Lactobacillus paracasei and breast milk oligosaccharide composition capable of synergistically preventing and treating Alzheimer disease

Abstract

The invention provides a lactobacillus paracasei and breast milk oligosaccharide composition capable of synergistically preventing and treating Alzheimer's disease, the active ingredients of the composition comprise lactobacillus paracasei L9 and breast milk oligosaccharide, the L9 strain is preserved in the China General Microbiological Culture Collection Center (CGMCC), the classification name is lactobacillus paracasei, the preservation number is CGMCC No.9800, the preservation number is CGMCC No.9800, the preservation number is CGMCC No.9800, and the preservation number is CGMCC No.9800. The preservation date is October 22, 2014. In the composition disclosed by the invention, the lactobacillus paracasei and the breast milk oligosaccharide have potential interaction, can cooperate with each other and can play a synergistic role, and reference indexes are provided for industrial production of the probiotic and prebiotic compound composition by improving spatial learning and memory disorder, synaptic plasticity disorder and neuroinflammation. And theoretical basis and data support are provided for popularization and application of the probiotic and prebiotic compound composition in the field of prevention and treatment of Alzheimer's disease.

Description

Technical Field

[0001] The invention belongs to the technical field of new application of microorganisms, and particularly relates to a Lactobacillus paracasei and human milk oligosaccharide composition capable of synergistically preventing and treating Alzheimer's disease. Background Art

[0002] Alzheimer's disease (AD), as a chronic neurodegenerative disease, has brought a heavy burden to global human health. It is mainly manifested by a persistent and irreversible decline in cognitive function, with patients gradually losing key abilities such as memory, thinking and reasoning.

[0003] From a pathological perspective, the prominent features of AD include abnormal deposition of amyloid-β and hyperphosphorylation of Tau protein. At the same time, factors such as intestinal flora imbalance, neuroinflammation and damage to the blood-brain barrier are also closely related to the pathogenesis of AD. However, despite the great efforts of researchers around the world, an effective method to completely cure Alzheimer's disease has not yet been found.

[0004] In terms of drug treatment, although many attempts have been made to develop drugs for the treatment of AD, only a few drugs have been approved for clinical practice in China. Cholinesterase inhibitors such as atordolinepezil, rivastigmine, galantamine, huperzine A, N-methyl-β-D-aspartate receptor antagonist memantine, as well as ginkgo leaf extract tablets and oligomannolate sodium capsules (GV-971) are currently the main clinical drug options. However, these drugs can only relieve patients' symptoms to a certain extent, but cannot effectively prevent the deterioration of the disease. This is mainly because when most patients are diagnosed and start drug treatment, the disease has often developed to the mid-stage. At this time, although drug intervention can reduce the level of Aβ or Tau protein in the brain to a certain extent, it is difficult for drugs to effectively repair and regenerate those dead neurons and damaged synapses.

[0005] With the increasing incidence of Alzheimer's disease, coupled with the increasingly prominent limitations of existing drug treatments and the gradual emergence of drug side effects, it has become a top priority to actively explore new methods to prevent and alleviate Alzheimer's disease in the field of food science.

[0006] In the study of improving Alzheimer's disease, probiotics and prebiotics each show unique advantages. Probiotics can accurately regulate the structure of intestinal flora and significantly increase the number and proportion of beneficial bacteria in the intestine. These beneficial bacteria can effectively regulate the activities of the human peripheral and central nervous systems through various communication pathways such as vagus nerve and adrenergic nerve activation, as well as self-synthesis and secretion of neurotransmitters, neuropeptides and endocrine hormones. Prebiotics can selectively promote the growth and metabolic activity of beneficial bacteria and stimulate the production of beneficial metabolites such as short-chain fatty acids, thereby providing strong support for improving cognitive impairment. Probiotics and prebiotics are mild in nature and highly adaptable, suitable for long-term use by people of different physiques, and have broad application prospects in the prevention and auxiliary treatment of AD. However, the current research on the combination of Lactobacillus paracasei and human milk oligosaccharides in the prevention and relief of Alzheimer's disease is still in a blank stage and urgently needs in-depth exploration and development. Summary of the invention

[0007] In view of the problems existing in the prior art, the purpose of the present invention is to explore the synergistic therapeutic effect of probiotics and prebiotics, and provide a Lactobacillus paracasei and human milk oligosaccharide composition with synergistic prevention and treatment of Alzheimer's disease. In order to provide reference indicators for the industrial production of probiotics and prebiotics composite compositions, and also provide theoretical basis and data support for the promotion and application of probiotics and prebiotics composite compositions in the field of prevention and treatment of Alzheimer's disease.

