Application of cyclopyrimethamine in the preparation of anti-pox virus drugs

Abstract

This invention provides the application of ciclopiroxamide in the preparation of anti-poxvirus drugs, belonging to the field of biomedical technology. The application of ciclopiroxamide in the preparation of anti-poxvirus drugs. This invention demonstrates for the first time that ciclopiroxamide possesses highly efficient anti-poxvirus activity, inhibiting the infection of host cells by orthopoxvirus and goatpoxvirus genera, while simultaneously inhibiting poxvirus replication. Therefore, ciclopiroxamide can be used in the treatment and drug development of poxvirus-related diseases. This invention opens up new avenues for the use of ciclopiroxamide, providing a new means for the treatment of poxvirus-related diseases in the livestock industry and biomedical fields.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of ciclopirox amide in the preparation of anti-vaccinia virus drugs. Background Technology

[0002] Viral infections not only threaten human health but also cause severe economic losses to the livestock industry. Different viruses exhibit significant differences in their transmission and replication mechanisms within the host. Poxviruses are among the most important pathogens infecting humans and animals; common poxviruses include smallpox virus and monkeypox virus. Currently, the FDA has approved two candidate drugs for treating smallpox: tecovirimat and brincidofovir. Although tecovirimat has shown good efficacy in treating monkeypox infections, clinical trial data is limited, and it is prone to developing resistance. The clinical efficacy of brincidofovir in treating monkeypox is also not optimistic. Therefore, identifying new and effective antiviral compounds is crucial for developing drugs targeting poxviruses.

[0003] Cilopirox ethanolamine (CPX-O) is a drug used to treat fungal skin infections and vaginal candidiasis. It exerts its inhibitory effect on various enzymes by chelating iron ions. In recent years, studies have shown that cilopirox ethanolamine possesses anticancer activity and is used to treat cervical cancer, breast cancer, and liver cancer, making it a potential anticancer drug candidate. Currently, there are no reports on cilopirox ethanolamine's anti-poxvirus activity. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide the use of ciclopiroxamide in the preparation of an anti-vaccinia virus drug, wherein ciclopiroxamide achieves the purpose of anti-vaccinia virus by inhibiting the replication and infection of cells by various vaccinia viruses.

[0005] This invention provides the use of ciclopiroxamide in the preparation of anti-vaccinia virus drugs.

[0006] This invention provides the use of ciclopiroxamide in the preparation of medicaments for the prevention and / or treatment of poxvirus infection-related diseases.

[0007] Preferably, the poxvirus infection-related diseases include at least one of the following: smallpox, bovine nodular dermatitis, monkeypox, and fowlpox.

[0008] Preferably, the poxvirus includes the genera *Orthopoxvirus* and / or *Goatpoxvirus*.

[0009] Preferably, the orthopoxvirus genus includes vaccinia virus.

[0010] Preferably, the goatpoxvirus genus includes bovine nodular dermatovirus.

[0011] Preferably, the drug comprises an injection solution and / or an injection powder.

[0012] Preferably, the drug includes human drugs and / or animal drugs.

[0013] Preferably, when the poxvirus is a vaccinia virus, the effective concentration of ciclopirox amide in the drug is not less than 5 μM.

[0014] Preferably, when the poxvirus is bovine nodular dermatovirus, the effective concentration of ciclopirox amine in the drug is not less than 1 μM.

[0015] This invention provides the application of ciclopiroxamide in the preparation of anti-poxvirus drugs. This invention demonstrates for the first time that the iron chelating agent ciclopiroxamide possesses highly efficient anti-poxvirus activity, inhibiting the infection of host cells by three viruses (vaccinia virus WR strain, vaccinia virus MVA strain, and bovine nodular dermatovirus) from the genera orthopoxvirus and goatpoxvirus. The results of the examples show that ciclopiroxamide can effectively inhibit vaccinia virus WR strain infection of host cells, inhibiting the virus by chelating iron ions; 5–20 μM ciclopiroxamide can effectively inhibit vaccinia virus MVA strain infection of host cells; when the drug concentration is as low as 0.5–3 μM, it inhibits LSDV infection of host cells in a concentration-dependent manner, providing new theoretical basis for further research on anti-poxviruses. Simultaneously, animal experiments show that 10 mg / kg ciclopiroxamide treatment of poxvirus-infected mice can effectively reduce the mortality rate of mice. This invention opens up new avenues for the use of ciclopiroxamide, providing a new means for the treatment of poxvirus-related diseases in the livestock industry and biomedical fields. Attached Figure Description

