A combination of african swine fever virus (ASFV) proteins and a vaccine prepared therefrom

Abstract

The application discloses a kind of African swine fever virus ASFV protein combination and vaccine prepared by it.The present application provides African swine fever virus protein combination, it includes at least 3 combinations in the following 4 proteins;The 4 proteins are EP84R protein or its truncation, D129L protein or its truncation, E146L protein or its truncation and K421R protein or its truncation.The present application uses the recombinant virus or subprotein vaccine or mRNA vaccine constructed by African swine fever virus EP84R, D129L, E146L, K421R, after immunizing pig, can make immune pig to the infection of ASFV Play a resistance role, immune pig can completely resist the attack of ASFV virulent and not be ill, can protect susceptible pigs from natural infection or artificial attack of ASFV, for the prevention of African swine fever.

Description

Technical Field

[0001] This invention belongs to the field of veterinary biological products technology, and relates to a combination of African swine fever virus (ASFV) proteins and a vaccine prepared therefrom. Background Technology

[0002] African swine fever (ASF) is a highly contagious, febrile, hemorrhagic, and fatal infectious disease of pigs caused by the African swine fever virus (ASFV). The mortality rate of acute infection can reach 100%, making it a major threat to the pig industry in my country and globally, causing significant losses in endemic areas. Due to insufficient safety or efficacy, neither inactivated nor live vaccines prepared with the ASF virus have been approved for marketing. Control of ASF has traditionally relied primarily on culling and carcass removal, along with strict biosecurity measures.

[0003] The African swine fever virus genome is 170-193 kb in length and contains 160-234 ORFs, which are estimated to encode approximately 165 proteins. To date, a large number of genes, including multi-gene families, have been discovered that are related to viral virulence, immunosuppression, and apoptosis. Studies suggest that the virulence factors of African swine fever virus include 9GL, UK, I177L, I226R, A137R, L60L, etc. (Lewis et al., 2000) (Zsak et al., 1998) (O'Donnell et al., 2015) (Borca et al., 2020), immunosuppressive factors include MGF100, MGF110, MGF300, MGF360, and MGF505, etc. (Afonso et al., 2004) (Li et al., 2021) (Reis et al., 2016), and hemoadsorption factors such as CD2v and EP153R, etc. (Rodriguezet et al., 1993). In recent years, attenuated vaccine strains with deletions in virulence genes such as MGF360, MGF505, CD2v, UK, and A238L of ASFV, as well as naturally attenuated strains isolated from domestic or wild pig populations, have been shown to provide some immunoprotective effects in pigs. However, some strains have been shown to cause chronic lesions in field trials, such as skin ulcers, fever, joint swelling, runts, abortion in sows, and abnormal clinical symptoms during the fattening period (King et al., 2011; Leitao et al., 2001; Revilla et al., 1992, personal communication). Artificially deleted viral strains, such as MGF / CD2v, I177L, I226R, A137R, and UK, have shown good immunogenicity. However, these gene-deleted live vaccines have exhibited significant adaptive mutations after application to target animals, leading to decreased immunity levels and the occurrence of various diseases in vaccinated and non-immunized pig populations. Therefore, gene-deleted live vaccines pose significant biosafety risks. Recombinant vaccines and subunit vaccines constructed using some genes of ASFV, such as p30, p54, and p72, have been reported to have certain immunizing effects, but no vaccines with better effects have been widely used.

[0004] Therefore, discovering effective target proteins and exploring safer and more effective new vaccines has always been an important and practical issue facing the prevention and control of African swine fever in the pig industry. Summary of the Invention

[0005] The technical problem solved by this invention is to provide a new African swine fever vaccine.

[0006] To address the aforementioned technical problems, in a first aspect, the present invention provides an African swine fever virus protein combination, comprising at least three of the following four proteins: EP84R protein or a truncated form thereof, D129L protein or a truncated form thereof, E146L protein or a truncated form thereof, and K421R protein or a truncated form thereof.

[0007] In one embodiment of the present invention, the truncated EP84R protein (fEP84L) is amino acid position 16-70 of the EP84L protein;

[0008] The truncated D129L protein (fD129LR) is located at positions 30-90 of the D129L protein amino acid sequence;

[0009] The truncated E146L protein (fE146L) is amino acid position 25-105 of the E146L protein sequence;

[0010] The truncated form of the K421R protein (fK421R) is located at positions 58-300 of the K421R protein amino acid sequence.

[0011] The African swine fever virus protein combination described above also includes other protein combinations;

[0012] The other protein combination consists of at least one of the following proteins: B646L, E183L, CP204L, and CP2457L.

[0013] The above protein combinations can be combinations of individual proteins or fusion proteins obtained by co-expressing multiple proteins.

[0014] In embodiments of the present invention, the above-mentioned protein combination is any one of the following:

[0015] 1) EP84R, D129L, K421R;

[0016] 2) EP84R, E146L, K421R;

[0017] 3) D129L, E146L, K421R;

[0018] 4)EP84R, D129L, E146L, K421R;

[0019] 5)EP84R, D129L, E146L, K421R, B646L

[0020] 6)EP84R, D129L, E146L, K421R, E183L, B646L

[0021] 7)EP84R, D129L, E146L, K421R, CP204L, E183L, B646L

[0022] 8)EP84R, D129L, E146L, K421R, CP2457L, CP204L, E183L, B646L;

[0023] 9) fEP84, fD129LR, fE146L, fK421R;

[0024] 10) EP84R, D129L, E146L;

[0025] The aforementioned proteins or their truncated forms are derived from African swine fever virus; the truncated forms have the same function as the full-length ones.

[0026] The proteins EP84R, D129L, E146L, K421R, B646L, E183L, CP204L, and CP2457L mentioned above are the proteins shown in GenBank accession number MH766894.3 (submitted on July 12, 2023), or they can be proteins obtained by adding tags to the ends of the amino acid sequences of each protein.

[0027] The aforementioned proteins can be products expressed by recombinant vector viruses, or products expressed by recombinant vectors or cells such as Escherichia coli, yeast, animal cells, or plant cells.

[0028] Secondly, the present invention provides a combination of African swine fever virus nucleic acids, which includes at least three of the following four nucleic acids; the four nucleic acids are the nucleic acids encoding EP84R protein or its truncated form, D129L protein or its truncated form, E146L protein or its truncated form, and K421R protein or its truncated form.

[0029] In the African swine fever virus nucleic acid combination described above, the nucleic acid molecule is DNA or mRNA.

[0030] The aforementioned nucleic acid molecules can be any of the following: the natural sequence of the ASFV gene, the same PCR amplified sequence, the same or degenerate artificially synthesized sequence, or a sequence that has been optimized or truncated but still encodes the protein products of the gene.

[0031] The aforementioned protein-coding nucleic acids can be combined individually, or multiple protein-coding nucleic acids can be linked together through a linker to form a fusion gene.

[0032] Thirdly, the present invention provides a nucleic acid delivery vector or a group of nucleic acid delivery vectors containing any three or four of the following four nucleic acids;

[0033] The four nucleic acids are the nucleic acids encoding EP84R protein or its truncated form, D129L protein or its truncated form, E146L protein or its truncated form, and K421R protein or its truncated form.

[0034] In the above text, the nucleic acid delivery carrier can be lipid nanoparticles or other nucleic acid delivery carriers.

[0035] The aforementioned lipid nanoparticles can be used to create a combination of four mRNA vaccines, as shown in Table 19 of the examples. Each mRNA vaccine has a titer of 10. 8.0 TCID 50 / ml mixture, each mRNA vaccine is a lipid nanoparticle containing the African swine fever virus nucleic acid combination described in the second aspect.

[0036] In the nucleic acid delivery vector or group of nucleic acid delivery vectors described above, the nucleic acid is mRNA.

[0037] Each of the above mRNAs is obtained by transcribing the coding nucleic acid of each protein or its truncated form.

[0038] In an embodiment of the present invention, the preparation is specifically carried out as follows: the 5'UTR, the protein or its truncated form encoding nucleic acid, the 3'UTR and polyA are tandemly cloned into the fragment between the kpn I and xba I sites of the T7 promoter-containing transcription plasmid pGEM-3zf(+) to obtain a recombinant transcription plasmid; then, after digestion with Hind III, the mRNA is obtained by transcription.

[0039] Fourthly, the present invention provides a recombinant viral combination comprising a recombinant virus or recombinant viral group expressing any three or four of the following four nucleic acids;

[0040] The recombinant virus is a recombinant virus obtained by packaging a recombinant vector expressing any 3 or 4 of the following 4 nucleic acids;

[0041] The recombinant viral group is a recombinant viral group composed of recombinant viruses obtained by packaging recombinant vectors expressing one or more nucleic acids respectively;

[0042] The four nucleic acids are the nucleic acids encoding EP84R protein or its truncated form, D129L protein or its truncated form, E146L protein or its truncated form, and K421R protein or its truncated form.

[0043] Each gene can be distributed individually or in multiples on each recombinant virus; that is, each recombinant virus can express a single gene or a coupled gene consisting of multiple genes.

[0044] The above-mentioned recombinant virus combinations can be combinations of viruses with the same type of vector or combinations of viruses with different types of vectors.