[0008] The objective of the present invention is achieved through the following technical solutions: In a first aspect of the present invention, a Lactobacillus paracasei and human milk oligosaccharide composition having the synergistic effect of preventing and treating Alzheimer's disease is provided, wherein the active ingredients of the composition include Lactobacillus paracasei L9 and human milk oligosaccharide; The Lactobacillus paracasei is named L9, and the strain is preserved in the General Microbiological Center of China Microbiological Culture Collection Administration Committee, and is classified and named Lactobacillus paracasei. Lactobacillus paracasei , the deposit number is CGMCC No.9800, and the deposit date is October 22, 2014; In the composition, the final therapeutic dose of Lactobacillus paracasei L9 is a viable bacterial count of not less than 5.0×10 9 CFU / d / kg body weight.

[0009] Furthermore, the human milk oligosaccharide comprises human milk oligosaccharide extract, 2'-FL, 3'-SL and LNnT.

[0010] Furthermore, in the composition, the final therapeutic dose of Lactobacillus paracasei L9 is 5.0×10 9 ~5.0×10 10 CFU / d / kg.

[0011] Furthermore, in the composition, the final therapeutic dose of human milk oligosaccharides is 2-5 mg / d / g body weight.

[0012] Furthermore, the dosage form of the composition includes lyophilized powder, capsule, tablet or granule.

[0013] The second aspect of the present invention provides the use of the Lactobacillus paracasei and human milk oligosaccharide composition described in the first aspect in the preparation of a product for preventing and treating Alzheimer's disease.

[0014] Furthermore, the product is any one of food, health care product, medicine or feed.

[0015] Furthermore, the application is one or more of the following: (1) The application can improve spatial learning and memory disorders; (2) The application can improve synaptic plasticity disorders; (3) The application can improve neuroinflammation.

[0016] The third aspect of the present invention provides a probiotic composition, comprising the Lactobacillus paracasei and human milk oligosaccharide composition having the synergistic effect of preventing and treating Alzheimer's disease as described in the first aspect.

[0017] Furthermore, the probiotic composition also includes a medically acceptable carrier.

[0018] Strain preservation information: Lactobacillus paracasei L9, the strain is deposited in the General Microbiology Center of China Microbiological Culture Collection Administration (CGMCC), address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101; the classification name is Lactobacillus paracasei Lactobacillus paracasei The deposit number is CGMCC No.9800 and the deposit date is October 22, 2014. Compared with the prior art, the present invention has the following beneficial effects:

