at a rate of 0.8-1℃ / day to 22-24℃ and then maintained at that rate. The light intensity increased from 3000-4000lx to 7000-9000lx at a rate of 200-300lx per day and then maintained at that rate. The photoperiod was adjusted from 10h light:14h dark to 16h light:8h dark at a rate of 0.5-0.6h per day and then maintained at that rate. The pH remained unchanged.

[0019] Preferably, in step S4, rotifers and Chlorella are added to the pool when the fry open their mouths, and microflow water treatment is started after the fry open their mouths, with a daily water change of 10-20%; rotifers are used as grouper bait when the fry are 3-12 days old, and rotifers are used as the main bait for grouper when the fry are 13-18 days old, and copepods or Artemia larvae are added; rotifer feeding is stopped when the fry are 19-29 days old, and copepods or Artemia larvae are used as the main bait for grouper; and fish paste and eel mixed feed are used as the main bait for grouper when the fry are 30-60 days old.

[0020] Preferably, when the fish are 3 to 8 days old, the density of rotifers in the water is 2 to 5 / mL; when the fish are 9 to 12 days old, the density of rotifers in the water is 6 to 10 / mL; when the fish are 13 to 18 days old, the density of rotifers in the water is 6 to 10 / mL, and the density of copepod larvae or Artemia larvae is 1 to 2 / mL; when the fish are 19 to 29 days old, the density of copepods or Artemia is 6 to 10 / mL.

[0021] Preferably, the density of Chlorella is 4×10 5 ~5×10 5 cells / mL.

[0022] Preferably, in step S4, the fertilized eggs are placed in the nursery pond at a density of 1,000 to 2,000 eggs / m³.

[0023] Preferably, the female to male ratio of broodstock is 4:1.

[0024] Preferably, in step S3, HCG and LHRH-A3 are used to induce spawning in male and female grouper fish with mature gonads by intraperitoneal injection.

[0025] Preferably, the injection dose for female fish is LRH-A3 3.5~5 mg + HCG 800~1000 units / kg body weight, and the dose for male fish is halved.

[0026] SEQ ID NO.1

[0027] CCACTCATCACAGGCCGGGGACGAAGACAGCCGCACACACGTACACTCCAACACACACGCTCCGGGCACAGGACCGAA T

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] The fry of the present invention metamorphoses into juvenile fish after 15 days of incubation, metamorphoses into young fish after 30 days of incubation, and the average body length of the fry reaches 15 cm after 60 days of incubation. Compared with conventional fry, the time from hatching to breeding into commercial fish of about 0.6 kg is shortened by at least 2 months. It can be seen that the growth and development speed of the fry of the present invention is fast.

[0030] The grouper bred by the present invention not only has a fast growth and development speed, but also has high crude fat and crude protein contents in its muscles, and a higher umami amino acid content, is delicious, is more popular with consumers, and has a good market prospect.

[0031] The invention solves the problems of slow growth and poor quality of grouper. DETAILED DESCRIPTION

[0032] In order to enable those skilled in the art to better understand the technical content of the present invention, the present invention is further described below in conjunction with specific embodiments.

[0033] Embodiment 1: A method for breeding fast-growing high-quality grouper

[0034] Step S1: Identify the genotype of the SNP site of the grouper, which is located at the 79th position of the gene sequence shown in SEQ ID NO.1. If the genotype of the site is TT, it is a candidate parent. According to the ratio of female to male of 4:1, select candidate parents (3 years old) with symmetrical body shape and strong physique as broodstock.

[0035] Step S2: HCG and LHRH-A3 were used to induce spawning in male and female grouper fish with mature gonads by intraperitoneal injection. The injection dose for female fish was LRH-A3 3.5~5mg + HCG 800~1000 units / kg body weight, and the dose for male fish was halved.

[0036] Step S3: Collecting eggs and sperm for artificial insemination.

[0037] Step S4: The fertilized eggs are uniformly placed in the indoor nursery pond at a density of 1,000 to 2,000 eggs / m³ for incubation. The eggs are tumbled in the pond by moderate aeration before the fry emerge. During the incubation and nursery process, the water temperature is maintained at 28-30°C, the salinity is 20-25‰, the pH is 7.8-8.6, and the light intensity is 3000-4000lx for 12h:12h (light:dark).