[0045] In the recombinant virus combination described above, the recombinant vector is derived from human adenovirus type 5, poxvirus, porcine pseudorabies virus, porcine reproductive and respiratory syndrome virus, porcine adenovirus, porcine encephalitis virus, classical swine fever virus, retrovirus, paramyxovirus, or lactic acid bacteria, but is not limited to these; each vector can produce transient infection, stable infection, or continuous expression of exogenous genes in pigs without causing any abnormal clinical symptoms.

[0046] In embodiments of the present invention, examples are as follows:

[0047] Recombinant adenovirus is obtained by transfecting cells with a recombinant adenovirus vector expressing the full-length or partial target gene and the backbone plasmid pacAd59.2-100, followed by packaging. A recombinant adenovirus set can consist of 1, 3, or 4 recombinant adenovirus combinations, with each virus used at a concentration of ≥10-1. 8.0 TCID 50 ; as shown in Tables 4, 5, 8 or 11 in the examples. The recombinant adenovirus vector can express one or more target genes in full length or in part.

[0048] Recombinant PRRS virus is obtained by transfecting cells with a recombinant PRRS virus vector expressing the target gene and then packaging the recombinant PRRS virus. A recombinant PRRS virus set can consist of four combinations of recombinant PRRS viruses, with each virus used in quantities of ≥10-1. 8.0 TCID 50 ; as shown in Table 14 of the embodiments.

[0049] Recombinant pseudorabies virus (PRV) is obtained by transfecting cells with a recombinant PRV vector expressing the target gene and then packaging the PRV. A recombinant PRV genome can be a combination of four PRVs, with each virus used at a concentration of ≥10-1. 8.0 TCID 50 ; as shown in Table 17 of the embodiments.

[0050] The recombinant virus group can also be a combination of 4 recombinant PRRSVs and 4 recombinant pseudorabies viruses. This recombinant virus group is administered in two doses: first, the recombinant PRRSV combination is administered, followed by the recombinant pseudorabies virus combination. The titer of each recombinant PRRSV is 10. 5.5 TCID 50 Mix in equal proportions of / ml, with each recombinant pseudorabies virus having a titer of 10. 6.5 TCID 50 Mix in equal proportions of / ml, as shown in Table 18 of the examples;

[0051] Fifthly, the present invention provides a biological material, which is any of the following:

[0052] 1) A recombinant vector group or recombinant vector expressing the African swine fever virus protein combination described in the first aspect;

[0053] 2) A recombinant microbiome or recombinant microorganism expressing the African swine fever virus protein combination described in the first aspect;

[0054] 3) Recombinant cell groups or recombinant cells expressing the combination of African swine fever virus proteins described in the first aspect.

[0055] The aforementioned recombinant vectors are recombinant vectors obtained by inserting one or more nucleic acids into an expression vector;

[0056] The aforementioned recombinant vector group is a recombinant vector group composed of the aforementioned recombinant vectors;

[0057] The aforementioned nucleic acids can be either full-length protein-encoding nucleic acids or protein truncated versions that encode nucleic acid fragments.

[0058] Each nucleic acid is distributed individually or in multiples on different recombinant vectors; that is, each recombinant vector can express a single nucleic acid or multiple nucleic acid-coupled genes. Protein-coding nucleic acids and protein truncated nucleic acid fragments can be constructed individually into recombinant vectors or cells that can express proteins in pigs, or two or more protein-coding nucleic acids or protein truncated nucleic acid fragments can be cloned separately or together in a fusion form into the same recombinant vector or cell.

[0059] The aforementioned expression vectors include, but are not limited to: human adenovirus type 5, poxvirus, porcine pseudorabies virus, porcine reproductive and respiratory syndrome virus, porcine adenovirus, porcine encephalitis virus, classical swine fever virus, rabies virus, retrovirus, paramyxovirus, or other viral or bacterial vector systems that can produce transient infection, stable infection, or continuous expression of exogenous genes in mammals without causing any abnormal clinical symptoms.

[0060] In embodiments of the present invention, the recombinant vector is exemplified by a recombinant adenovirus vector, a recombinant porcine reproductive and respiratory syndrome virus vector (recombinant porcine reproductive and respiratory syndrome virus vector), or a recombinant porcine pseudorabies virus vector.

[0061] In a sixth aspect, the present invention provides the following applications of the African swine fever virus protein combination described in the first aspect, the African swine fever virus nucleic acid combination described in the second aspect, the nucleic acid delivery vector or nucleic acid delivery vector group described in the third aspect, the recombinant virus combination described in the fourth aspect, or the biological material described in the fifth aspect:

[0062] 1) To prepare products for the treatment of diseases caused by African swine fever virus infection;

[0063] 2) Prepare products for inducing an immune response to African swine fever virus antigens;

[0064] 3) Prepare products for preventing diseases caused by African swine fever virus infection;

[0065] 4) Prepare products to combat African swine fever virus.

[0066] The products described are vaccines, pharmaceuticals, compositions, or other biological products. The vaccines mentioned above may also include adjuvants, immune enhancers, immunomodulators, or other vaccines.

[0067] The aforementioned adjuvants can be salt adjuvants such as aluminum glue, different polysaccharide adjuvants, biological protein adjuvants, nucleic acid adjuvants, or nanomaterial adjuvants, etc.; in the embodiments of the present invention, the adjuvant is further described as a polysaccharide adjuvant, specifically Poria cocos polysaccharide or Schisandra chinensis polysaccharide.

[0068] The vaccines mentioned above are subunit vaccines, nucleic acid vaccines, or recombinant virus vaccines.

[0069] In a seventh aspect, the present invention provides African swine fever products, including any of the following:

[0070] 1) The African swine fever virus protein combination described in the first aspect;

[0071] 2) The second aspect: African swine fever virus nucleic acid combination;

[0072] 3) The nucleic acid delivery vector or nucleic acid delivery vector set described in the third aspect;

[0073] 4) The recombinant virus combination described in the fourth aspect;

[0074] 5) The biomaterials described in the fifth aspect.

[0075] The recombinant virus combination in the above-mentioned products or vaccines can be any combination of three or more recombinant viruses, mixed together in a certain proportion for direct use or for use in batches.

[0076] This invention also provides a method for preventing African swine fever virus, which involves immunizing animals with the aforementioned product. In an embodiment of this invention, the recombinant viruses in the product are mixed in a certain proportion before immunization.

[0077] This invention provides a combination of recombinant viruses containing the ASFV gene and a vaccine prepared therefrom. Specifically, it utilizes the EP84R, D129L, E146L, and K421R proteins of ASFV as target genes to construct recombinant viruses or recombinant bacteria with different viral or bacterial vectors. These combinations of recombinant viruses or recombinant bacteria with different genes can be used directly after mixing the cultured viral or bacterial cultures in equal or different proportions, or mixed with adjuvants and immune enhancers. Immunizing susceptible animals can show good immune protection against African swine fever virus challenge, protecting susceptible pigs from natural infection or artificial challenge with virulent ASFV, and is used for the prevention of African swine fever.

[0078] The vaccine of this invention can be directly immunized to target animals—pigs, or mixed with adjuvants and immune enhancers before immunization to target animals. Both methods provide good immune protection and can protect susceptible pigs from natural infection or artificial challenge with virulent ASFV, thus preventing African swine fever.

[0079] The beneficial effects of this invention are as follows: The recombinant virus, subprotein vaccine, or mRNA vaccine constructed using African swine fever virus EP84R, D129L, E146L, and K421R can enable immunized pigs to resist ASFV infection after immunization. Immunized pigs can completely resist the attack of virulent ASFV without developing the disease, and can protect susceptible pigs from natural infection or human attack by ASFV, thus preventing African swine fever. Detailed Implementation

[0080] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0081] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0082] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0083] The cells, virus strains, and vectors used in the following examples are as follows:

[0084] 1. HEK293AD cells (purchased from Invitrogen, USA) are stored in our laboratory and must be cultured in DMEM medium (gibco product, catalog number C119955bbBT) or a complete suspension medium containing 1%-10% fetal bovine serum. 2. BHK-21 cells (purchased from the China Institute of Veterinary Drug Inspection) are stored in our laboratory and must be cultured in DMEM medium containing 1%-10% fetal bovine serum or a complete suspension medium. 3. Marc-145 cells (purchased from the China Institute of Veterinary Drug Inspection) are stored in our laboratory and must be cultured in DMEM medium containing 1%-10% fetal bovine serum. 4. Vero cells (purchased from the China Institute of Veterinary Drug Inspection) are stored in our laboratory and must be cultured in DMEM medium containing 1%-10% fetal bovine serum.

[0085] 2. The expression plasmid vector pacAd5 CMVK-NpA (purchased from Invitrogen, USA) and the backbone plasmid pacAd5 9.2-100 (purchased from Invitrogen, USA) for the foreign gene were amplified and extracted in E. coli. The expression plasmid for the foreign gene in stable cell lines was pcDNA3.1 plasmid (purchased from Invitrogen, USA).

[0086] 3. The in vitro transcription vector pGEM-3ZF(+) was purchased from Promega. The 5'UTR, 3'UTR and polyA structures were biosynthesized and subcloned into pGEM-3ZF(+). The recombinant plasmid was then propagated and extracted in E. coli.

