Application of ciclopirox amine in preparation of anti-poxvirus medicine

Abstract

The invention provides an application of ciclopirox amine in preparation of an anti-poxvirus medicine, and belongs to the technical field of biological medicines. The invention relates to an application of ciclopirox olamine in preparation of anti-poxvirus drugs. It is proved for the first time that ciclopirox amine has efficient anti-poxvirus activity, can inhibit orthopoxvirus and goat poxvirus from infecting host cells, and meanwhile inhibits poxvirus replication. Therefore, the ciclopirox olamine can be applied to treatment of diseases related to poxvirus infection and drug development. The invention opens up a new way for the application of ciclopirox olamine, and provides a new means for treating poxvirus infection related diseases in the fields of breeding industry and biomedicine.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically relates to the application of ciclopirox in the preparation of anti-pox virus drugs. Background Art

[0002] Viral infections not only threaten human health, but also cause serious economic losses to the breeding industry. There are also great differences in the transmission methods of different viruses and the ways they replicate in the host. Poxvirus is one of the important pathogens that infect humans and animals. Common poxviruses include smallpox virus and monkeypox virus. Currently, the FDA has approved two alternative drugs for the treatment of smallpox, tecovirimat and brincidofovir. Although tecovirimat has shown good efficacy in the treatment of monkeypox infection cases, clinical experimental data are also limited and drug resistance is prone to occur. The clinical efficacy of brincidofovir in the treatment of monkeypox is not optimistic. Therefore, identifying new and effective antiviral compounds is the key to developing drugs against poxviruses.

[0003] Ciclopirox ethanolamine (CPX-O) is a drug for fungal skin infections and vaginal candidiasis, which can inhibit a variety of enzymes by chelating iron ions. In recent years, studies have shown that Ciclopirox ethanolamine has anticancer activity and is used to treat cervical cancer, breast cancer, liver cancer, etc., and is a potential anticancer drug candidate. There are currently no reports on Ciclopirox ethanolamine's anti-acne virus activity. Summary of the invention

[0004] In view of this, the object of the present invention is to provide the use of ciclopirox in the preparation of anti-poxvirus drugs, wherein the ciclopirox inhibits the replication of multiple poxviruses and the infection of cells to achieve the purpose of anti-poxvirus.

[0005] The invention provides application of ciclopirox in preparing anti-pox virus medicine.

[0006] The present invention provides the use of ciclopirox in preparing a medicine for preventing and / or treating diseases related to poxvirus infection.

[0007] Preferably, the poxvirus infection-related diseases include at least one of the following: smallpox, bovine nodular dermatitis, monkeypox and fowlpox.

[0008] Preferably, the poxvirus comprises an orthopoxvirus and / or a capripoxvirus.

[0009] Preferably, the orthopoxvirus genus includes vaccinia virus.

[0010] Preferably, the capripoxvirus genus includes bovine lumpy skin disease virus.

[0011] Preferably, the medicine comprises injection solution and / or injection powder.

[0012] Preferably, the medicine includes medicine for human use and / or medicine for animal use.

[0013] Preferably, when the poxvirus is vaccinia virus, the effective concentration of ciclopirox in the drug is not less than 5 μM.

[0014] Preferably, when the poxvirus is bovine nodular dermatosis virus, the effective concentration of ciclopirox in the drug is not less than 1 μM.

[0015] The present invention provides the use of ciclopirox in the preparation of anti-pox virus drugs. The present invention proves for the first time that the iron ion chelator ciclopirox has high-efficiency anti-pox virus activity, and can inhibit three viruses (vaccinia virus WR strain, vaccinia virus MVA strain, bovine nodular skin disease virus) of the genera Orthopoxvirus and Capripoxvirus from infecting host cells. The results of the embodiment show that ciclopirox can effectively inhibit the infection of host cells by the vaccinia virus WR strain, and it inhibits the virus by chelating iron ions; 5-20 μM ciclopirox can effectively inhibit the infection of host cells by the vaccinia virus MVA strain; when the drug is used at a concentration as low as 0.5-3 μM, it inhibits the infection of host cells by LSDV in a concentration-dependent manner, providing a new theoretical basis for subsequent research on anti-pox virus. At the same time, animal experimental results show that 10 mg / kg ciclopirox can effectively reduce the mortality rate of mice by treating mice infected with poxvirus. The present invention opens up a new way for the use of ciclopirox, and provides a new means for the treatment of poxvirus infection-related diseases in the aquaculture and biomedical fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The figure shows the results of different concentrations of ciclopirox inhibiting the replication of VACV-WR (MOI=0.01) in Hela cells;