[0019] 1. The present application combines Lactobacillus paracasei L9 with human milk oligosaccharides to achieve synergistic effects and treat Alzheimer's disease by improving spatial learning and memory disorders, synaptic plasticity disorders, and neuroinflammation, which has important practical significance for the development of highly effective Alzheimer's disease drugs; 2. Compared with the prior art, the present invention combines probiotics and prebiotics, which can act on the central nervous system from two aspects. The components of the Lactobacillus paracasei and human milk oligosaccharides are clear and safe. Among them, Lactobacillus paracasei is responsible for regulating the intestinal flora, increasing the abundance of beneficial bacteria in the intestine, and then controlling the activities of the peripheral and central nervous systems. Human milk oligosaccharides can promote the growth and / or activity of beneficial bacteria, and increase the production of beneficial metabolites (such as short-chain fatty acids) to improve cognitive impairment. This combination can not only improve the therapeutic effect, but also reduce the dependence on a single treatment method and reduce the risk of side effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The present invention will be further described below in conjunction with the accompanying drawings and embodiments: Figure 1 The chromatographic peaks of 2'-FL, 3'-SL and LNT standard substances are shown; Figure 2 The results show that the binding of Lactobacillus paracasei L9 to human milk oligosaccharide 2'-FL was 5.0×10 9 The results of the combination of CFU / d / kg and 2 mg / d / g in treating spatial learning and memory disorders in Alzheimer's disease mice; A is an example of the trajectory of mice in the water maze experiment, B is the escape latency in the water maze experiment, C is the number of platform shuttles in the water maze experiment, D is the platform residence time in the water maze experiment, E is the number of target hole explorations in the Barnes maze, F is the target hole exploration time in the Barnes maze, G is an example of the trajectory of mice in the new object recognition experiment, H is the new object recognition index, and I is the proportion of the number of entries into the new arm in the Y maze experiment; Figure 3 The results show that the binding of Lactobacillus paracasei L9 to human milk oligosaccharide 2'-FL was 5.0×10 9 Results of the combination of CFU / d / kg and 2 mg / d / g in treating synaptic plasticity disorders in Alzheimer's disease mice; Figure 4 The results show that the binding of Lactobacillus paracasei L9 to human milk oligosaccharide 2'-FL was 5.0×10 9 Results of the combination of CFU / d / kg and 2 mg / d / g in treating neuroinflammation in Alzheimer's disease mice; A is the relative expression of IL-6, and B is the relative expression of IL-1β; Figure 5 The results of comparative example 1 in which Lactobacillus paracasei L9 was used to treat spatial learning and memory disorders in mice with Alzheimer's disease were shown; wherein A is the escape latency in the water maze experiment, B is the number of platform shuttles in the water maze experiment, C is the platform residence time in the water maze experiment, D is the number of target hole explorations in the Barnes maze, and E is the target hole exploration time in the Barnes maze; Figure 6 The results of comparative example 2, human milk oligosaccharide 2'-FL, in treating spatial learning and memory disorders in Alzheimer's disease mice are shown; wherein A is the escape latency in the water maze experiment, B is the number of platform shuttles in the water maze experiment, C is the platform residence time in the water maze experiment, D is the new object recognition index, and E is the proportion of the number of entries into the new arm in the Y maze experiment. DETAILED DESCRIPTION

[0021] The implementation of the present invention is not limited to the following embodiments, and any form of modification and / or change made to the present invention will fall within the scope of protection of the present invention. In the present invention, unless otherwise specified, all equipment and raw materials can be purchased from the market or are commonly used in the industry. Unless otherwise specified, the methods used in the embodiments are common techniques in the art.

[0022] For numerical ranges, the endpoints of each range, the endpoints of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be deemed to be specifically disclosed herein.

[0023] In the following examples, Lactobacillus paracasei L9 was deposited in the General Microbiological Center of China Microbiological Culture Collection Administration (CGMCC), address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing; it was classified and named Lactobacillus paracasei Lactobacillus paracasei The deposit number is CGMCC No.9800 and the deposit date is October 22, 2014. The strain was derived from the feces of centenarians in Bama, Guangxi, China. Other chemical reagents used were purchased from regular chemical reagent suppliers and were analytically pure.

[0024] In the following examples, the culture medium formulations involved include: The modified MRS liquid culture medium has a formula of: 10 g of peptone, 5 g of yeast extract powder, 20 g of glucose, 10 g of beef extract, 2 g of K2HPO4, 2 g of diammonium citrate, 0.58 g of MgSO4·7H2O, 0.25 g of MnSO4·4H2O, 5 g of anhydrous sodium acetate, 1 mL of Tween 80, 0.5 g of cysteine ​​hydrochloride, distilled water to 1 L, pH adjusted to 6.5, and sterilized at 121°C for 15 min. Example 1: Microbial culture preparation

[0025] 1) Preparation of Lactobacillus paracasei L9 bacteria: A probiotic strain was obtained by isolating the feces of centenarians in Bama, Guangxi, and was identified as Lactobacillus paracasei Lactobacillus paracasei, deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC No.9800 and the deposit date being October 22, 2014.