[0038] When the larvae open their mouths, add rotifers and Chlorella vulgaris (density 4×10 5 ~5×10 5cells / mL), Chlorella supplements nutrition for rotifers and is used to improve water quality. Microflow water treatment is started after the larvae start to open, and the water volume is changed by 10~20% every day.

[0039] When the fish are 3 to 8 days old, the density of rotifers in the water is 2 to 5 / mL; when the fish are 9 to 12 days old, the density of rotifers in the water is 6 to 10 / mL; when the fish are 13 to 18 days old, the density of rotifers in the water is maintained at 6 to 10 / mL and copepods or Artemia larvae are added, and the density of copepod larvae or Artemia larvae is 1 to 2 / mL; when the fish are 19 to 29 days old, stop feeding rotifers and maintain the density of copepods or Artemia in the water at 6 to 10 / mL; when the fish are 30 to 60 days old, feed a mixed feed of fish paste and eel (mass ratio 2:5), and the daily feeding amount is 5% to 8% of the fish body weight. After 60 days of age, large-sized seedlings are fed with commercially available grouper compound feed (crude protein ≥52g / 100g, crude fat ≥8g / 100g, crude ash ≤17g / 100g, crude fiber ≤6g / 100g, calcium ≤5g / 100g, total phosphorus ≥1.0g / 100g, lysine ≥2.0g / 100g).

[0040] Routine water quality management and disease prevention and control management are carried out during the breeding process.

[0041] Embodiment 2: A method for breeding fast-growing high-quality grouper

[0042] In this embodiment, the seedling raising conditions are optimized.

[0043] Step S1: Identify the genotype of the SNP site of the grouper, which is located at the 79th position of the gene sequence shown in SEQ ID NO.1. If the genotype of the site is TT, it is a candidate parent. According to the ratio of female to male of 4:1, select candidate parents (3 years old) with symmetrical body shape and strong physique as broodstock.

[0044] Step S2: HCG and LHRH-A3 were used to induce spawning in male and female grouper fish with mature gonads by intraperitoneal injection. The injection dose for female fish was LRH-A3 3.5~5mg + HCG 800~1000 units / kg body weight, and the dose for male fish was halved.

[0045] Step S3: Collecting eggs and sperm for artificial insemination.

[0046] Step S4: the fertilized eggs are uniformly placed in an indoor nursery pond at a density of 1,000 to 2,000 eggs / m³ for hatching. Before the fry hatch, the eggs are aerated at a moderate intensity to make them roll in the pond. The water temperature is 28 to 30°C, the salinity is 20 to 25‰, the pH is 7.8 to 8.6, and the light intensity is 3000 to 4000 lx for 12h:12h (light:dark). After the fry hatch, the salinity is reduced to 12 to 15‰ at a rate of 0.5 to 0.6‰ / day and maintained thereafter, and other conditions remain unchanged.

[0047] When the larvae open their mouths, add rotifers and Chlorella vulgaris (density 4×10 5 ~5×10 5 cells / mL), Chlorella supplements nutrition for rotifers and is used to improve water quality. Microflow water treatment is started after the larvae start to open, and the water volume is changed by 10~20% every day.

[0048] When the fish are 3 to 8 days old, the density of rotifers in the water is 2 to 5 / mL; when the fish are 9 to 12 days old, the density of rotifers in the water is 6 to 10 / mL; when the fish are 13 to 18 days old, the density of rotifers in the water is maintained at 6 to 10 / mL and copepods or Artemia larvae are added, and the density of copepod larvae or Artemia larvae is 1 to 2 / mL; when the fish are 19 to 29 days old, stop feeding rotifers and maintain the density of copepods or Artemia in the water at 6 to 10 / mL; when the fish are 30 to 60 days old, feed a mixed feed of fish paste and eel (mass ratio 2:5), and the daily feeding amount is 5% to 8% of the fish body weight. After 60 days of age, large-sized seedlings are fed with commercially available grouper compound feed (crude protein ≥52g / 100g, crude fat ≥8g / 100g, crude ash ≤17g / 100g, crude fiber ≤6g / 100g, calcium ≤5g / 100g, total phosphorus ≥1.0g / 100g, lysine ≥2.0g / 100g).