[0087] 4. PRRSV-A1 strain (the full-length gene was synthesized by Jilin Kumei Biotechnology Co., Ltd., sequence 59-15453bp) is a rescued attenuated vaccine strain, with the infectious genome cloned in a plasmid.

[0088] 5. The pseudorabies virus strain is the vaccine candidate strain JL14-△gI / gE / TK. The specific construction method is as follows: The virulent JL strain isolated and identified in our laboratory was attenuated by homologous recombination deletion of the gI and gE genes to form the vaccine candidate strain JL14-△gI / gE / TK (described in the following literature: Zhou Xintao. Construction and characterization of pseudorabies virus gene-deleted strain JL14-△gI / gE / TK [D]. Jilin Agricultural University, 2018).

[0089] 6. African swine fever virus strain SY-18 (described in the following literature: Zhou X, Li N, Luo Y, Liu Y, Miao F, Chen T, Zhang S, Cao P, Li X, Tian K, Qiu HJ, Hu R (2018)Emergence of African Swine Fever in China, 2018. Transboundary and emerging diseases 65(6):1482-1484. doi:10.1111 / tbed.12989), was isolated by the Epidemiology Research Laboratory of the Military Veterinary Research Institute in 2018. At the time of isolation, 0.1 ml of sterile pathogenic material (blood) from infected pigs was inoculated into a 25 cm inoculation chamber. 2 Porcine primary alveolar macrophages were cultured in culture flasks at 37°C for 4-6 days, followed by freeze-thaw cycles, and the culture medium was collected. This process was repeated four times, with freeze-thaw cycles followed by culture medium collection. Appropriate amounts were serially diluted, and viral titers were determined on 96-well cell culture plates. The median cellularity (TCID) of the virus was calculated using the Reed-Muench method. 50 Viral titer at 10 6.0 TCID 50 The cultures described above should be retained for future use. The GenBank accession number for the genome sequence of this virus is MH766894.3 (submitted on July 12, 2023). The strain used in this study was a fourth-generation PAM cell-propagated virus, which was aliquoted and stored at -80°C.

[0090] The target genes of African swine fever virus, EP84R, D129L, E146L, and K421R, and their amino acid sequences can be found in GenBank accession number MH766894.3 (submitted on July 12, 2023).

[0091] Example 1: Construction and Immunization Effect of Recombinant Adenoviruses Expressing African Swine Fever Virus EP84R, D129L, E146L, and K421R Genes, Separately

[0092] I. Construction of recombinant adenovirus expressing African swine fever virus EP84R, D129L, E146L, and K421R genes

[0093] The construction of recombinant adenoviruses expressing the EP84R, D129L, E146L, and K421R genes is detailed below (the construction and usage strategies for other replication-defective and reproducible vector DNA viruses are similar):

[0094] 1. Construction of homologous recombination plasmids

[0095] The genome of African swine fever virus strain SY-18 was extracted using conventional methods. Primers for the ASFV EP84R, D129L, E146L, and K421R genes, each containing a homologous arm of the expression plasmid vector pacAd5CMVK-NpA, were designed, as shown in Table 1. Using the SY-18 genome as a template, PCR was performed using the designed primers to amplify the homologous recombinant gene fragments of ASFV EP84R, D129L, E146L, and K421R genes, respectively.

[0096] Table 1 shows the primer sequences for gene amplification of EP84R, D129L, E146L, and K421R.

[0097]

[0098] The following recombinant plasmids were obtained by inserting various homologous recombinant gene fragments between the EcoRI sites of the plasmid pacAd5 CMVK-NpA (human adenovirus type 5 expression vector). Details are as follows:

[0099] The homologous recombination gene fragments of each of the above-mentioned amplified genes were ligated to the EcoRI-digested linearized pacAd5 CMVK-NpA plasmid at a certain ratio, and then transformed into competent E. coli cells for homologous recombination to obtain recombinant plasmids pAdCMV-EP84R, pAdCMV-D129L, pAdCMV-E146L, and pAdCMV-K421R, respectively.

[0100] The recombinant plasmid pAdCMV-EP84R is a plasmid obtained by inserting the EP84R gene into the EcoRI site of the pacAd5 CMVK-NpA plasmid (human adenovirus type 5 expression vector). This plasmid expresses the EP84R gene.

[0101] The recombinant plasmid pAdCMV-D129L is a plasmid obtained by inserting the D129L gene into the EcoRI site of the pacAd5 CMVK-NpA plasmid (human adenovirus type 5 expression vector). This plasmid expresses the D129L gene.

[0102] The recombinant plasmid pAdCMV-E146L is a plasmid obtained by inserting the E146L gene into the EcoRI site of the pacAd5 CMVK-NpA plasmid (human adenovirus type 5 expression vector). This plasmid expresses the E146L gene.

[0103] The recombinant plasmid pAdCMV-K421R is obtained by inserting the K421R gene into the EcoRI site of the pacAd5 CMVK-NpA plasmid (human adenovirus type 5 expression vector), and this plasmid expresses the K421R gene.

[0104] 2. Rescue and identification of recombinant adenoviruses

[0105] The recombinant plasmids pAdCMV-EP84R, pAdCMV-D129L, pAdCMV-E146L, pAdCMV-K421R and the backbone plasmid pacAd59.2-100 were linearized by PacI digestion to obtain four types of digested recombinant plasmids and the digested backbone plasmid pacAd59.2-100.

[0106] Each of the above-mentioned recombinant plasmids after enzyme digestion was mixed at a certain ratio (2 μg) with the enzyme-digested backbone plasmid pacAd59.2-100 (4 μg), and then mixed with 200 μL of transfection reagent. After mixing (2000), add 2 ml of cell culture medium, evenly add to the cell monolayer, and transfect at 25 cm. 2 HEK293AD cells were grown into a monolayer. After 3 days, the transfected cells were passaged. After growing into a monolayer, the cells were transfected a second time according to the above steps.

[0107] Transfect the cells three times following the above steps. When cell lesions such as extensive rounding are observed, freeze-thaw the cells, collect and preserve the freeze-thaw solutions, and label them as P0 generation recombinant adenovirus EP84R, P0 generation recombinant adenovirus D129L, P0 generation recombinant adenovirus E146L, and P0 generation recombinant adenovirus K421R, respectively. Different gene fragments were introduced, and these were labeled as different recombinant viruses. The P0 generation recombinant adenoviruses were then inoculated into 25 cm cells at a specific ratio (MOI value of 0.1). 2 HEK293AD cells (2 × 10⁶ cells) in a cell culture flask (10 ml of fresh culture medium) 6 Two days after the lesion, the virus was frozen and thawed, and the frozen and thawed solution was collected and preserved. This was the P1 generation recombinant adenovirus. The above steps were repeated until the P3 generation recombinant adenoviruses EP84R, D129L, E146L, and K421R were collected.

[0108] 3. Testing

[0109] The titers of each P3 generation recombinant adenovirus were determined as follows: The P3 generation recombinant adenovirus was serially diluted 10-fold (12 dilutions in total), and each dilution was seeded into 8 replicate wells. The cells were then seeded into HEK293AD cells in 96-well plates at a volume of 0.1 ml / well. After incubation at 37°C for 5-6 days, cytopathic effects were observed under a light microscope, and the TCID of the virus was calculated using the Reed-Muench method. 50 .

[0110] The results are shown in Table 2.

[0111] Table 2 shows the titer determination results for each P3 generation recombinant adenovirus.

[0112] Recombinant adenovirus <![CDATA[Titer TCID 50 / mL]]> rAdv-EP84R <![CDATA[10 8.50 ]]> rAdv-D129L <![CDATA[10 8.250 ]]> rAdv-E146L <![CDATA[10 8.875 ]]> rAdv-K421R <![CDATA[10 8.625 ]]>

[0113] Nucleic acid was extracted from each P3 generation recombinant adenovirus, and identification primers (upstream primer: CGCAAATGGGCGGTAGGCGTG, downstream primer: CACTGCATTCTAGTTGTGGTTT) were used to identify the recombinant adenovirus. The expected size of the identification product is shown in Table 1. The fragment amplified to the target size is the target recombinant adenovirus.

[0114] All the recombinant adenoviruses obtained were the target adenoviruses.

[0115] The recombinant adenoviruses expressing the target genes were named rAdv-EP84R, rAdv-D129L, rAdv-E146L, and rAdv-K421R, respectively.

[0116] II. Immunoprotective assay of recombinant adenovirus expressing EP84R, D129L, E146L, and K421R genes.

[0117] 1. Immunoprotective assays for any combination of 2, 3, or 4 of the recombinant adenoviruses containing the EP84R, D129L, E146L, and K421R genes (other replication-defective and replicable vector DNA viruses, as well as other combinations of these genes, and the usage strategies are similar).

[0118] 1) Immunity

[0119] The recombinant adenoviruses obtained above were combined according to the recombinant adenovirus combination forms 2, 3, and 4 shown in Table 4 (each virus used 10... 8.0 TCID 50 Different combinations of vaccines were obtained, with a total volume of 2 ml, and 100 micrograms of Poria cocos polysaccharide were added to each dose of vaccine.