[0016] Figure 1 Figure 1 shows the results of different concentrations of ciclopiroxamide inhibiting VACV-WR replication (MOI = 0.01) in HeLa cells;

[0017] Figure 2 Figure 1 shows the cytotoxicity of different concentrations of ciclopiroxamide on HeLa cells;

[0018] Figure 3 Figure showing the results of different concentrations of ciclopiroxamide inhibiting VACV-WR replication (MOI=3) in HeLa cells;

[0019] Figure 4 Figure 1 shows the results of different concentrations of ciclopiroxamide inhibiting VCV-WR replication in A549 cells;

[0020] Figure 5 The diagram shows the results of cyclopyridamole inhibiting the transcription of the early gene E3L mRNA.

[0021] Figure 6The diagram shows the results of cyclopyridamole inhibiting the transcription of the mid-term gene D13L mRNA;

[0022] Figure 7 The diagram shows the results of cyclopyridamole inhibiting the transcription of the late-stage gene A3L mRNA;

[0023] Figure 8 The diagram shows the results of cyclopyridamole inhibiting DNA synthesis.

[0024] Figure 9 Figure showing the results of cyclopyridamole inhibiting VCV-WR replication;

[0025] Figure 10 This is a graph showing the survival curve results for mice;

[0026] Figure 11 Figure showing the results of cyclopyridamole inhibiting VACV-MVA replication;

[0027] Figure 12 The figure shows the results of cyclopyridamole inhibiting LSDV replication. Detailed Implementation

[0028] This invention provides the use of ciclopiroxamide in the preparation of anti-vaccinia virus drugs.

[0029] In this invention, the molecular formula of the cyclopyridine is C1 12 H 17 NO2.C2H7NO has the structure shown in Formula 1. In this embodiment of the invention, the cyclopyridine was purchased from Selleck, catalog number S3019.

[0030]

[0031] In this invention, the poxvirus preferably includes the genera *Orthopoxvirus* and / or *Capepoxvirus*. The *Orthopoxvirus* genus preferably includes vaccinia virus. The vaccinia virus includes vaccinia virus WR strain (VACV-WR) and vaccinia virus MVA strain (VACV-MVA). The *Capepoxvirus* genus preferably includes bovine nodular dermatitis virus.

[0032] In this invention, the drug preferably comprises an injection solution and / or an injection powder. The drug preferably comprises a human drug and / or a veterinary drug. This invention does not impose any particular limitation on the species of animal; any species of poxvirus-infected animals well-known in the art can be used, such as African rodents (e.g., African squirrels, tree squirrels, Gambian kangaroos, dormice, etc.), primates (e.g., monkeys, chimpanzees, etc.) and other mammals (gerbils, marmots, squirrels, rabbits, dogs, cats, etc.).

[0033] In this invention, the effective inhibitory concentration of ciclopiroxamide varies for different types of poxviruses: when the poxvirus is vaccinia virus, the effective concentration of ciclopiroxamide in the drug is preferably not less than 5 μM, and can be 10 μM, 15 μM, 20 μM, 30 μM, 40 μM, and 50 μM. When the poxvirus is bovine nodular dermatosis virus, the effective concentration of ciclopiroxamide in the drug is preferably not less than 1 μM, and can be 2 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, etc. Ciclopiroxamide inhibits poxvirus infection activity by reducing host cell cytopathic effects caused by the poxvirus, lowering viral titers in cells, and inhibiting poxvirus replication. Ciclopiroxamide inhibits poxvirus replication by chelating iron ions.

[0034] In one embodiment of this invention, using VCV-WR as the infecting virus, different host cells (HeLa cells and A549 cells) were infected with viral solutions of different titers (0.01 MOI and 3 MOI) to verify the efficacy of ciclopirox amide. The results showed that 10–50 μM ciclopirox amide effectively reduced cytopathic effects and viral titers, and the degree of infection inhibition was dose-dependent. This invention also investigated the effect of ciclopirox amide on viral replication. The results showed that ciclopirox amide significantly inhibited the expression of mid-to-late stage genes and suppressed viral DNA replication, indicating that ciclopirox amide has the ability to inhibit poxvirus replication. Furthermore, in vivo pharmacodynamic experiments were conducted using a mouse model infected with poxvirus. The results showed that compared with the VCV-WR infection group, ciclopirox amide treatment significantly improved the survival rate of virus-infected mice. Cytotoxicity tests showed that ciclopirox amide concentrations of 10–50 μM maintained cell viability above 50%, indicating that ciclopirox amide has low cytotoxicity.