[0026] The isolated Lactobacillus paracasei L9 was subcultured twice in a modified MRS liquid medium, then inoculated into a modified MRS liquid medium at a 2% inoculum and cultured for 12 h at 37 ± 1 °C and 0% oxygen concentration. The supernatant was removed by centrifugation (4000 rpm, 10 min), and the cells were washed twice with PBS. When gavage was performed, the cells were resuspended in 0.9% saline and the concentration of the bacterial suspension was adjusted to 5.0 × 10 9 CFU / g. Example 2: Preparation of human milk oligosaccharides

[0027] This embodiment provides a method for extracting human milk oligosaccharide extract, which specifically comprises the following steps: Breast milk samples of healthy Chinese women (aged between 25 and 30 years old, all secretory people, no history of infectious diseases) during 1-3 months of lactation were collected and frozen at -80 °C for batch extraction. After thawing, the breast milk samples were mixed, centrifuged at 12,000 g, 4 °C for 20 min, the upper fat was removed, and the whey was collected. It was filtered through a 10 KD ultrafiltration membrane through an ultrafiltration device to remove residual fat and a large amount of protein. The filtrate was collected, and 2 times the volume of anhydrous ethanol was added according to the volume ratio. After mixing, it was allowed to stand at 4 °C for 12 hours. After centrifugation at 12,000 g, 4 °C for 20 min, the supernatant was collected, and most of the ethanol solution was removed by rotary evaporation. The remaining aqueous solution was freeze-dried to obtain the crude HMO sample and stored at -80 °C.

[0028] The crude HMO sample obtained in the previous step was dissolved in pure water at a concentration of 20 mg / mL. The crude HMO product solution was separated by an industrially prepared chromatographic column filled with porous graphitized carbon to remove salt and lactose. The chromatographic conditions were as follows: mobile phase A was ultrapure water, mobile phase B was acetonitrile containing 0.1% trifluoroacetic acid, and the flow rate was 250 mL / min. The elution program was as follows: 0-40 min, 0% B; 40-80 min, 1% B; 80-120 min, 80% B. According to the retention properties of the filler, the substances that flowed out before 80 min were lactose and small molecule salts, and the substances that flowed out from 80-120 min were HMO. This part of the fraction was recovered, and after rotary evaporation and freeze-dried, it was the purified HMO pure product and stored at -80 ℃.

[0029] The purified HMO obtained in the above steps was dissolved in ultrapure water at a concentration of 50 mg / mL, and the endotoxin removal column (Cat. No. 88277, Thermo Fisher, USA) was taken out, centrifuged at 500 g for 1 min to remove the internal liquid, rinsed with ultrapure water 3 times, added 10 mL of sample, incubated at room temperature for 1 hour, centrifuged at 500 g for 1 min, recovered the filtrate, and lyophilized. After the removal column was used up, it was soaked in 2M sodium hydroxide for 2 hours to regenerate the column. Each removal column can be used at least 5 times. The lyophilized HMO was weighed and prepared into a 10 mg / mL solution. Quantitative analysis was performed using a commercially available endotoxin detection kit (Cat. No. E039-1-1, Nanjing Jiancheng Bioengineering Institute) to determine the endotoxin removal effect.

[0030] The endotoxin-free HMO was dissolved in 50% anhydrous ethanol solution to prepare a 10 mg / mL solution. The detection was carried out on a quadrupole-time-of-flight liquid-mass spectrometer. The chromatographic conditions were as follows: the chromatographic column was an epoxy aspartic acid column (10×150 mm, 5 μm, Dalian Institute of Chemical Physics), the mobile phase A was ultrapure water, the mobile phase B was acetonitrile, and the elution conditions were: 0-40 min, 80%-50% B; 40-45 min, 20% B; 45-55 min, 80% B. The mass spectrometry conditions were: negative ion mode, dryer temperature 350°C, sheath gas flow rate 8 L / min, collision voltage 30 V, primary mass spectrometry scanning 300-2000 m / z per second, secondary mass spectrometry scanning 50-2000 m / z per second. The peak position on the chromatographic peak was determined based on 2'-FL, 3'-SL and LNT standard substances (such as Figure 1 As shown), the human milk oligosaccharide extract was then chromatographically separated by purified liquid chromatography, and 2'-FL, 3'-SL and LNnT were obtained after freeze-drying.