[0049] Routine water quality management and disease prevention and control management are carried out during the breeding process.

[0050] Embodiment 3: A method for breeding fast-growing high-quality grouper

[0051] In this embodiment, the seedling raising conditions are optimized.

[0052] Step S1: Identify the genotype of the SNP site of the grouper, which is located at the 79th position of the gene sequence shown in SEQ ID NO.1. If the genotype of the site is TT, it is a candidate parent. According to the ratio of female to male of 4:1, select candidate parents (3 years old) with symmetrical body shape and strong physique as broodstock.

[0053] Step S2: HCG and LHRH-A3 were used to induce spawning in male and female grouper fish with mature gonads by intraperitoneal injection. The injection dose for female fish was LRH-A3 3.5~5mg + HCG 800~1000 units / kg body weight, and the dose for male fish was halved.

[0054] Step S3: Collecting eggs and sperm for artificial insemination.

[0055] Step S4: the fertilized eggs are uniformly placed in an indoor nursery pond at a density of 1,000 to 2,000 eggs / m³ for hatching. Before the fry hatch, the eggs are aerated at a moderate intensity to make them roll in the pond. The water temperature is 28 to 30°C, the salinity is 20 to 25‰, the pH is 7.8 to 8.6, and the light intensity is 3000 to 4000 lx for 12h:12h (light:dark). After the fry hatch, the temperature is reduced to 22 to 24°C at a rate of 0.8 to 1°C / day and maintained thereafter, and other conditions remain unchanged.

[0056] When the larvae open their mouths, add rotifers and Chlorella vulgaris (density 4×10 5 ~5×10 5 cells / mL), Chlorella supplements nutrition for rotifers and is used to improve water quality. Microflow water treatment is started after the larvae start to open, and the water volume is changed by 10~20% every day.

[0057] When the fish are 3 to 8 days old, the density of rotifers in the water is 2 to 5 / mL; when the fish are 9 to 12 days old, the density of rotifers in the water is 6 to 10 / mL; when the fish are 13 to 18 days old, the density of rotifers in the water is maintained at 6 to 10 / mL and copepods or Artemia larvae are added, and the density of copepod larvae or Artemia larvae is 1 to 2 / mL; when the fish are 19 to 29 days old, stop feeding rotifers and maintain the density of copepods or Artemia in the water at 6 to 10 / mL; when the fish are 30 to 60 days old, feed a mixed feed of fish paste and eel (mass ratio 2:5), and the daily feeding amount is 5 to 8% of the fish body weight. After 60 days of age, large-sized seedlings are fed with commercially available grouper compound feed (crude protein ≥52g / 100g, crude fat ≥8g / 100g, crude ash ≤17g / 100g, crude fiber ≤6g / 100g, calcium ≤5g / 100g, total phosphorus ≥1.0g / 100g, lysine ≥2.0g / 100g).

[0058] Routine water quality management and disease prevention and control management are carried out during the breeding process.

[0059] Embodiment 4: A fast-growing high-quality breeding method for grouper

[0060] In this embodiment, the seedling raising conditions are optimized.

[0061] Step S1: Identify the genotype of the SNP site of the grouper, which is located at the 79th position of the gene sequence shown in SEQ ID NO.1. If the genotype of the site is TT, it is a candidate parent. According to the ratio of female to male of 4:1, select candidate parents (3 years old) with symmetrical body shape and strong physique as broodstock.

[0062] Step S2: HCG and LHRH-A3 were used to induce spawning in male and female grouper fish with mature gonads by intraperitoneal injection. The injection dose for female fish was LRH-A3 3.5~5mg + HCG 800~1000 units / kg body weight, and the dose for male fish was halved.

[0063] Step S3: Collecting eggs and sperm for artificial insemination.

[0064] Step S4: Fertilized eggs are uniformly placed in an indoor nursery pond at a density of 1,000 to 2,000 eggs / m³ for incubation. Before the fry hatch, the eggs are aerated at a moderate intensity to make them roll in the pond. The water temperature is 28 to 30°C, the salinity is 20 to 25‰, and the pH is 7.8 to 8.6. After the fry hatch, the light intensity is increased from 3000 to 4000 lx at a rate of 200 to 300 lx per day to 7000 to 9000 lx and then maintained. The photoperiod is adjusted from 10h:14h (light:dark) to 16h:8h (light:dark) at a rate of 0.5 to 0.6h per day and then maintained, and other conditions remain unchanged.