[0035] In another embodiment of the present invention, using VACV-MVA and LSDV as infecting viruses, host cells (DF-1 cells and MDBK cells) were infected with viral fluids of different titers (0.01 MOI and 3 MOI) to verify the efficacy of ciclopirox amide. The results showed that, compared with the control, ciclopirox amide significantly inhibited viral replication; 5, 10, and 20 μM ciclopirox amides could all effectively inhibit VACV-MVA virus infection; at the same time, 1 and 3 μM ciclopirox amides could both inhibit LSDV replication in a concentration-dependent manner.

[0036] This invention also provides the use of ciclopiroxamide in the preparation of medicaments for the prevention and / or treatment of poxvirus infection-related diseases.

[0037] In this invention, the poxvirus infection-related diseases preferably include at least one of the following: smallpox, bovine nodular dermatitis, monkeypox, and fowlpox.

[0038] The following examples illustrate the application of ciclopiroxamine provided by the present invention in the preparation of anti-vaccinia virus drugs, but these examples should not be construed as limiting the scope of protection of the present invention.

[0039] Example 1

[0040] Effect of the compound cyclopyridamole on the replication of vaccinia virus VACV-WR

[0041] (1) Hela, A549 and BSC cells were cultured in DMEM medium containing 10% FBS and 100 U / ml penicillin and streptomycin in a 37°C, 5% CO2 incubator.

[0042] BSC cells were seeded with 0.01 MOI VCV-WR. After 48 h of infection, cells were scraped off, the virus was collected, and the cells were centrifuged at 2500 rpm for 5 min, and the supernatant was discarded. Cells were resuspended in 10 mM Tris-Cl (pH 9.0), transferred to a glass homogenizer, and the cell suspension was lysed by grinding (on ice). The cells were centrifuged at 300 g and 4 °C for 5 min, and the supernatant was stored. The supernatant was sonicated, and 36% sucrose was added to a sterile centrifuge tube. The sonicated lysis buffer was added to a 36% sucrose pad, and the cells were centrifuged at 33000 g for 80 min. The supernatant was discarded, and the virus particles were resuspended in 1 mM Tris-Cl (pH 9.0) and stored at -80 °C for later use.

[0043] HeLa cells were infected with 0.01 MOI VCV-WR and incubated for 2 h. The virus solution was discarded, and the cells were washed twice with PBS. The medium was then replaced with maintenance medium containing ciclopiroxamide at concentrations of 10 μM, 20 μM, and 50 μM. The cells were cultured for another 48 h, with DMSO as a control. The virus was harvested, and the viral titer was determined on BSC cells. The viral titer was calculated using 1 × 10⁻⁶ cells. 5 BSC cells were seeded into 6-well plates and incubated at 37°C in a 5% CO2 incubator. The virus was diluted to 10-1 -4 10 -5 10 -6 Inoculate into 6-well plates. After 1–2 hours of infection, discard the virus solution and replace it with DMEM medium containing 0.75% methylcellulose. Continue culturing for 48 hours. Discard the medium and add 1 ml of 0.1% crystal violet to each well. Incubate at room temperature for 20 minutes. Discard the crystal violet, wash the 6-well plate with water, and calculate the virus titer by counting plaques in the wells according to Formula I.

[0044] Virus titer (PFU / ml) = number of empty plaques × virus dilution factor ÷ inoculation volume (ml) Formula I.

[0045] Simultaneously, this embodiment also conducted a median transtoxicity (MTT) assay to detect the effect of cyclopyridine on cytotoxicity. HeLa cells were seeded in 96-well plates at 10,000 cells per well and cultured overnight at 37°C in a 5% CO2 incubator. The culture medium was discarded, and different concentrations of cyclopyridine (10, 20, and 50 μM) were added, followed by 48 h of further culture. The supernatant was discarded, and 90 μL of fresh DMEM medium was added to each well, followed by 10 μL of 0.5% MTT solution. The plates were then cultured at 37°C in a 5% CO2 incubator for 4 h. After discarding the supernatant, 110 μL of Formazan solution was added, and the plates were shaken at low speed for 10 min. The absorbance was read at 490 nm. Zeroing wells (culture medium, MTT, and Formazan solution) and control wells (cells, drug solution of the same concentration, culture medium, MTT, and Formazan solution) were also set up.