[0031] The isolated human milk oligosaccharide 2'-FL was used for subsequent animal experiments. When administered orally, it was resuspended in 0.9% saline and adjusted to a concentration of 200 mg / mL. Based on the weight of the mice, the daily oral dose was 2 mg / kg body weight. Example 3: Preparation of animal model and animal experiment

[0032] In this example, an animal experiment was used to evaluate the synergistic effect of Lactobacillus paracasei L9 and human milk oligosaccharide 2'-FL composition. The experimental animals were 5×FAD mice (5-month-old, male) purchased from Albumin Biotechnology (Wuhan) Co., Ltd.

[0033] The animal experiment was divided into two groups, namely the model group and the mixed group of Lactobacillus paracasei L9 and human milk oligosaccharide 2'-FL, with 6 mice in each group, for a total of 12 mice.

[0034] The mice were kept in the following conditions: temperature 24°C, 12h light, 12h dark, and the bedding was changed every three days. The mice were fed for one week and weighed once a week.

[0035] The model group was gavaged with 0.9% saline until the end of the experiment; The intervention group was gavaged with 5.0×10 9 The mixed group of Lactobacillus paracasei L9 (CFU / d / kg) and human milk oligosaccharide 2'-FL (2 mg / d / g) was gavaged for 10 weeks. Test Example 1: Detection of spatial learning and memory impairment in mice with Alzheimer's disease

[0036] This test example measures the Morris water maze escape latency, platform shuttle times and platform stay time of each group of experimental animals in Example 3; the Barnes maze target hole exploration times and target hole exploration time; the new object recognition index in the new object recognition experiment; and the proportion of the number of entries into the new arm of the Y maze. The specific methods and results are as follows: Morris water maze escape latency, platform shuttle times and platform stay time determination: Phase 1: Acquisition training. The pool is divided into four quadrants, and the platform is placed in the center of one of the quadrants. The mouse is placed in the water with its head facing the pool wall, and the placement position is randomly selected from one of the four starting positions of east, west, south, and north. The time it takes for the animal to find the underwater platform is recorded. In the first few training sessions, if this time exceeds 60s, guide the animal to the platform and let the animal stay on the platform for 15s.

[0037] Phase 2: Exploration training. The day after the last acquisition training, the platform was removed and a 60-second exploration training session was started. The animal was placed in the water on the opposite side of the original platform quadrant.

[0038] The following indicators were recorded as spatial memory detection indicators: Escape latency (s): the total time from when the animal entered the water to when it successfully climbed onto the platform; Number of platform crossings: the number of times the animal crossed the original platform; Time spent on the platform (s): The time the animal stayed on the original platform.

[0039] Determination of the number of explorations and time of the target hole in the Barnes maze test: Phase 1: Animals were trained from the 1st to the 5th day. The animals were placed in the start box to restrict their activities for 1 minute, and the start box was lifted to start the experiment. The experiment lasted for 4 minutes. If the animal successfully found the target hole during the exploration, the experiment stopped automatically. If the animal did not find the target hole, it was guided to the target hole and allowed to jump into the target hole by itself. It was taken out after 1 minute of adaptation. At the same time, the escape box and platform needed to be cleaned with 75% alcohol to remove the odor.

[0040] Phase 2: On the 6th day, the animals were placed in the start box to restrict their activities for 1 minute, and the start box was lifted to start the experiment. The experimental time was 4 minutes.

[0041] The number of target hole explorations and the target hole exploration time were recorded as detection indicators of spatial memory.

[0042] Determination of novel object recognition index in novel object recognition experiment: Phase 1: Training. The day before the experiment, mice were placed in an empty arena for familiarization, and each mouse was familiarized for 10 min. During the training period, two identical objects were first placed in the arena, and mice were placed from a fixed position, at the same distance from the two objects, with their backs facing the objects. After 10 min, the mice were taken out for rest, and the test began 1 h later.

[0043] Phase 2: Testing phase. One of the objects was replaced with a new object, and the mouse was placed in the same position. The exploration time of the mouse on the two objects was recorded within 10 minutes as shown in the figure. After the test was completed, the discrimination index was calculated according to the formula. The calculation formula is: Discrimination index = new object / (new object + old object) × 100%.

[0044] Determination of the proportion of entries into the novel arm of the Y-maze experiment: Phase 1: Exploration. Randomly select one arm as the novel arm and block it with a partition, allowing the experimental animal to freely explore the remaining two arms for 10 minutes; Phase 2: Test. This was conducted 2 hours after the end of the exploration phase. All arm doors were opened, and an arm other than the novel arm was randomly selected as the starting arm. The mice were allowed to freely explore among the three arms for 10 min, and the number of times the mice entered the novel arm was recorded. Each mouse was returned to the cage after the test, and the Y maze was deodorized with 75% alcohol.