[0120] Poria cocos polysaccharide was prepared as follows: 10 kg of Poria cocos tuber was crushed, soaked in 50 kg of distilled water overnight, heated to 80°C, maintained for 2 hours with constant stirring, and centrifuged at 10000 rpm (centrifugal force 12857 g g) for 15 minutes using a continuous centrifuge to collect the supernatant. The water was evaporated to 1 / 10 of the supernatant volume using a rotary evaporator. A portion of the supernatant was taken, and 1 / 5 volume of petroleum ether was added. The mixture was refluxed at 37°C for 60 min. Anhydrous ethanol was added to the aqueous phase until the final ethanol concentration was 65%. After standing for 1 hour, the mixture was centrifuged at 8000 rpm (8228 g) for 30 min, and the precipitate was collected. The precipitate was resuspended in 0.9% physiological saline (NaCl aqueous solution) with a mass-to-volume ratio (g:ml) to achieve a final concentration of 100 mg / ml, which is Poria cocos polysaccharide.

[0121] Experimental group: Each combination of vaccines with added Poria cocos polysaccharide (each virus used 10) was administered. 8.0 TCID 50 After mixing, add 100 micrograms of Poria cocos polysaccharide to each 2ml dose. Inject 5 pigs intramuscularly. Immune twice, 14 days apart, with the same dose each time.

[0122] Control immunization group: A mixture of recombinant adenoviruses expressing p30, p54, p72, pCD2v, pF317L, pp62, and pp220, and a mixture of recombinant adenoviruses expressing D129L, EP84R, E146L, NP419L, and S273R genes, respectively, were used as controls (each virus was used at 10...). 8.0 TCID 50 After mixing, add 100 micrograms of Poria cocos polysaccharide to each 2ml dose. Inject 5 pigs intramuscularly. Immune pigs were immunized twice, 14 days apart, with the same dosage each time.

[0123] Recombinant adenoviruses expressing p30, p54, p72, pCD2v, pF317L, pp62, and pp220 genes were prepared according to the recombinant adenovirus construction method described in Section I (the sequences of each gene can be found in GenBank accession number: MH766894.3, submission date: July 12, 2023). The template was the genome of African swine fever virus strain SY18. The primer sequences and amplified gene sizes are shown in Table 3.

[0124] Table 3 shows the primer sequences and product sizes for each gene amplification.

[0125]

[0126]

[0127] Recombinant adenovirus was identified using upstream primer (CGCAAATGGGCGGTAGGCGTG) and downstream primer (CACTGCATTCTAGTTGTGGTTT). The expected size of the identified product is shown in Table 3. The amplified fragment of the target size is the target recombinant adenovirus.

[0128] Challenge control group: Five animals were challenged without being injected with any virus.

[0129] Feed them according to their usual routine.

[0130] 2) Attacking the poison

[0131] On the 14th day after the second immunization (referred to as day 1 of the first day of the second immunization), the experimental groups, control immunization group, and challenge control group were challenged with African swine fever virus strain SY18: each head was orally administered 10 mg / L. 3.0TCID 50 / 2ml of highly virulent ASFV strain SY18. Observe the survival rate of pigs.

[0132] The recombinant viruses of each combination and their immune challenge results are shown in Table 4. It can be seen that the recombinant adenoviruses of each combination have obvious protective effects against challenge, which is different from the traditional gene selection reported.

[0133] Table 4 shows the results of immune challenge with different recombinant virus combinations and traditional target protein recombinant viruses.

[0134]

[0135]

[0136] 2. Immunization and challenge assays of recombinant adenovirus combinations expressing EP84R, D129L, E146L, K421R and other genes (5, 6, 7, 8).

[0137] 1) Immunity

[0138] The recombinant adenoviruses obtained above were combined according to the combination forms shown in Table 5 below (each virus was used in 10...). 8.0 TCID 50 Different combinations of vaccines were obtained, with a total volume of 2 ml, and 100 micrograms of Poria cocos polysaccharide were added to each dose of vaccine.

[0139] Experimental group (Group 1): Each combination of vaccines containing the recombinant adenovirus obtained above and supplemented with Poria cocos polysaccharide (each virus used 10... 8.0 TCID 50 After mixing, each dose (2 ml) was further supplemented with 100 micrograms of Poria cocos polysaccharide and injected intramuscularly into 5 pigs. Two immunizations were administered, 14 days apart, with the same dosage each time.

[0140] Experiment + Other Proteomes (Groups 2-5): Mix the various recombinant adenoviruses obtained above with various recombinant adenoviruses expressing other proteins (each virus was used at 10... 8.0 TCID 50 After mixing, each dose (2 ml) was further supplemented with 100 micrograms of Poria cocos polysaccharide and injected intramuscularly into 5 pigs. Two immunizations were administered, 14 days apart, with the same dosage each time.

[0141] The recombinant adenoviruses expressing other proteins are CP2457L, CP204L, E183L, and B646L (prepared according to the recombinant adenovirus construction method in section 1; the sequences of each gene can be found in GenBank accession number: MH766894.3; submission date: July 12, 2023).

[0142] Other combination groups: A mixture of recombinant adenovirus expressing pCD2v, pF317L, pp62, and pp220 respectively, and control group recombinant adenoviruses CP2457L, CP204L, E183L, and B646L (each virus was used at 10...). 8.0 TCID 50 After mixing, each dose (2 ml) was further supplemented with 100 micrograms of Poria cocos polysaccharide and injected intramuscularly into 5 pigs. Two immunizations were administered, 14 days apart, with the same dosage each time.

[0143] Challenge control group: Five animals were challenged without being injected with any virus.

[0144] Feed them according to their usual routine.

[0145] 2) Attacking the poison

[0146] On the 14th day after the second immunization (referred to as day 1 of the first day of the second immunization), the experimental groups, control immunization group, and challenge control group were challenged with African swine fever virus strain SY18: each head was orally administered 10 mg / L. 3.0 TCID 50 / 2ml of highly virulent ASFV strain SY18. Observe for 28 days, and record clinical manifestations and final outcomes.

[0147] The recombinant viruses of each combination and their immune challenge results are shown in Table 5. It can be seen that, after 28 days of observation, all non-immunized control pigs became ill and died, all pigs immunized with the traditional vector vaccine combination died, and all 5 pigs in the other immunized groups survived.

[0148] Table 5 shows the results of immunization of pigs with different recombinant adenoviruses containing more than four gene combinations.

[0149]

[0150] Example 2: Construction and Immunization Effect of Recombinant Adenovirus Expressing Two Gene Fusions of African Swine Fever Virus

[0151] This invention provides the construction and immunogenicity of ASFV two-gene fusion recombinant adenovirus (the construction and combination strategies for other replication-defective and reproducible vector DNA viruses with arbitrary two or more gene fusions are similar), as detailed below:

[0152] I. Construction of ASFV two-gene fusion recombinant adenovirus

[0153] The EP84R gene sequence, linker sequence, and D129L gene tandem sequence were linked together using a synthetic method to obtain a two-gene fusion fragment (EP84R-D129L).

[0154] The E146L gene sequence, linker sequence, and K421R gene tandem sequence were linked together using a synthetic method to obtain a two-gene fusion fragment (E146L-K421R).

[0155] The linker sequence above is: gcaacaaacttctctctgctgaaacaagccggagatgtcgaagagaatcctggaccg.

[0156] Recombinant adenoviruses with two genes were constructed according to the recombinant adenovirus construction method in Example 1: First, the fusion fragments of each gene were amplified to obtain homologous recombination fragments (using the fusion fragments as templates, the primers and product sizes required for amplification are shown in Table 6). These fragments were then constructed into the EcoRI restriction site of the pacAd5 CMVK-NpA plasmid through homologous recombination to obtain recombinant plasmids. The recombinant plasmids and the backbone plasmid pacAd59.2-100 were then transfected into HEK293AD cells, and the freeze-thawed solution was harvested until the P3 generation recombinant adenoviruses with two genes were obtained, which were named rAdv-EP84R-D129L and rAdv-E146L-K421R, respectively.

[0157] Nucleic acid was extracted from P3 generation recombinant adenoviruses expressing various target genes. Recombinant adenoviruses were identified using identification primers (upstream primer: CGCAAATGGGCGGTAGGCGTG, downstream primer: CACTGCATTCTAGTTGTGGTTT). The expected size of the identification product is shown in Table 6. The target size fragment amplified is the target recombinant adenovirus.

[0158] Table 6 shows the primer sequences and product sizes for amplifying the two-gene fusion fragment.

[0159]

[0160] The titers of each recombinant virus were determined using standard methods. For each virus culture, a 10-fold serial dilution was performed, for a total of 12 dilutions. Eight replicates were inoculated into each dilution and seeded onto HEK293AD cells in 96-well plates at a volume of 0.1 ml / well. After incubation at 37°C for 5-6 days, cytopathic effects were observed under a light microscope, and the TCID of the virus was calculated using the Reed-Muench method. 50 The results are shown in Table 7.

[0161] Table 7 shows the titers of fusion recombinant adenoviruses.