[0046] The results showed that, compared with the DMSO group, ciclopirox amide reduced cytopathic effects and significantly decreased viral titers, with 50 μM showing the most significant inhibitory effect on the virus. Figure 1 ), ciclopiroxamide has relatively low cytotoxicity ( Figure 2 ).

[0047] (2) HeLa cells were infected with 3 MOI VCV-WR and incubated for 2 h. The virus solution was discarded, and the cells were washed twice with PBS. The culture medium was then replaced with maintenance medium containing 10 μM, 20 μM, and 50 μM ciclopiroxamine and cultured for another 24 h. DMSO was used as a control. The virus was collected and the viral titer was measured on BSC cells.

[0048] The results showed that, compared with the DMSO group, ciclopirox amide reduced cytopathic effects and significantly decreased viral titers in a concentration-dependent manner, with 50 μM showing the most significant inhibitory effect on the virus. Figure 3 ).

[0049] (3) Infect A549 cells with 0.01 MOI VCV-WR, incubate for 2 h, discard the virus solution, wash twice with PBS, and replace with maintenance medium containing ciclopiroxamine at drug concentrations of 10 μM, 20 μM, and 50 μM. Continue culturing for 48 h, with DMSO as a control. Collect the virus and determine the viral titer on BSC cells.

[0050] The results showed that, compared with the DMSO group, 50 μM ciclopirox amide significantly inhibited viral replication. Figure 4 ).

[0051] (4) HeLa cells were infected with 3 MOI VACV-WR and incubated for 2 hours. The virus solution was discarded, and the cells were washed twice with PBS. Fresh medium containing DMSO and 50 μM cyclopyridine was added, and the cells were cultured for another 2 hours and 8 hours. Cell samples were collected, RNA was extracted, and reverse transcribed into cDNA. The mRNA transcription levels of the early gene E3L, the mid-stage gene D13L, and the late gene A3L were detected using qPCR. The primer sequences are as follows:

[0052] E3L-F:TGACAGGGTTAGCACCTTTCCAATC (SEQ ID NO: 1);

[0053] E3L-R:CGGATGCTGATGCTATGGCTGAC (SEQ ID NO: 2);

[0054] D13L-F: GATAGCCTGATTGTCTGGACCATCG (SEQ ID NO: 3);

[0055] D13L-R:AACGGTCTAATGTCTTCGCAGTCG (SEQ ID NO: 4);

[0056] A3L-F: CTATAGACAAAATAGAAGCC (SEQ ID NO: 5);

[0057] A3L-R: CCATGATTAGAAAAGCAATTATG (SEQ ID NO: 6).

[0058] A 20 μL reaction system was established using the above primers: 10 μL Green qPCR SuperMix, 0.4 μL each of forward and reverse primers, 2 μL cDNA, and 7.2 μL ddH2O. Reaction program: 94℃ pre-denaturation for 30 s, 94℃ denaturation for 5 s, 60℃ annealing for 30 s, 40 cycles. Melting curve: from 60℃ to 95℃ at a rate of 4.4℃ / s.

[0059] HeLa cells were infected with 3 MOI VACV-WR and incubated for 2 hours. After incubation, the virus solution was discarded, and the cells were washed twice with PBS. The incubator was then replaced with fresh medium containing DMSO and ciclopiroxamide, respectively. Cell samples were collected 8 hours after infection to extract DNA. The effect on viral DNA replication was analyzed using qPCR. The primer sequences are as follows:

[0060] E11L-F:ACCGACGATGTATGTGCCTC (SEQ ID NO:7);

[0061] E11L-R: CAAACAGCAAGGGTTCGTCA (SEQ ID NO:8).

[0062] Establish a 20 μL reaction system: 10 μL Green qPCR SuperMix, 0.4 μL each of forward and reverse primers, 2 μL cDNA, and 7.2 μL ddH2O. Reaction program: 94℃ pre-denaturation for 30 s, 94℃ denaturation for 5 s, 60℃ annealing for 30 s, 40 cycles. Melting curve: from 60℃ to 95℃ at a rate of 4.4℃ / s.