[0045] The performance of the intervention group was compared with that of the model group, e.g. Figure 2 The results showed that after 10 weeks of intervention with Lactobacillus paracasei L9 and human milk oligosaccharide 2'-FL, Alzheimer's disease mice showed improvement in spatial learning and memory. In the water maze experiment, compared with the model group, the heat map of the movement trajectory of Alzheimer's disease mice during the experiment showed that the mice basically moved around the escape platform and could not find the escape platform, while the movement trajectory of the intervention group mice was mainly around the escape platform ( Figure 2 Middle A); The escape latency of mice in the intervention group was significantly reduced by 20.9 seconds ( Figure 2 Middle B); the number of platform shuttles increased significantly by 4 times ( Figure 2 Middle C); platform stay time increased significantly by 21.7 seconds ( Figure 2In the Barnes experiment, compared with the model group, the number of target hole probes in the intervention group increased significantly by 3 times ( Figure 2 Middle E); target hole exploration time significantly increased by 16.5 seconds ( Figure 2 Middle F). In the new object recognition experiment, the discrimination index of mice in the intervention group increased significantly by 17.94% ( Figure 2 Middle H), Example of the trajectory of mice in the new object recognition experiment ( Figure 2 In the Y-maze, the intervention group increased the number of entries into the novel arm by 6.5% ( Figure 2 The results showed that the combination of Lactobacillus paracasei L9 and human milk oligosaccharide 2'-FL improved the spatial learning and memory impairment in Alzheimer's disease mice. Test Example 2: Determination of synaptic plasticity-related genes in Alzheimer's disease mice

[0046] This test example further measured the expression of the postsynaptic density protein-95 (PSD-95) gene in the hippocampal tissue of each group of experimental animals in Example 3. The specific method and results are as follows: After the behavioral experiment, the experimental animals in each group were decapitated and hippocampal tissue was obtained. Real-time fluorescence quantitative PCR was performed after total RNA extraction and reverse transcription. The samples to be tested and the target gene wells were arranged on paper, the cDNA + water premix system was arranged in rows, and the primer + enzyme premix system was arranged in columns. The reaction system is as follows: a total of 20 μL, containing 10 μL SYBR enzyme, 0.5 μL of upstream and downstream primers, 7 μL of sterile enzyme-free water, and 2 μL of template cDNA. According to the above reaction system ratio, the number of sample wells to be tested was calculated and there was a surplus of about 5 wells for premixing.

[0047] The primers used are arranged in order from 5' to 3'. The genes include: GAPDH-F: AAGCCCATCACCATCTTCCA (SEQ ID NO: 1); GAPDH-R: CACCAGTAGACTCCACCGACA (SEQ ID NO: 2); PSD95-F:TCAGACGGTCACGATCATCGCT (SEQ ID NO:3); PSD95-R: GTTGCTTCGCAGAGATGCAGTC (SEQ ID NO: 4).

[0048] The program settings are as follows:

[0049] RT-qPCR was used to measure the expression of the reference gene GAPDH and the target gene PSD-95 in the model group and the intervention group. [-△（△Ct）] The relative expression of mRNA was calculated using the formula.

[0050] The specific calculation method is as follows: ①△Ct = Ct of target gene mean - Reference gene Ct mean , get the △Ct value of each sample; ② Calculate the mean of △Ct of the control group, then △(△Ct)=(△Ct) 各样本 - (△Ct) 对照组均值 After 10 weeks of intervention with Lactobacillus paracasei L9 and human milk oligosaccharide 2'-FL in Alzheimer's disease mice, the expression of PSD-95 gene was significantly increased (increased by 1.85 times) compared with the model group ( Figure 3 ). The results showed that the combination of Lactobacillus paracasei L9 and human milk oligosaccharide 2'-FL improved synaptic plasticity disorders in Alzheimer's disease mice. Test Example 3: Determination of neuroinflammation-related genes in Alzheimer's disease mice