[0017] Figure 2 The cytotoxicity of different concentrations of ciclopirox to Hela cells;

[0018] Figure 3 The figure shows the results of different concentrations of ciclopirox inhibiting the replication of VACV-WR (MOI=3) in Hela cells;

[0019] Figure 4 The results of different concentrations of ciclopirox inhibiting the replication of VACV-WR in A549 cells;

[0020] Figure 5 This is the result of cyclopyrisamide inhibiting the transcription of early gene E3L mRNA;

[0021] Figure 6This is the result of cyclopyrisamide inhibiting the transcription of the mid-term gene D13L mRNA;

[0022] Figure 7 This is the result of cyclopyrisamide inhibiting the transcription of late gene A3L mRNA;

[0023] Figure 8 This is the result of cyclopyrisamide inhibiting DNA synthesis;

[0024] Fig. 9 This is the result of ciclopirox inhibiting VACV-WR replication;

[0025] Fig.10 This is the result graph of mouse survival curve;

[0026] Fig.11 This is the result of ciclopirox inhibiting VACV-MVA replication;

[0027] Fig.12 This is a graph showing the results of ciclopirox inhibiting LSDV replication. DETAILED DESCRIPTION

[0028] The invention provides application of ciclopirox in preparing anti-pox virus medicine.

[0029] In the present invention, the molecular formula of ciclopirox is C 12 H 17 NO2.C2H7NO has a structure shown in Formula 1. In the embodiment of the present invention, the cyclopyrimethamine is purchased from Selleck Company with a product number of S3019.

[0030]

[0031] In the present invention, the poxvirus preferably includes orthopoxvirus and / or capripoxvirus. The orthopoxvirus preferably includes vaccinia virus. The vaccinia virus includes vaccinia virus WR strain (VACV-WR) and vaccinia virus MVA strain (VACV-MVA). The capripoxvirus preferably includes bovine nodular skin disease virus.

[0032] In the present invention, the drug preferably includes an injection solution and / or an injection powder. The drug preferably includes a human drug and / or an animal drug. The present invention has no particular limitation on the type of animal, and the type of poxvirus-infected animal known in the art can be used, such as African rodents (such as African squirrels, tree squirrels, Gambian kangaroos, dormice, etc.), primates (such as monkeys, chimpanzees, etc.) and other mammals (gerbils, marmots, squirrels, rabbits, dogs, cats, etc.).

[0033] In the present invention, there are differences in the effective inhibitory concentrations of cyclopyrisamide for different types of poxviruses: when the poxvirus is vaccinia virus, the effective concentration of cyclopyrisamide in the drug is preferably not less than 5 μM, and can be 10 μM, 15 μM, 20 μM, 30 μM, 40 μM and 50 μM. When the poxvirus is bovine nodular dermatosis virus, the effective concentration of cyclopyrisamide in the drug is preferably not less than 1 μM, and can be 2 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, etc. The cyclopyrisamide is achieved by reducing the host cell lesions caused by poxvirus, reducing the virus titer in the cells, and inhibiting the replication ability of poxvirus, thereby inhibiting the infection activity of poxvirus. The cyclopyrisamide inhibits poxvirus replication by chelating iron ions.

[0034] In one embodiment of the present invention, VACV-WR is used as the infection virus, and different host cells (Hela cells, A549 cells) are infected with virus liquids of different titers (0.01MOI, 3MOI) to verify the administration effect of cyclopyramide. The results show that 10-50 μM cyclopyramide can effectively reduce cytopathic effects, effectively reduce viral titers, and inhibit the degree of infection in a dose-dependent manner. At the same time, the present invention also detects the effect of cyclopyramide on viral replication. The results show that cyclopyramide can significantly inhibit the expression of mid- and late-stage genes and inhibit viral DNA replication, which indicates that cyclopyramide has the ability to inhibit poxvirus replication. In addition, the poxvirus-infected mouse model is used as the object to carry out the in vivo efficacy experiment of cyclopyramide. The results show that compared with the VACV-WR infection group, cyclopyramide significantly improves the survival rate after treating virus-infected mice. Cytotoxicity tests show that the administration concentration of 10-50 μM of cyclopyramide makes the activity of cells more than 50%, indicating that cyclopyramide has lower cytotoxicity.