[0162] Recombinant adenovirus <![CDATA[Titer TCID 50 / mL]]> rAdv-EP84R-D129L <![CDATA[10 8.375 ]]> rAdv-E146L-K421R <![CDATA[10 8.625 ]]>

[0163] II. Immunoprotective assay using recombinant adenovirus with two gene fusions

[0164] 1. Immunity

[0165] Experimental group: 10 of each of the two-gene fusion recombinant adenoviruses prepared above (as shown in Table 7) were taken respectively. 8.0 TCID 50 Each group was immunized with 100 micrograms of Poria cocos polysaccharide and injected into the neck muscles of pigs. Five pigs were immunized in each group.

[0166] Control immunization group: A mixture of three viruses expressing recombinant adenoviruses p30, p54, and p72, respectively, was used as a control. Each virus was administered at 10... 8.0 TCID 50 After mixing, add 100 micrograms of Poria cocos polysaccharide, and immunize 5 animals in each group.

[0167] Both groups were immunized twice, 14 days apart, with the same dose each time.

[0168] Challenge control group: Five animals were challenged without being injected with any virus.

[0169] Feed them according to their usual routine.

[0170] 2. Attacking the poison

[0171] On the 14th day after the second immunization (referred to as day 1 of the second immunization), the experimental groups (EP84R-D129L and E146L-K421R), the control immunization groups (rdv-p30, rdv-p54, rdv-p72), and the challenge control group were challenged with strong African swine fever virus strain SY18 orally. 3.0 TCID 50 / 2ml of highly virulent ASFV strain SY18. Observe the survival status of the pigs.

[0172] The results are shown in Table 8. It can be seen that all unimmunized control pigs became ill and died, all pigs immunized with the traditional vector vaccine combination died, and over 60% to 80% of the five pigs in the other immunized groups survived. This indicates that the selected gene and fusion combination has a significant protective effect against viral challenge, unlike traditional gene selection.

[0173] Table 8 compares the immunogenicity of different bigenic recombinant viruses with traditional target protein recombinant viruses.

[0174]

[0175] Example 3: Construction and Immunization Effect of Recombinant Adenovirus Expressing Partial Coding Fragment of African Swine Fever Virus Gene

[0176] This invention provides the construction and immunoassay of recombinant adenoviruses encoding partial coding fragments of the EP84R9L, D129L, E146L, and K421R genes (the construction and use strategies for recombinant viruses encoding partial coding fragments of other replication-defective and replicable vector DNA viruses are similar), as detailed below:

[0177] I. Construction of Recombinant Adenovirus Coding Partial Fragment of ASFV Gene

[0178] 1. Construction of homologous recombination plasmids

[0179] The recombinant plasmid pAdCMV-fEP84L is obtained by inserting bases 10-150 of the EP84R gene (MH766894.3, submitted on July 12, 2023) into the EcoRI site of the pacAd5 CMVK-NpA plasmid (human adenovirus type 5 expression vector). This plasmid expresses the gene encoding the fEP84L protein (amino acid positions 16-70 of the EP84L protein sequence).

[0180] The recombinant plasmid pAdCMV-fD129LR is obtained by inserting the bases of the D129L gene from position 88 to 211 into the EcoRI site of the pacAd5 CMVK-NpA plasmid (human adenovirus type 5 expression vector). This plasmid expresses the fD129LR protein gene (amino acid positions 30-90 of the D129L protein sequence).

[0181] The recombinant plasmid pAdCMV-fE146L is obtained by inserting the E146L gene from positions 58 to 353 into the EcoRI site of the pacAd5 CMVK-NpA plasmid (human adenovirus type 5 expression vector). This plasmid expresses the gene encoding the fE146L protein (amino acid positions 25 to 105 of the E146L protein sequence).

[0182] The recombinant plasmid pAdCMV-fK421R is obtained by inserting bases 241-930 of the K421R gene between the EcoRI sites of the pacAd5 CMVK-NpA plasmid (human adenovirus type 5 expression vector). This plasmid expresses the gene encoding the fK421R protein (amino acid positions 58-300 of the K421R protein sequence). The amplification primer sequences are shown in Table 9.

[0183] Table 9 shows the primer sequences and product sizes for gene amplification of each part.

[0184]

[0185] 2. Rescue and identification of recombinant adenoviruses

[0186] Following the method in Example 1, the recombinant plasmids pAdCMV-fEP84L, pAdCMV-fD129LR, pAdCMV-fE146L, pAdCMV-fK421R, and the backbone plasmid pacAd59.2-100 were linearized by PacI digestion to obtain four types of digested recombinant plasmids and the digested backbone plasmid pacAd59.2-100.

[0187] Each of the above-mentioned recombinant plasmids after enzyme digestion was mixed at a certain ratio (2 μg) with the enzyme-digested backbone plasmid pacAd59.2-100 (4 μg), and then mixed with 12 μL of transfection reagent. After mixing (2000), add 2 ml of DMEM cell culture medium, evenly add it to the cell monolayer, and transfect at 25 cm. 2 HEK293AD cells, which grew into a monolayer, were transfected multiple times according to the method in Example 1 to prepare P3 generation recombinant adenovirus.

[0188] 3. Testing

[0189] The titer of the P3 generation recombinant adenovirus was determined using the method described in Example 1.

[0190] The results are shown in Table 10.

[0191] Table 10 shows the titer determination results of each recombinant adenovirus from generation P3.

[0192] Recombinant adenovirus <![CDATA[Titer TCID 50 / mL]]> rAdv-fEP84R <![CDATA[10 8.50 ]]> rAdv-fD129L <![CDATA[10 8.375 ]]> rAdv-fE146L <![CDATA[10 8.625 ]]> rAdv-fK421R <![CDATA[10 8.50 ]]>

[0193] Nucleic acid was extracted from the P3 generation recombinant adenovirus, and identification primers (upstream primer: CGCAAATGGGCGGTAGGCGTG, downstream primer: CACTGCATTCTAGTTGTGGTTT) were used for identification of the recombinant adenovirus. The expected product size is shown in Table 9. The amplified fragment of the target size was the target recombinant adenovirus. All the recombinant adenoviruses obtained were the target adenoviruses.

[0194] Each rescued target adenovirus was named a recombinant adenovirus rAdv-fEP84R, rAdv-fD129L, rAdv-fE146L, and rAdv-fK421R.

[0195] II. Immunoprotection experiment with recombinant adenovirus

[0196] The constructed recombinant viral vectors, such as fEP84R, fD129L, fE146L, and fK421R, were inoculated into HEK293AD cells, and the cells were expanded, the viral fluid was harvested, and the titers were measured. The viral loads were then measured at 10... 8 TCID 50 The above-mentioned recombinant vector viral solutions are combined in three or more combinations and mixed in equal proportions.

[0197] 1. Immunity

[0198] Recombinant adenoviruses rAdv-fEP84R, rAdv-fD129LR, rAdv-fE146L, and rAdv-fK421R were mixed in equal proportions, with each recombinant virus having a viral titer of 10. 8 TCID 50 / ml, to obtain a combined vaccine with a total volume of 2ml, and add 100 micrograms of Poria cocos polysaccharide to each dose of vaccine.

[0199] The recombinant adenovirus combination group (fEP84R, fD129LR, fE146L, rfK421R): Five pigs were immunized intramuscularly with the above-mentioned combination vaccine supplemented with Poria cocos polysaccharide. Two immunizations were administered, 14 days apart, with the same dosage each time.

[0200] p30, p54, p72, pCD2v, pF317L, pp62, pp220 virus combination group: A mixture of recombinant adenoviruses expressing p30, p54, p72, pCD2v, pF317L, pp62, and pp220, respectively, was used as the control immunization group (10 μg / mL of each virus was used). 8.0 TCID 50 After mixing, each dose (2 ml) was further supplemented with 100 micrograms of Poria cocos polysaccharide and injected intramuscularly into 5 pigs. Two immunizations were administered, 14 days apart, with the same dosage each time.

[0201] Both groups were immunized twice, 14 days apart, with the same dose each time.

[0202] Challenge control group: Five animals were challenged without being injected with any virus.

[0203] Feed them according to their usual routine.

[0204] 2. Attacking the poison

[0205] On the 14th day after the second immunization (day 1 is designated as the first day of the second immunization), the African swine fever virus SY18 strain was used to challenge the above-mentioned immunization groups and the challenge control group with a strong virus, and the virus was administered orally at 10 mg / L. 3.0 TCID 50 / 2ml of highly virulent ASFV strain SY18. Observe for 28 days, and record clinical manifestations and final outcomes.

[0206] The results are shown in Table 11. After 28 days of observation, all pigs in the challenge control group became ill and died. All pigs immunized with the traditional vector vaccine combination (p30, p54, p72, pCD2v, pF317L, pp62, pp220 virus combination) died. All five pigs in the immunization group with the recombinant virus of four gene fragments (fEP84, fD129LR, fE146L, fK421R recombinant adenovirus combination) survived.

[0207] Table 11 shows the results of immunization of pigs with recombinant adenovirus combinations of different gene fragments.