[0051] This test example uses RT-qPCR to measure the expression of IL-6 and IL-1β genes in the hippocampus of mice in the model group and intervention group of Example 3. Real-time fluorescence quantitative PCR was performed after total RNA extraction and reverse transcription. The samples to be tested and the target gene wells were arranged on paper, the cDNA + water premix system was arranged in rows, and the primer + enzyme premix system was arranged in columns. The reaction system is as follows: a total of 20 μL of the system, containing 10 μL of SYBR enzyme, 0.5 μL of upstream and downstream primers, 7 μL of sterile enzyme-free water, and 2 μL of template cDNA. According to the above reaction system ratio, calculate the number of sample wells to be tested and premix with a surplus of about 5 wells.

[0052] The primers used are arranged in order from 5' to 3'. The genes include: GAPDH-F: AAGCCCATCACCATCTTCCA (SEQ ID NO: 1); GAPDH-R: CACCAGTAGACTCCACCGACA (SEQ ID NO: 2); IL-6-F: TACCACTTCACAAGTCGGAGGC (SEQ ID NO:5); IL-6-R: CTGCAAGTGCATCATCGTTGTTC (SEQ ID NO:6); IL-1β-F: TGGACCTTCCAGGATGAGGACA (SEQ ID NO:7); IL-1β-R: GTTCATCTCGGAGCCTGTAGGTAGGT (SEQ ID NO: 8).

[0053] The program settings are as follows:

[0054] RT-qPCR was used to measure the expression of the reference gene GAPDH and target genes IL-6 and IL-1β in the model group and intervention group. [-△（△Ct）] The relative expression of mRNA was calculated using the formula.

[0055] The specific calculation method is as follows: ①△Ct = Ct of target gene mean - Reference gene Ct mean , get the △Ct value of each sample; ② Calculate the mean of △Ct of the control group, then △(△Ct)=(△Ct) 各样本 - (△Ct) 对照组均值 like Figure 4 The results showed that the combination of Lactobacillus paracasei L9 and human milk oligosaccharides significantly reduced the gene expression of IL-6 (reduced by 5 / 9) and IL-1β (reduced by 3 / 4). The results showed that the combination of Lactobacillus paracasei L9 and human milk oligosaccharides 2'-FL had an improving effect on neuroinflammation in Alzheimer's mice. Comparative Example 1

[0056] In this comparative example, the microbial culture preparation was carried out according to the method described in Example 1 to prepare the resuspension of Lactobacillus paracasei L9, and the intervention group was gavaged with 1.0×10 10 Animal experiments were conducted with Lactobacillus paracasei L9 at CFU / d / kg and brain cognitive function was evaluated using Morris water maze and Barnes maze. Figure 5 As shown in the figure, the behavioral performance of mice in the intervention group was improved compared with that in the model group. After 10 weeks of intervention with Lactobacillus paracasei L9, mice with Alzheimer's disease had improved spatial learning and memory. In the water maze experiment, the escape latency of mice in the intervention group was reduced by 11.46 seconds compared with the model group ( Figure 5 Middle A, p >0.05, the average of the model group was 31.34 seconds, and the average of the intervention group was 19.88 seconds); the number of platform shuttles increased significantly by 2 times ( Figure 5 Middle B, p<0.05, the model group averaged 3 times, and the intervention group averaged 5 times); the platform stay time increased by 8.34 seconds ( Figure 5 Middle C, p >0.05, the average of the model group was 32.75 seconds, and the average of the intervention group was 41.09 seconds); in the Barnes experiment, compared with the model group, the number of target hole probes of the intervention group mice increased significantly by 2.5 times ( Figure 5 Middle D, p <0.05, the model group averaged 4 times, and the intervention group averaged 6.5 times); the target hole exploration time was significantly increased by 13.737 seconds ( Figure 5 Middle E, p <0.05, average 7.493 seconds in the model group and 21.487 seconds in the intervention group).