[0035] In another embodiment of the present invention, VACV-MVA and LSDV were used as infectious viruses, and different titers (0.01MOI, 3MOI) of virus solutions were used to infect host cells (DF-1 cells and MDBK) to verify the administration effect of cyclopyrisamide. The results showed that compared with the control, cyclopyrisamide significantly inhibited the replication of the virus; 5, 10, and 20 μM cyclopyrisamide could effectively inhibit the infection of VACV-MVA virus; at the same time, 1 and 3 μM cyclopyrisamide could inhibit the replication of LSDV, and it was concentration-dependent.

[0036] The present invention also provides the use of ciclopirox in preparing medicines for preventing and / or treating diseases related to poxvirus infection.

[0037] In the present invention, the poxvirus infection-related diseases preferably include at least one of the following: smallpox, bovine nodular dermatitis, monkeypox and fowlpox.

[0038] The application of ciclopirox provided by the present invention in the preparation of anti-pox virus drugs is described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0039] Example 1

[0040] Effects of the compound ciclopirox on the replication of vaccinia virus VACV-WR

[0041] (1) Hela, A549 and BSC cells were cultured in DMEM medium containing 10% FBS and 100 U / ml penicillin-streptomycin in a 37°C, 5% CO2 incubator.

[0042] Inoculate BSC cells with VACV-WR at 0.01 MOI, scrape the cells after 48 hours of infection, collect the virus, centrifuge at 2500rpm for 5 minutes, and discard the supernatant. Resuspend the cells with 10mM Tris-Cl (pH 9.0), transfer to a glass homogenizer to grind and lyse the cell suspension (on ice), centrifuge at 300g and 4°C for 5 minutes, and save the supernatant; ultrasonically treat the supernatant, add 36% sucrose to a sterile centrifuge tube, and add the ultrasonic lysate to the 36% sucrose cushion, centrifuge at 33000g for 80 minutes, discard the supernatant, resuspend the virus particles with 1mM Tris-Cl (pH 9.0), and store at -80°C for use.

[0043] Hela cells were infected with VACV-WR at 0.01 MOI and incubated for 2 h. The virus solution was discarded, washed twice with PBS, and replaced with maintenance medium containing cyclopyrimethamine. The drug concentration was set to 10 μM, 20 μM, and 50 μM. The culture was continued for 48 h. DMSO was used as a control. The virus was collected and the virus titer was determined on BSC cells. 1×10 5 BSC cells were plated into 6-well plates and cultured in a 37°C, 5% CO2 incubator. The virus was diluted to 10 -4 , 10 -5 , 10 -6 Inoculate in a 6-well plate, discard the virus solution 1-2 hours after infection, replace with DMEM medium containing 0.75% methylcellulose, and continue to culture for 48 hours. Discard the medium, add 1 ml of 0.1% crystal violet to each well, and incubate at room temperature for 20 minutes; discard the crystal violet, wash the 6-well plate with water, and calculate the virus titer by counting the plaques in the wells according to formula I;

[0044] Virus titer (PFU / ml) = number of plaques × virus dilution factor ÷ inoculation volume (ml) Formula I.

[0045] At the same time, the present embodiment also carries out the effect detection experiment (MTT) of ciclopirox on cytotoxicity, and Hela cells are inoculated in 96-well plates, 10000 cells per well, and cultured overnight in 37°C, 5% CO2 incubator. The culture medium is discarded, and ciclopirox (10, 20, 50 μM) containing different concentrations is added, and culture is continued for 48h. The supernatant is discarded, 90 μL fresh DMEM culture medium is added to each well, and 10 μL 0.5% MTT solution is added, and cultured in 37°C, 5% CO2 incubator for 4h; After discarding the supernatant, 110 μL Formazan lysate is added, and it is placed on a shaking table and oscillated at low speed for 10min, and the absorbance is read at 490nm. Zeroing hole (culture medium, MTT, Formazan lysate) and control well (cell, drug dissolution medium of the same concentration, culture fluid, MTT, Formazan lysate) are set simultaneously.