[0208]

[0209] Example 4: Construction and Immunization Effect of Recombinant Porcine Reproductive and Respiratory Syndrome (PRRSV) Expressing African Swine Fever Virus Gene

[0210] I. Construction of a recombinant PRRSV expressing the EP84R, D129L, E146L, and K421R genes

[0211] 1. Construction of virus rescue plasmid

[0212] Virus rescue plasmid pcDNA-HH-PRRSV-TRS: This plasmid is obtained by inserting the HamRz-PRRSV(5'UTR-ORF1-PacⅠ-TRS-ORF2-ORF3-ORF4-ORF5-ORF6-ORF7-3'UTR)-HdvRz (sequence 1) fragment between the EcoRV restriction sites of plasmid pcDNA3.1 (Invitrogen, catalog number: V790-20).

[0213] The nucleotide sequence of the HamRz-PRRSV(5'UTR-ORF1-PacⅠ-TRS-ORF2-ORF3-ORF4-ORF5-ORF6-ORF7-3'UTR)-HdvRz fragment is Sequence 1. In Sequence 1, positions 1-58 are the hammerhead ribozyme encoding gene, positions 12048-12048 are the restriction site PacⅠ, positions 12049-12087 are the transcriptional regulatory sequence TRS, and positions 15454-15537 are the hepatitis D ribozyme encoding gene.

[0214] Using ASFV SY18 DNA as a template, primers were designed according to the instructions of Takara's In-Fusion seamless cloning enzyme. PCR amplification was performed on the corresponding fragments of the genes EP84R, D129L, E146L, and K421R (primer sequences are shown in Table 12). These fragments were then ligated to the PacI-digested plasmid pcDNA-HH-PRRSV-TRS to construct recombinant PRRSV rescue plasmids pcDNA-HH-PRRSV-EP84R, pcDNA-HH-PRRSV-D129L, pcDNA-HH-PRRSV-E146L, and pcDNA-HH-PRRSV-K421R.

[0215] The recombinant plasmids mentioned above were obtained by inserting each gene fragment into the PacⅠ site of the plasmid pcDNA-HH-PRRSV-TRS.

[0216] Table 12 shows the primer sequences and product sizes for each gene amplification.

[0217]

[0218] 2. Recombinant virus rescue and identification

[0219] Taking the rescue and identification of PRRSV recombinant with the EP84R gene as an example.

[0220] The recombinant PRRSV rescue plasmid pcDNA3.1-HH-PRRSV-EP84R was transfected into BHK-21 cells. After 3 days, the cells were frozen and thawed twice. The supernatant was collected and transferred into Marc145 cells. After 4 days of observation, if cytopathic effects were observed, it was considered that the recombinant virus had been successfully rescued and was labeled as rPRRSV-EP84R.

[0221] The recombinant virus rPRRSV-EP84R was identified by RT-PCR using the identification primers (upstream primer: 5'-TGCTGGAAAGTGATGTTGGAC-3', downstream primer: 5'-TGCTCAGGGTGAACGGTAGA-3') to obtain the target product.

[0222] Using the same method, BHK cells were transfected with the corresponding rescue plasmids to rescue recombinant PRRSV viruses rPRRSV-D129L, rPRRSV-E146L, and rPRRSV-K421R expressing the D129L, E146L, and K421R genes, respectively. RT-PCR was performed using identification primers. The primer sequences and product sizes for each gene amplification are shown in Table 12.

[0223] 3. Titer detection

[0224] The titer of recombinant African swine fever virus (APFV) was determined by serially diluting each recombinant PRRSV virus culture medium 10-fold, for a total of 12 dilutions. Eight replicates were performed for each dilution, and the cells were inoculated into Marc-145 cells in 96-well plates at a volume of 0.1 ml / well. After incubation at 37°C for 4-5 days, cytopathic effects were observed under a light microscope, and the TCID of the virus was calculated using the Reed-Muench method. 50 The results are shown in Table 13 below.

[0225] Table 13 shows the results of the African swine fever virus gene-recombinant PRRSV titer determination.

[0226] Recombinant virus <![CDATA[Titer TCID 50 / mL]]> rPRRSV-EP84R <![CDATA[10 7.250 ]]> rPRRSV-D129L <![CDATA[10 7.375 ]]> rPRRSV-E146L <![CDATA[10 7.125 ]]> rPRRSV-K421R <![CDATA[10 7.0 ]]>

[0227] II. Immunization and challenge assays of recombinant PRRSV expressing the EP84R, D129L, E146L, and K421R genes.

[0228] 1. Immunity

[0229] Recombinant PRRSV viruses expressing the EP84R, D129L, E146L, and K421R genes were mixed in combinations of 2, 3, and 4 recombinant viruses (Table 14), with a viral titer of 10 for each recombinant virus in each combination. 5.7 TCID 50 / ml, each recombinant virus is mixed in equal proportions, 0.3ml of each virus, and 100 micrograms of Schisandra polysaccharide are added to each dose of vaccine.

[0230] Schisandra chinensis polysaccharide was prepared as follows: 10 kg of Schisandra chinensis leaves were pulverized, soaked in 50 kg of distilled water overnight, heated to 80°C, maintained for 2 hours with constant stirring, and centrifuged at 10000 rpm (centrifugal force 12857 g) for 15 minutes using a continuous centrifuge to collect the supernatant. The water was evaporated to 1 / 10 of the supernatant volume using a rotary evaporator. A portion of the supernatant was taken, and 1 / 5 volume of petroleum ether was added. The mixture was refluxed at 37°C for 60 min. Anhydrous ethanol was added to the aqueous phase until the final ethanol concentration reached 70%. After standing for 1 hour, the mixture was centrifuged at 8000 rpm (8228 g) for 30 min, and the precipitate was collected. The precipitate was resuspended in 0.9% physiological saline (NaCl aqueous solution) with a mass-to-volume ratio (g:ml) to achieve a final concentration of 100 mg / ml, which is the Schisandra chinensis polysaccharide.

[0231] Immunization experimental group: 10g of recombinant PRRSV virus from each of the above-prepared combinations (Table 14 rPRRSV-EP84R, rPRRSV-D129L, rPRRSV-E146L, rPRRSV-K421R combination, rPRRSV-EP84R, rPRRSV-D129L combination, rPRRSV-EP84R, rPRRSV-D129L, rPRRSV-E146L combination) was taken respectively. 5.7 TCID 50 Mix each recombinant virus in equal proportions (0.3 ml per virus), then add 100 micrograms of Schisandra chinensis polysaccharide; inject into the neck muscle of pigs, immunizing 5 pigs per group.

[0232] Immunization with conventional vector vaccine combination group: A mixture of recombinant adenoviruses p30, p54, p72, pCD2v, pF317L, pp62, and pp220 was used as a control, with each virus administered at 10... 8.0 TCID 50 After mixing, add 100 micrograms of Schisandra chinensis polysaccharide, and immunize 5 animals in each group.

[0233] Both groups were immunized twice, 14 days apart, with the same dose each time.

[0234] Challenge control group: Five animals were challenged without being injected with any virus.

[0235] Feed them according to their usual routine.

[0236] 2. Attacking the poison

[0237] On the 14th day after the second immunization (referred to as day 1 of the second immunization), the experimental groups, control immunization group, and challenge control group were challenged with virulent African swine fever virus strain SY18, and orally administered 10 mmol / L. 3.0 TCID 50 / 2ml of highly virulent ASFV strain SY18. Observe for 28 days, and record clinical manifestations and final outcomes.

[0238] The results are shown in Table 14. It can be seen that, after 28 days of observation, all the non-immunized control pigs became ill and died, all the pigs immunized with the traditional vector vaccine combination died, and some or all of the 5 pigs immunized with the combination of recombinant viruses of genes 2, 3, and 4 survived.

[0239] Table 14 shows the challenge results of pigs immunized with recombinant porcine reproductive and respiratory syndrome virus (PRRSV) with different gene combinations.

[0240]

[0241] Example 5: Construction and Immunoprotective Experiment of Recombinant Pseudorabies Virus Expressing EP84R, D129L, E146L, and K421R Genes

[0242] I. Construction of recombinant pseudorabies virus expressing EP84R, D129L, E146L, and K421R genes

[0243] 1. Homologous recombination plasmids

[0244] The homologous recombination plasmid pUC-ΔTK-EGFP was obtained by inserting the TKRight Arm-EGFP-TKLeft Arm fragment (sequence 2) between the XbaⅠ and SphⅠ restriction sites of the pUC19 plasmid (Takara, Code No. 3219).

[0245] The linearized pUC-ΔTK-EGFP fragment was obtained by PCR amplification using pUC-ΔTK-EGFP as a template and PUC-F and PUC-R primers.

[0246] PUC-F: ctaccggtcgccaccatggtgagcaaggg, PUC-R: gaccggtagcgctagcggatctgacggt;

[0247] Using ASFV SY18 DNA as a template, primers were designed according to the instructions of Takara's In-Fusion seamless cloning enzyme (Table 15). PCR amplification was performed on the corresponding fragments of the EP84R, D129L, E146L, and K421R genes, which were then cloned into the pUC-ΔTK-EGFP plasmid to construct recombinant plasmids pUC-ΔTK-EGFP-EP84R, pUC-ΔTK-EGFP-D129L, pUC-ΔTK-EGFP-E146L, and pUC-ΔTK-EGFP-K421R.