[0057] The results showed that Lactobacillus paracasei L9 improved the spatial learning and memory impairment of Alzheimer's disease mice, but its effect was not as good as that of Lactobacillus paracasei L9 (5.0×10 9 CFU / d / kg) and human milk oligosaccharide 2'-FL composition. Comparative Example 2

[0058] In this comparative example, the extraction of human milk oligosaccharides and the preparation of human milk oligosaccharide 2'-FL solution were carried out according to the method described in Example 2. The intervention group was gavaged with 2 mg / d / g human milk oligosaccharide 2'-FL for animal experiments in the same way as in Example 3, and the Morris water maze, novel object recognition, and Y maze were used to evaluate brain cognitive function. Figure 6 As shown in the figure, the behavioral performance of mice in the intervention group was improved compared with that in the model group. After 10 weeks of intervention with human milk oligosaccharide extract, mice with Alzheimer's disease had improved spatial learning and memory. In the water maze experiment, the escape latency of mice in the intervention group was reduced by 12.22 seconds compared with the model group ( Figure 6 Middle A, p >0.05, the average of the model group was 31.34 seconds, and the average of the intervention group was 19.12 seconds); the number of platform shuttles increased significantly by 3 times ( Figure 6 Middle B, p <0.05, the average of 3 times in the model group and 6 times in the intervention group); the platform stay time increased by 13.02 seconds ( Figure 6 Middle C, p >0.05, the average of the model group was 32.75 seconds, and the average of the intervention group was 45.77 seconds); in the new object recognition experiment, compared with the model group, the discrimination index of the mice in the intervention group for new objects increased significantly by 13.83% ( Figure 6 Middle D, p <0.05, the average discrimination index of the model group was 40.64%, and the average discrimination index of the intervention group was 54.47%); in the Y-maze experiment, the number of entries into the novel arm increased by 2.69% compared with the model group ( Figure 6 Middle E, p >0.05, the average of the model group was 36.24%, and the average of the intervention group was 38.93%). The results showed that the human milk oligosaccharide extract alone improved the spatial learning and memory impairment of Alzheimer's disease mice, but its effect was not as good as the combination of Lactobacillus paracasei L9 and human milk oligosaccharide 2'-FL (2 mg / kg / d) in Example 3.

[0059] In summary, Lactobacillus paracasei L9 and human milk oligosaccharide composition can treat Alzheimer's disease by improving spatial learning and memory disorders, improving synaptic plasticity and neuroinflammation.

[0060] Finally, it should be noted that the above is only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred arrangement scheme, a person skilled in the art should understand that the technical solution of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A Lactobacillus paracasei and human milk oligosaccharide composition having the synergistic effect of preventing and treating Alzheimer's disease, characterized in that: The active ingredients of the composition include Lactobacillus paracasei and human milk oligosaccharides; The Lactobacillus paracasei is named L9, and the strain is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration Committee and is classified as Lactobacillus paracasei. Lactobacillus paracasei , the deposit number is CGMCC No.9800, and the deposit date is October 22, 2014; In the composition, the final therapeutic dose of Lactobacillus paracasei L9 is a viable bacterial count of not less than 5×10 9 CFU / d / kg body weight.

2. The composition according to claim 1, characterized in that In the composition, the human milk oligosaccharide comprises human milk oligosaccharide extract, 2'-FL, 3'-SL and LNnT.

3. The composition according to claim 1, characterized in that In the composition, the final therapeutic dose of Lactobacillus paracasei L9 is 5.0×10 9 ~5.0×10 10 CFU / d / kg.

4. The composition according to claim 1, characterized in that In the composition, the final therapeutic dose of human milk oligosaccharides is 2-5 mg / d / g body weight.

5. The composition according to any one of claims 1 to 4, characterized in that The dosage form of the composition includes lyophilized powder, capsule, tablet or granule.

6. Use of the composition according to any one of claims 1 to 5 in preparing a product for preventing and treating Alzheimer's disease.

7. The use according to claim 6, characterized in that The product is any one of food, health care product, medicine or feed.

8. The use according to claim 6, characterized in that The application is one or more of the following: (1) The application can improve spatial learning and memory disorders; (2) The application can improve synaptic plasticity disorders; (3) The application can improve neuroinflammation.

9. A probiotic composition, characterized in that A composition comprising the Lactobacillus paracasei and human milk oligosaccharide having the synergistic effect of preventing and treating Alzheimer's disease as claimed in any one of claims 1 to 5.

10. The probiotic composition according to claim 9, characterized in that Medically acceptable carriers are also included.

Images