[0065] When the larvae open their mouths, add rotifers and Chlorella vulgaris (density 4×10 5 ~5×10 5 cells / mL), Chlorella supplements nutrition for rotifers and is used to improve water quality. Microflow water treatment is started after the larvae start to open, and the water volume is changed by 10~20% every day.

[0066] When the fish are 3 to 8 days old, the density of rotifers in the water is 2 to 5 / mL; when the fish are 9 to 12 days old, the density of rotifers in the water is 6 to 10 / mL; when the fish are 13 to 18 days old, the density of rotifers in the water is maintained at 6 to 10 / mL and copepods or Artemia larvae are added, and the density of copepod larvae or Artemia larvae is 1 to 2 / mL; when the fish are 19 to 29 days old, stop feeding rotifers and maintain the density of copepods or Artemia in the water at 6 to 10 / mL; when the fish are 30 to 60 days old, feed a mixed feed of fish paste and eel (mass ratio 2:5), and the daily feeding amount is 5% to 8% of the fish body weight. After 60 days of age, large-sized seedlings are fed with commercially available grouper compound feed (crude protein ≥52g / 100g, crude fat ≥8g / 100g, crude ash ≤17g / 100g, crude fiber ≤6g / 100g, calcium ≤5g / 100g, total phosphorus ≥1.0g / 100g, lysine ≥2.0g / 100g).

[0067] Routine water quality management and disease prevention and control management are carried out during the breeding process.

[0068] Example 5: A fast-growing and high-quality breeding method for grouper

[0069] In this embodiment, the seedling raising conditions are optimized.

[0070] Step S1: Identify the genotype of the SNP site of the grouper, which is located at the 79th position of the gene sequence shown in SEQ ID NO.1. If the genotype of the site is TT, it is a candidate parent. According to the ratio of female to male of 4:1, select candidate parents (3 years old) with symmetrical body shape and strong physique as broodstock.

[0071] Step S2: HCG and LHRH-A3 were used to induce spawning in male and female grouper fish with mature gonads by intraperitoneal injection. The injection dose for female fish was LRH-A3 3.5~5mg + HCG 800~1000 units / kg body weight, and the dose for male fish was halved.

[0072] Step S3: Collecting eggs and sperm for artificial insemination.

[0073] Step S4: the fertilized eggs are uniformly put into the indoor nursery pond at a density of 10,000 to 20,000 eggs / m³ for hatching. The eggs are tumbled in the pond by moderate aeration before the fry hatch out of the membrane. The water temperature is 28-30°C, the salinity is 20-25‰, and the pH is 7.8-8.6. After the fry hatch out of the membrane, the salinity is decreased to 12-15‰ at a rate of 0.5-0.6‰ / day and then maintained, the temperature is decreased to 22-24°C at a rate of 0.8-1°C / day and then maintained, the light is increased from 3000-4000lx to 7000-9000lx at a rate of 200-300lx per day and then maintained, the photoperiod is adjusted from 10h:14h (light:dark) to 16h:8h (light:dark) at a rate of 0.5-0.6h per day and then maintained, and the pH remains unchanged.

[0074] When the larvae open their mouths, add rotifers and Chlorella vulgaris (density 4×10 5 ~5×10 5 cells / mL), Chlorella supplements nutrition for rotifers and is used to improve water quality. Microflow water treatment is started after the larvae start to open, and the water volume is changed by 10~20% every day.

[0075] When the fish are 3 to 8 days old, the density of rotifers in the water is 2 to 5 / mL; when the fish are 9 to 12 days old, the density of rotifers in the water is 6 to 10 / mL; when the fish are 13 to 18 days old, the density of rotifers in the water is maintained at 6 to 10 / mL and copepods or Artemia larvae are added, and the density of copepod larvae or Artemia larvae is 1 to 2 / mL; when the fish are 19 to 29 days old, stop feeding rotifers and maintain the density of copepods or Artemia in the water at 6 to 10 / mL; when the fish are 30 to 60 days old, feed a mixed feed of fish paste and eel (mass ratio 2:5), and the daily feeding amount is 5% to 8% of the fish body weight. After 60 days of age, large-sized seedlings are fed with commercially available grouper compound feed (crude protein ≥52g / 100g, crude fat ≥8g / 100g, crude ash ≤17g / 100g, crude fiber ≤6g / 100g, calcium ≤5g / 100g, total phosphorus ≥1.0g / 100g, lysine ≥2.0g / 100g).