[0248] The recombinant plasmids described above are obtained by recombining the gene fragments obtained from the above PCR amplification under the action of In-Fusion enzyme, and inserting them between the GCCACC (Kozak sequence) of the pUC-ΔTK-EGFP linearized fragment obtained by PCR and the EGFP gene.

[0249] Table 15 shows the specific primers and product sizes for recombinant PRV virus.

[0250]

[0251] 2. Recombinant virus rescue, purification and identification

[0252] Taking the rescue, purification, and identification of EP84R gene recombinant pseudorabies virus as an example.

[0253] BHK cells were transfected with the recombinant plasmid pUC-ΔTK-EGFP-EP84R. Five hours later, the JL14-ΔgI / gE / TK strain of virus, lacking the gI and gE genes, was infected with the virus at 0.1 MOI. After culturing for 24 hours, cells exhibiting green fluorescence were picked and transferred to fresh normal BHK cells for one round of purification. This purification process was repeated four times. Fluorescent cells were collected, frozen and thawed three times, and subjected to three rounds of limiting dilution on BHK cells. Fluorescent cells from the final limiting dilution wells were collected and stored. Purity was determined using identification primers (upstream primer: 5'-GGCTGACCGCCCAACGA-3', downstream primer: 5'-CCTTGCTCACCATCGGTCC-3'). The purified recombinant pseudorabies virus strain was named PRV-EP84R (denoted as PRV-EP84R gene recombinant pseudorabies virus).

[0254] Using the same method, BHK cells were transfected with the corresponding recombinant plasmids to rescue and purify recombinant pseudorabies virus PRV-D129L, PRV-E146L, and PRV-K421R. After being identified correctly with identification primers, they were stored at -40℃.

[0255] The titer of African swine fever virus gene-recombinant pseudorabies virus was determined. For the assay, the culture medium of each recombinant virus was serially diluted 10-fold, for a total of 12 dilutions. Each dilution was inoculated in 8 replicates onto Vero cells in 96-well plates at an inoculation volume of 0.1 ml / well. After incubation at 37°C for 3-4 days, cytopathic effects were observed under a light microscope, and the TCID of the virus was calculated using the Reed-Muench method. 50 The results are shown in Table 16.

[0256] Table 16 shows the results of the African swine fever virus gene-recombinant PRV titer determination.

[0257] Recombinant virus <![CDATA[Titer TCID 50 / mL]]> PRV-EP84R <![CDATA[10 7.50 ]]> PRV-D129L <![CDATA[10 7.625 ]]> PRV-E146L <![CDATA[10 7.875 ]]> PRV-K421R <![CDATA[10 7.625 ]]>

[0258] II. Immunization and challenge experiments of recombinant pseudorabies virus expressing ASFV EP84R, D129L, E146L, and K421R genes.

[0259] 1. Group immunization

[0260] Experimental group (PRV-EP84R, PRV-D129L, PRV-E146L, PRV-K421R combination): The recombinant pseudorabies virus PRV-EP84R, PRV-D129L, PRV-E146L, and PRV-K421R prepared above were combined according to the format in Table 17, and the viral titer of each recombinant virus was 10.6.5 TCID 50 Each recombinant virus is mixed in equal proportions, with 0.1 ml of each virus, and 100 micrograms of 4% nano-aluminum gel adjuvant is added to each dose of the mixed vaccine.

[0261] The preparation steps for 4% nano-aluminum gel adjuvant are as follows:

[0262] Aluminum salt dissolution: Dissolve an appropriate amount of aluminum salt (such as aluminum hydroxide) in deionized water to prepare an aluminum salt solution with a mass-volume ratio (g:ml) of 5%.

[0263] pH adjustment: Adjust the pH of the aluminum salt solution (usually 6-8) using dilute hydrochloric acid or sodium hydroxide to promote the formation of aluminum gel.

[0264] Colloid formation: Stir (e.g., stir, heat) at 10–70°C until aluminum ions in the aluminum salt solution form a colloid, becoming nano-aluminum particles. This step can continue for several hours until the colloid is fully formed.

[0265] Washing of nano-aluminum particles: Unreacted aluminum salts and impurities are removed by centrifugation at 800 r / min for 10 minutes to obtain high-purity aluminum gel.

[0266] Concentration Adjustment: Adjust the concentration of the aluminum paste as needed to achieve a final mass-volume percentage (g:ml) concentration of 4%. This can be achieved by diluting or concentrating the liquid.

[0267] Stabilization and Storage: A stabilizer is added to prevent particle aggregation. Finally, the prepared nano-aluminum gel is stored under suitable conditions (such as low temperature) to ensure its stability.

[0268] Immunization with conventional vector vaccine combinations (p30, -p54, -p72, -pCD2v, -pF317L, -pp62, -pp220 combination): A mixture of recombinant adenoviruses (p30, p54, p72, pCD2v, pF317L, pp62, pp220) was used as a control. Each virus was administered at 10... 8.0 TCID 50 After mixing, add 100 micrograms of 4% nano-aluminum gel adjuvant, and immunize 5 heads per group.

[0269] Both groups were immunized twice, 14 days apart, with the same dose each time.

[0270] Challenge control group: Five animals were challenged without being injected with any virus.

[0271] Feed them according to their usual routine.

[0272] 2. Attacking the poison

[0273] On the 14th day after the second immunization (referred to as day 1 of the second immunization), the experimental groups, control immunization group, and challenge control group were challenged with strong African swine fever virus strain SY18 (10 mg / day of oral administration per head). 3.0 TCID 50 / 2ml ASFV virulent strain SY18). Observe for 28 days, and record clinical manifestations and final outcomes.

[0274] The results are shown in Table 17. During the 28-day observation period, all unimmunized control pigs became ill and died, all pigs immunized with the traditional vector vaccine combination became ill and died, and all pigs immunized with the PRV-EP84R, PRV-D129L, PRV-E146L, and PRV-K421R recombinant pseudorabies virus combination survived.

[0275] Table 17 shows the results of pig challenge with ASFV D129L and other recombinant pseudorabies virus.

[0276]

[0277]

[0278] Example 6: Immunization and challenge experiments of recombinant PRRSV and recombinant pseudorabies virus expressing ASFV EP84R, D129L, E146L, and K421R genes.

[0279] 1. Group immunization

[0280] Two recombinant virus combinations were used: rPRRSV-EP84R, rPRRSV-D129L, rPRRSV-E146L, and rPRRSV-K421R recombinant PRRSV virus, and PRRV-D129L, PRRV-E146L, PRRV-K421R, and PRRV-EP84R recombinant pseudorabies virus. The titer of each recombinant rPRRSV was 10. 5.5 TCID 50 Mix in equal proportions, 0.1 ml for each virus, and use directly after mixing; the titer of each recombinant pseudorabies virus is 10. 6.5 TCID 50 The two vaccine combinations were mixed in equal proportions, with 0.1 ml of each recombinant virus, and then freeze-dried. The two vaccine combinations were administered first (recombinant rPRRSV combination) to immunize pigs, followed by an intramuscular injection of the (recombinant pseudorabies virus combination) into the neck muscles. The immunization interval between the two combinations was 14 days. A total of 5 pigs were immunized.

[0281] Challenge control group: Five animals were challenged without being injected with any virus.

[0282] Feed them according to their usual routine.

[0283] 2. Attacking the poison

[0284] Fourteen days after the second immunization, each immunized pig, along with the control pigs that were not immunized, was orally administered 10 mg of the vaccine. 3.0 TCID 50 / 2ml of highly virulent ASFV strain SY18 was observed for 28 days, and clinical manifestations and final outcomes were recorded.

[0285] The results are shown in Table 18. It can be seen that, after 28 days of observation, all the unimmunized control pigs became ill and died, and the dead pigs tested positive for ASFV. All five pigs in the immunized group survived after being challenged with the virus.

[0286] Table 18 shows the results of pig challenge with four-gene recombinant rPRRSV and recombinant pseudorabies virus.

[0287]

[0288] Example 7: Preparation and immunogenicity of a vaccine expressing EP84R, D129L, E146L, and K421R mRNA

[0289] I. Preparation of vaccines expressing EP84R, D129L, E146L, and K421R mRNA

[0290] 1. Construction and amplification of transcription plasmids

[0291] Change 5'UTR(GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATG

[0292] The DNA coding sequences (including stop codons) of the EP84R, D129L, E146L, or K421R genes, the 3' UTR (AGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTA TGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAGCTCGCTTTCTTGCTGTCCAATTT CTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTG CCTAATAAAAAACATTTATTTTCATTGC) and polyA

[0293] (AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAA ...

[0294] The recombinant transcription plasmid pGEM-3zf(+)-EP84R is obtained by replacing the fragment between the kpn I and xba I sites of plasmid pGEM-3zf(+) with a fragment consisting of the DNA coding sequence (including the stop codon) of the 5'UTR, the EP84R gene, the 3'UTR, and the polyA sequence.