[0063] The results showed that, compared with DMSO, cyclopyridine significantly inhibited the E3L gene ( Figure 5 ), D13L ( Figure 6 ) and A3L transcription ( Figure 7 ), and inhibited DNA replication ( Figure 8 ).

[0064] (5) Infect HeLa cells with 0.01 MOI VCV-WR, incubate for 2 h, discard the virus solution, wash twice with PBS, and replace with PBS containing Fe. 2+ , ciclopiroxamine and ciclopiroxamine + Fe 2+ The cells were cultured in maintenance medium for another 48 hours, with DMSO as a control. Virus was harvested and viral titer was measured on BSC cells. Results showed that ciclopirox methylparaben significantly reduced viral titer. The ciclopirox methylparaben, in combination with 50 μM Fe... 2+ Combined application increased viral titer ( Figure 9 ).

[0065] (6) Twenty BALB / c mice were divided into four groups of five mice each: a blank control group, a VCV-WR infection group, a ciclopirox methylformamide treatment group (10 mg / kg), and a ciclopirox methylformamide virus infection treatment group (10 mg / kg). Mice were anesthetized with isoflurane and treated with 5 × 10⁻⁶ mice. 5 Mice were inoculated with pfu / ml via intranasal administration of the virus, and treated daily after infection, with survival rates recorded.

[0066] The results showed that, compared with the VCV-WR infection group, treatment with ciclopirox olamine significantly improved the survival rate of virus-infected mice. Figure 10 ).

[0067] Example 2

[0068] Effect of the compound cyclopyridamole on the replication of vaccinia virus VACV-MVA

[0069] DF-1 cells were cultured in DMEM medium containing 10% FBS and 100 U / ml penicillin and streptomycin at 37°C in a 5% CO2 incubator. DF-1 cells were infected with VCV-MVA (MOI=3) and incubated for 2 h. The virus solution was discarded, and the cells were washed twice with PBS. The medium was then replaced with maintenance medium containing 5 μM, 10 μM, and 20 μM ciclopiroxamide, and cultured for another 48 h. DMSO was used as a control. The virus was harvested, and the viral titer was measured on the DF-1 cells.

[0070] The results showed that, compared with the DMSO control, ciclopirox amide significantly inhibited viral replication. Figure 11 ).

[0071] Example 3

[0072] Effects of the compound cyclopyridamole on bovine nodular dermatitis virus (LSDV) replication

[0073] MDBK cells were cultured in DMEM medium containing 10% FBS and 100 U / ml penicillin and streptomycin at 37°C in a 5% CO2 incubator. MDBK cells were then collected for later use. They were infected with LSDV (MOI = 0.01) and incubated for 2 hours. The virus solution was discarded, and the cells were washed twice with PBS. The medium was then replaced with maintenance medium containing 0.5 μM, 1 μM, and 3 μM ciclopiroxamide, and cultured for another 48 hours. DMSO was used as a control. The virus was collected, and the viral titer was measured on the MDBK cells.

[0074] The results showed that ciclopirox amide significantly inhibited the replication of LSDV virus in a concentration-dependent manner, with the most significant inhibitory effect observed at 3 μM. Figure 12 ).

[0075] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The use of ciclopiroxamide in the preparation of anti-poxvirus drugs, wherein the poxvirus is at least one of the following: vaccinia virus WR strain, vaccinia virus MVA strain, and bovine nodular dermatosis virus.

2. The use of ciclopiroxamide in the preparation of medicaments for the prevention and / or treatment of poxvirus-related diseases, wherein the poxvirus is at least one of the following: vaccinia virus WR strain, vaccinia virus MVA strain, and bovine nodular dermatitis virus, wherein the poxvirus-related disease is smallpox and / or bovine nodular dermatitis.

3. The application according to claim 1 or 2, characterized in that, The drug includes injectable solutions and / or injectable powders.

4. The application according to claim 1 or 2, characterized in that, The drugs include drugs for human use and / or drugs for animal use.

5. The application according to claim 1 or 2, characterized in that, When the poxvirus is a vaccinia virus WR strain or a vaccinia virus MVA strain, the effective concentration of ciclopirox amide in the drug is not less than 5 μM.

6. The application according to claim 1 or 2, characterized in that, When the poxvirus is bovine nodular dermatovirus, the effective concentration of ciclopirox amide in the drug is not less than 1 μM.

Images