[0046] The results showed that compared with the DMSO group, cyclopyrimethamine reduced cytopathic effects and significantly decreased viral titers, with 50 μM having the most significant inhibitory effect on the virus ( Figure 1 ), cyclopyrimethamine has less cytotoxicity ( Figure 2 ).

[0047] (2) Hela cells were infected with VACV-WR at 3 MOI and incubated for 2 h. The virus solution was discarded, washed twice with PBS, and replaced with maintenance medium containing 10 μM, 20 μM, and 50 μM ciclopirox. The cells were cultured for another 24 h. DMSO was used as a control. The virus was collected and the virus titer was determined on BSC cells.

[0048] The results showed that compared with the DMSO group, cyclopyrimethamine reduced cytopathic effects and significantly reduced viral titers in a concentration-dependent manner, and 50 μM had the most significant inhibitory effect on the virus ( Figure 3 ).

[0049] (3) A549 cells were infected with VACV-WR at 0.01 MOI and incubated for 2 h. The virus solution was discarded, washed twice with PBS, and replaced with maintenance medium containing ciclopirox. The drug concentrations were set to 10 μM, 20 μM, and 50 μM. The cells were cultured for 48 h. DMSO was used as a control. The virus was collected and the virus titer was measured on BSC cells.

[0050] The results showed that compared with the DMSO group, 50 μM ciclopirox significantly inhibited viral replication ( Figure 4 ).

[0051] (4) Infect Hela cells with 3 MOI of VACV-WR, discard the virus solution after incubation for 2 hours, wash twice with PBS, add fresh culture medium containing DMSO and 50 μM cyclopyrithamide, and continue to culture. Continue to culture for 2 hours and 8 hours, collect cell samples, extract RNA, and reverse transcribe it into cDNA. qPCR was used to detect the transcription level of early gene E3L, middle gene D13L and late gene A3L mRNA, and the primer sequences are as follows:

[0052] E3L-F:TGACAGGGTTAGCACCTTTCCAATC (SEQ ID NO: 1);

[0053] E3L-R:CGGATGCTGATGCTATGGCTGAC (SEQ ID NO: 2);

[0054] D13L-F: GATAGCCTGATTGTCTGGACCATCG (SEQ ID NO: 3);

[0055] D13L-R:AACGGTCTAATGTCTTCGCAGTCG (SEQ ID NO: 4);

[0056] A3L-F: CTATAGACAAAATAGAAGCC (SEQ ID NO: 5);

[0057] A3L-R: CCATGATTAGAAAAGCAATTATG (SEQ ID NO: 6).

[0058] Use the above primers to establish a 20μL reaction system: 10μL Green qPCR SuperMix, 0.4 μL of upstream and downstream primers, 2 μL of cDNA, 7.2 μL of ddH2O. Reaction program: 94℃ pre-denaturation for 30 s, 94℃ denaturation for 5 s, 60℃ annealing for 30 s, 40 cycles, melting curve: from 60℃ to 95℃ at 4.4℃ / s.

[0059] Hela cells were infected with 3 MOI VACV-WR, and the virus solution was discarded after incubation for 2 hours. The cells were washed twice with PBS and replaced with fresh culture medium containing DMSO and ciclopirox, respectively. Cell samples were collected 8 hours after infection to extract DNA, and the effect on viral DNA replication was analyzed by qPCR. The primer sequences are as follows:

[0060] E11L-F:ACCGACGATGTATGTGCCTC (SEQ ID NO:7);

[0061] E11L-R: CAAACAGCAAGGGTTCGTCA (SEQ ID NO:8).

[0062] To set up a 20 μL reaction system: 10 μL Green qPCR SuperMix, 0.4 μL of upstream and downstream primers, 2 μL of cDNA, 7.2 μL of ddH2O. Reaction program: 94℃ pre-denaturation for 30 s, 94℃ denaturation for 5 s, 60℃ annealing for 30 s, 40 cycles, melting curve: from 60℃ to 95℃ at 4.4℃ / s.