[0076] Routine water quality management and disease prevention and control management are carried out during the breeding process.

[0077] Comparative Example 1:

[0078] The parents with CC genotype were selected for breeding, and other conditions were the same as those in Example 1.

[0079] The breeding effects of various embodiments and comparative examples are as follows:

[0080] 1. By using the methods of Examples 1 to 5, the fish metamorphose into juveniles after 15 days of hatching, metamorphose into juveniles after 30 days of hatching, and the average body length of the fry after 60 days of hatching reaches 15.1 to 16.3 cm. Compared with conventional seedlings, the time from hatching to breeding into 0.6 kg commercial fish in Examples 1 to 4 is shortened by 2 months, while that in Example 5 is shortened by 3 months. By using the method of Comparative Example 1, the fish metamorphose into juveniles after 18 to 20 days of hatching, metamorphose into juveniles after 50 days of hatching, and the average body length of the fry after 60 days of hatching is 10.5 to 11.2 cm.

[0081] 2. Fish quality testing

[0082] Large-sized grouper seedlings after 60 days of age were fed with commercially available grouper compound feed (crude protein ≥52g / 100g, crude fat ≥8g / 100g, crude ash ≤17g / 100g, crude fiber ≤6g / 100g, calcium ≤5g / 100g, total phosphorus ≥1.0g / 100g, lysine ≥2.0g / 100g), and the crude fat, crude protein and amino acid contents in the muscle were measured after 7 months.

[0083] The protein in the muscle was analyzed using an automatic amino acid analyzer. The crude fat content was determined using the Soxhlet extraction method. The crude protein content was determined using a nitrogen analyzer. The number of samples tested was ≥20.

[0084] The experimental data were expressed as mean ± standard deviation and statistically analyzed using SPSS software to compare the significance of the differences between the data. p <0.05.

[0085] The results are shown in the following table:

[0086] Table 1

[0087]

[0088] The results in Table 1 show that the contents of crude fat and crude protein in Example 5 are close to those of adult grouper caught in the wild, and are significantly higher than those in Comparative Example 1.

[0089] Table 2

[0090]

[0091] The deliciousness of fish meat depends on the content of umami amino acids. Aspartic acid, glutamic acid, glycine and alanine are four important flavor amino acids, among which aspartic acid and glutamic acid are umami amino acids, and glycine and alanine are sweet amino acids. In addition, glutamic acid is an important amino acid in the biochemical metabolism of brain tissue and plays an important role in the synthesis of physiologically active substances in the metabolic process.

[0092] As can be seen from Table 2, the umami amino acid content of each embodiment is significantly higher than that of comparative example 1, and also higher than that of adult grouper caught in the wild, indicating that the method of the present invention can effectively improve the umami taste of grouper and improve the meat quality. Among the embodiments, embodiment 5 has the best effect, and the umami amino acid content is significantly higher than that of other embodiments.

[0093] The specific implementation methods described above are only partial embodiments of the present invention and are not intended to limit the present invention. Any equivalent substitutions, improvements, etc. made by those skilled in the art within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for breeding fast-growing high-quality grouper, characterized in that: The following steps are involved: Step S1: Identify the genotype of the SNP site of the eastern grouper, the SNP site is located at the 79th position of the gene sequence shown in SEQ ID NO.1, if the genotype of the site is TT type, then it is a candidate parent; select candidate parents with symmetrical body shape and strong physique as broodstock; Step S2: inducing spawning of male and female grouper fish; Step S3: collecting eggs and sperm for artificial insemination; Step S4: evenly placing the fertilized eggs into an indoor nursery pool for hatching and seedling raising.

2. The method for breeding fast-growing high-quality grouper according to claim 1, characterized in that: During the incubation and seedling raising process, the water temperature is 22~30℃, the salinity is 12~25‰, the pH is 7.8~8.6, the photoperiod is 12~16h light: 8~12h dark, and the light intensity is 3000~9000lx.