[0295] The recombinant transcription plasmid pGEM-3zf(+)-D129L is obtained by replacing the fragment between the kpn I and xba I sites of plasmid pGEM-3zf(+) with a fragment consisting of the 5'UTR, the DNA coding sequence of the D129L gene (including the stop codon), the 3'UTR, and the polyA sequence.

[0296] The recombinant transcription plasmid pGEM-3zf(+)-E146L is obtained by replacing the fragment between the kpn I and xba I sites of plasmid pGEM-3zf(+) with a fragment consisting of the DNA coding sequence (including the stop codon), 3'UTR, and polyA sequence of the 5'UTRE146L gene.

[0297] The recombinant transcription plasmid pGEM-3zf(+)-K421R is obtained by replacing the fragment between the kpn I and xba I sites of plasmid pGEM-3zf(+) with a fragment consisting of the DNA coding sequence (including the stop codon) of the 5'UTR, the K421R gene, the 3'UTR, and the polyA sequence.

[0298] 2. Linearization of transcription plasmids and transcription of mRNA

[0299] Recombinant transcription plasmids pGEM-3zf(+)-EP84R, pGEM-3zf(+)-D129L, pGEM-3zf(+)-E146L, and pGEM-3zf(+)-K421R were digested with Hind III and the linearized fragments were recovered. They were then added to an in vitro transcription system (the in vitro transcription system used the T7 High Yield RNA Transcription Kit (E131, novoprotein co., ltd; for specific procedures, refer to the kit instructions; N1-Me-Pseudo UTP was used instead of the UTP in the T7 kit to reduce immunogenicity). The reaction was carried out at 37°C for 3 hours, followed by incubation with DNase I at 37°C for 15 minutes to digest the transcribed DNA template. The mRNA was then purified using an RNA purification kit.

[0300] 3. mRNA capping

[0301] The purified mRNA was capped using an RNA capping kit (T7 ARCA Mrna in vitro Synthesis kit, catalog number: MT0125, Beijing Bio-Rad Biotechnology Co., Ltd.) at 37°C for 0.5 hours. The capped mRNA was then purified using an RNA purification kit or by LiCl precipitation and centrifugation.

[0302] 4. DNA removal

[0303] Add an appropriate amount of DNase I to the reaction system obtained in step 3 above, incubate at 37°C for 15 min to digest the DNA template, and then purify to obtain mRNA.

[0304] 5. mRNA purification and vaccine preparation

[0305] Purification method (lithium chloride purification, other kits can also be used for purification): Add 30 μL of Lithium Chcoride Precipitation Solution (7.5 M Lithium Chcoride, 50 mM EDTA) and 30 μL of RNase-Free Water, mix well, and place at -20°C for at least 30 min. Centrifuge at 1200 rpm for 15 min at 4°C, discard the supernatant, and collect the precipitate. Wash three times with pre-cooled 70% ethanol, centrifuging at 4°C for 2 min after each wash (70% ethanol must be freshly prepared). Let stand in a clean bench with the lid open for 5-8 min until the ethanol evaporates. Reconstitute with RNase-Free Water and test the concentration. Store at -80°C for later use.

[0306] The purified mRNAs were diluted with citrate buffer to 80-120 ng / μL as the aqueous phase. Liposomes were dissolved in anhydrous ethanol to form the organic phase. The liposomes consisted of distearate, cholesterol, DLIN-MC3-DMA, and DMG-PEG2000, with a mass ratio of 10:38.5:50:1.5. The final concentration of liposomes in the organic phase was 5-7 mg / ml. The organic and aqueous phases were mixed in a nucleic acid nanomedicine preparation instrument at a specific mass ratio (1:2-1:4) at a flow rate of 12 ml / min. The resulting liquid was the mRNA encapsulated in lipid nanoparticles. Anhydrous ethanol was removed by dialysis to obtain a lipid nanoparticle-encapsulated mRNA vaccine suitable for animal immunization.

[0307] mRNA vaccines expressing four proteins were obtained, namely EP84R-mRNA vaccine, D129L-mRNA vaccine, E146L-mRNA vaccine, and K421-mRNA vaccine.

[0308] The four mRNA vaccines mentioned above—EP84R-mRNA vaccine, D129L-mRNA vaccine, E146L-mRNA vaccine, and K421-mRNA vaccine—were mixed in equal mass ratios to prepare 300 vials, each containing 5 doses (each dose contains 30 micrograms of protein), for a total of 1500 doses.

[0309] II. Immunization of mRNA vaccines expressing EP84R, D129L, E146L, and K421R (Only mRNA vaccines with a 4-gene combination and immunization test results are provided; mRNA vaccines with other combinations and immunization tests are similar)

[0310] 1. Group immunization

[0311] Five pigs were immunized by intramuscular injection of EP84R-mRNA, D129L-mRNA, E146L-mRNA, and K421-mRNA vaccines into the neck muscles. Each pig was immunized with one dose, and the immunizations were administered twice, with an interval of 14 days.

[0312] Simultaneously, a combination of five conventional vector vaccine immunizations (p30, p54, p72, pCD2v, pF317L, pp62, pp220) was set up: a mixture of recombinant adenoviruses expressing p30, p54, p72, pCD2v, pF317L, pp62, and pp220 respectively was used as a control (each virus was used at 10... 8.0 TCID 50 After mixing, add 100 micrograms of Poria cocos polysaccharide to each 2ml serving.

[0313] Challenge control group: Five animals were challenged without being injected with any virus.

[0314] Feed them according to their usual routine.

[0315] 2. Attacking the poison

[0316] Fourteen days after the second immunization following the viral challenge, each pig in the immunized group and the control group was orally administered 10 mg of the vaccine. 3.0 TCID 50 / 2ml of highly virulent ASFV strain SY18 was observed for 28 days, and clinical manifestations and final outcomes were recorded.

[0317] The results are shown in Table 19. During the 28-day observation period, all non-immunized control pigs became ill and died, all pigs immunized with the traditional vector vaccine combination became ill and died, and all pigs immunized with the mRNA vaccine survived.

[0318] Table 19 shows the results of pig challenge with mRNA vaccines containing four proteins, including ASFV D129L.

[0319]

[0320]

[0321] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. An African swine fever virus protein combination, which is any one of the following: 1) EP84R, D129L, K421R; 2) EP84R, E146L, K421R; 3) D129L, E146L, K421R; 4) EP84R, D129L, E146L, K421R; 5) EP84R, D129L, E146L, K421R, B646L 6) EP84R, D129L, E146L, K421R, E183L, B646L 7) EP84R, D129L, E146L, K421R, CP204L, E183L, B646L 8) EP84R, D129L, E146L, K421R, CP2457L, CP204L, E183L, B646L; 9) fEP84R, fD129LR, fE146L, fK421R; fEP84R refers to amino acid positions 16-70 of the EP84R protein sequence. fD129L refers to amino acid positions 30-90 of the D129L protein sequence. fE146L refers to amino acid positions 25-105 of the E146L protein sequence. fK421R refers to amino acid positions 58-300 of the K421R protein sequence. The amino acid sequences of the EP84R protein, the D129L protein, the E146L protein, and the K421R protein are shown in the GenBank accession number MH766894.3 submitted on July 12, 2023. 10) EP84R, D129L, E146L.

2. An African swine fever virus nucleic acid combination, which is a combination of the nucleic acids encoding each protein in the African swine fever virus protein combination of claim 1.

3. The African swine fever virus nucleic acid combination according to claim 2, characterized in that: The nucleic acid molecule is either DNA or mRNA.

4. A nucleic acid delivery vector or a group of nucleic acid delivery vectors containing each nucleic acid in the nucleic acid combination of claim 2 or 3.

5. A recombinant viral combination comprising a recombinant virus or recombinant viral group expressing each of the nucleic acids in the nucleic acid combination of claim 2 or 3.

6. The recombinant virus combination according to claim 5, characterized in that: The recombinant virus is derived from human adenovirus type 5, poxvirus, porcine pseudorabies virus, porcine reproductive and respiratory syndrome virus, porcine adenovirus, porcine encephalitis virus, classical swine fever virus, retrovirus, or paramyxovirus.

7. Biological material, which is any one of the following: 1) A recombinant vector group or recombinant vector expressing the African swine fever virus protein combination of claim 1; 2) A recombinant microbiome or recombinant microorganism expressing the African swine fever virus protein combination of claim 1; 3) Recombinant cell groups or recombinant cells expressing the African swine fever virus protein combination of claim 1; Recombinant cell groups or recombinant cells do not include plant cells.

8. The use of the African swine fever virus protein combination of claim 1, the African swine fever virus nucleic acid combination of claim 2 or 3, the nucleic acid delivery vector or nucleic acid delivery vector group of claim 4, the recombinant virus combination of claim 5 or 6, or the biomaterial of claim 7 in the preparation of an anti-African swine fever virus product; wherein the product is a vaccine or composition.

9. African swine fever products, including any of the following: 1) The African swine fever virus protein combination as described in claim 1; 2) The African swine fever virus nucleic acid combination as described in claim 2 or 3; 3) The nucleic acid delivery vector or set of nucleic acid delivery vectors as described in claim 4; 4) The recombinant virus combination as described in claim 5 or 6; 5) The biomaterial as described in claim 7; The product is a vaccine or a composition.

Images