[0063] The results showed that compared with DMSO, cyclopyrimethamine significantly inhibited the expression of gene E3L ( Figure 5 )、D13L( Figure 6 ) and A3L transcription ( Figure 7 ) and inhibited DNA replication ( Figure 8 ).

[0064] (5) Hela cells were infected with VACV-WR at an MOI of 0.01 and incubated for 2 h. The virus solution was discarded and the cells were washed twice with PBS and replaced with Fe 2+ , ciclopirox and ciclopirox+Fe 2+ The culture was continued for 48 h, and DMSO was used as a control. The virus was collected and the virus titer was measured on BSC cells. The results showed that ciclopirox significantly reduced the virus titer. 2+ Combined use increased viral titer ( Fig. 9 ).

[0065] (6) Twenty BALB / c mice were divided into four groups, each with five mice, namely, a blank control group, a VACV-WR infection group, a ciclopirox treatment group (10 mg / kg), and a ciclopirox treatment virus infection group (10 mg / kg). The mice were anesthetized with isoflurane at 5 × 10 5 The virus was inoculated intranasally at a concentration of pfu / ml, and the mice were treated with daily medication after infection, and the survival rate of the mice was recorded.

[0066] The results showed that ciclopirox treatment of virus-infected mice significantly improved the survival rate compared with the VACV-WR infected group ( Fig.10 ).

[0067] Example 2

[0068] Effects of the compound ciclopirox on the replication of vaccinia virus VACV-MVA

[0069] DF-1 cells were cultured in DMEM medium containing 10% FBS and 100U / ml penicillin-streptomycin at 37°C in a 5% CO2 incubator. DF-1 cells were infected with VACV-MVA (MOI=3) and incubated for 2h, the virus solution was discarded, washed twice with PBS, and replaced with maintenance medium containing 5μM, 10μM, and 20μM ciclopirox, and cultured for 48h, while DMSO was used as a control. The virus was collected and the virus titer was measured on DF-1 cells.

[0070] The results showed that ciclopirox significantly inhibited viral replication compared with the DMSO control ( Fig.11 ).

[0071] Example 3

[0072] Effects of the compound ciclopirox on the replication of bovine lumpy skin disease virus (LSDV)

[0073] MDBK cells were cultured in DMEM medium containing 10% FBS and 100U / ml penicillin-streptomycin, and cultured in a 37°C, 5% CO2 incubator. MDBK cells were collected for use. MDBK cells were infected with LSDV (MOI = 0.01), incubated for 2 hours, the virus solution was discarded, washed twice with PBS, and replaced with maintenance medium containing 0.5μM, 1μM, and 3μM ciclopirox, and cultured for 48 hours. DMSO was used as a control. The virus was collected and the virus titer was measured on MDBK cells.

[0074] The results showed that cyclopyrimethamine significantly inhibited the replication of LSDV in a concentration-dependent manner, with the most significant inhibitory effect at 3 μM ( Fig.12 ).

[0075] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. The application of cyclopyrisulfide in the preparation of anti-acne virus drugs.

2. Use of ciclopirox in the preparation of drugs for preventing and / or treating diseases related to poxvirus infection.

3. The application according to claim 2, characterized in that: The poxvirus infection-related diseases include at least one of the following: smallpox, bovine nodular dermatitis, monkeypox and fowlpox.

4. The use according to claim 1 or 2, characterized in that: The poxviruses include orthopoxvirus and / or capripoxvirus.

5. The application according to claim 4, characterized in that: The orthopoxvirus genus includes vaccinia virus.

6. The use according to claim 4, characterized in that: The capripoxvirus genus includes the bovine lumpy skin disease virus.

7. The use according to claim 1 or 2, characterized in that: The medicine includes injection solution and / or injection powder.

8. The use according to claim 1 or 2, characterized in that: The medicine includes medicine for human use and / or medicine for animal use.

9. The use according to claim 1 or 2, characterized in that: When the poxvirus is vaccinia virus, the effective concentration of ciclopirox in the drug is not less than 5 μM.

10. The use according to claim 1 or 2, characterized in that: When the poxvirus is bovine nodular dermatosis virus, the effective concentration of ciclopirox in the drug is not less than 1 μM.

Images