3. The method for breeding fast-growing high-quality grouper according to claim 1, characterized in that: The environmental conditions during incubation and seedling raising are selected from any one of the following (1) to (5): (1) Maintain water temperature at 28-30°C, salinity at 20-25‰, pH at 7.8-8.6, 3000-4000 lx, photoperiod of 12 h light: 12 h dark; (2) Before the fry hatch, the water temperature is 28-30°C, the salinity is 20-25‰, and the pH is 7.8-8.

6. After the fry hatch, the salinity decreases at a rate of 0.5-0.6‰ / day to 12-15‰ and then maintains the same level, while other conditions remain unchanged. (3) Before the fry hatch, the water temperature is 28-30°C, the salinity is 20-25‰, and the pH is 7.8-8.

6. After the fry hatch, the temperature drops at a rate of 0.8-1°C / day to 22-24°C and then maintains the same, while other conditions remain unchanged. (4) Before the fry hatch, the water temperature was 28-30℃, the salinity was 20-25‰, and the pH was 7.8-8.

6. After the fry hatched, the light intensity was increased from 3000-4000 lx to 7000-9000 lx at a rate of 200-300 lx per day and then maintained at that time. The photoperiod was adjusted from 10 h light: 14 h dark to 16 h light: 8 h dark at a rate of 0.5-0.6 h per day and then maintained at that time. Other conditions remained unchanged. (5) Before the fry hatched, the water temperature was 28-30℃, the salinity was 20-25‰, and the pH was 7.8-8.

6. After the fry hatched, the salinity decreased at a rate of 0.5-0.6‰ / day to 12-15‰ and then maintained at that rate. The temperature decreased at a rate of 0.8-1℃ / day to 22-24℃ and then maintained at that rate. The light intensity increased from 3000-4000lx to 7000-9000lx at a rate of 200-300lx per day and then maintained at that rate. The photoperiod was adjusted from 10h light:14h dark to 16h light:8h dark at a rate of 0.5-0.6h per day and then maintained at that rate. The pH remained unchanged.

4. The method for breeding fast-growing high-quality grouper according to claim 1, characterized in that: In step S4, rotifers and Chlorella are added to the pool before the fry open their mouths, and microflow water treatment is started after the fry open their mouths, with a water change of 10-20% per day; rotifers are used as bait for the grouper when the fry are 3-12 days old, and rotifers are used as the main bait for the grouper when the fry are 13-18 days old, and copepods or Artemia larvae are added; rotifers are stopped from being fed when the fry are 19-29 days old, and copepods or Artemia larvae are used as the main bait for the grouper; and fish paste and eel mixed feed are used as the main bait for the grouper when the fry are 30-60 days old.

5. The method for breeding fast-growing high-quality grouper according to claim 4, characterized in that: When the fish are 3 to 8 days old, the density of rotifers in the water is 2 to 5 / mL; when the fish are 9 to 12 days old, the density of rotifers in the water is 6 to 10 / mL; when the fish are 13 to 18 days old, the density of rotifers in the water is 6 to 10 / mL, and the density of copepod larvae or Artemia larvae is 1 to 2 / mL; when the fish are 19 to 29 days old, the density of copepods or Artemia is 6 to 10 / mL.

6. The method for breeding fast-growing high-quality grouper according to claim 4, characterized in that: The density of Chlorella is 4×10 5 ~5×10 5 cells / mL.

7. The method for breeding fast-growing high-quality grouper according to claim 1, characterized in that: In step S4, the fertilized eggs are placed in the nursery pond at a density of 1,000 to 2,000 eggs / m³.

8. The method for breeding fast-growing high-quality grouper according to claim 1, characterized in that: The ratio of female to male broodstock is 4:

1.

9. The method for breeding fast-growing high-quality grouper according to claim 1, characterized in that: In step S3, HCG and LHRH-A3 are used to induce spawning in male and female grouper fish with mature gonads by intraperitoneal injection.

10. The method for breeding fast-growing high-quality grouper according to claim 1, characterized in that: The injection dose for female fish is LRH-A3 3.5~5mg + HCG 800~1000 units / kg body weight, and the dose for male fish is halved.

Images