Primer probe combination and kit for fluorescent quantitative PCR (polymerase chain reaction) detection of African swine fever virus and application of primer probe combination and kit

By designing specific primer-probe combinations targeting the MGF-100-1L gene of ASFV and optimizing the real-time PCR method, the problems of insufficient sensitivity and cross-reactivity in ASFV detection were solved, achieving high-sensitivity and specific early diagnosis of ASFV.

CN120967071APending Publication Date: 2025-11-18LANZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511420212.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-30
Publication Date
2025-11-18

AI Technical Summary

Technical Problem

Existing ASFV detection technologies suffer from insufficient sensitivity, are prone to false negatives and false positives, and lack effective means to address ASFV genomic variations, making it difficult to achieve early and accurate diagnosis.

Method used

A real-time PCR detection method for ASFV MGF-100-1L gene was designed using a specific primer-probe combination, and reaction conditions were optimized to ensure high sensitivity and specificity.

Benefits of technology

It achieves high-sensitivity detection of ASFV, can accurately identify it at extremely low concentrations, reduces cross-reactivity, improves the detection rate of weakly positive samples, and ensures the stability and consistency of test results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses a primer probe combination and a kit for fluorescent quantitative PCR (Polymerase Chain Reaction) detection of African swine fever virus and application of the primer probe combination and the kit. The primer probe combination is a specific primer probe combination 1 or a specific primer probe combination 2. The nucleotide sequence of the specific primer probe combination 1 is as shown in SEQ ID NO.1-3, and the nucleotide sequence of the specific primer probe combination 2 is as shown in SEQ ID NO.4-6. The qPCR detection method with strong specificity and high sensitivity is established, the lower detection limit can reach 0.87 copies / L, the sensitivity of the qPCR detection method is equivalent to that of a WOAH recommendation method, and the detection rate of weak positive samples is higher; the kit has no cross reaction with common swine pathogens such as hog cholera virus and pseudorabies virus, and has good specificity. The method provides reliable technical support for early diagnosis and precise prevention and control of African swine fever.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological detection, and particularly relates to a primer probe combination for fluorescent quantitative PCR detection of African swine fever virus, a kit and application thereof. BACKGROUND

[0002] African swine fever (ASF) is a highly infectious disease caused by African swine fever virus (ASFV), with a very high mortality rate. Once infected, the mortality rate of live pigs is almost 100%. The disease has been listed by the World Organization for Animal Health (WOAH) as one of the animal diseases that must be reported. Due to the complex genome of ASFV and the immune escape mechanism, African swine fever virus (ASFV) shows strong resistance to the external environment. So far, no specific treatment drugs and preventive vaccines have been developed. At present, the prevention and control work mainly relies on clinical monitoring, isolation measures, and comprehensive prevention and control strategies such as disposal of infected animals. Under this background, the development of new ASF diagnostic techniques with rapid response capability, high accuracy and detection efficiency has an irreplaceable strategic value for building an effective epidemic control system.

[0003] In the detection technology system of African swine fever virus (ASFV), the classical etiological detection method can achieve rapid response in the early stage of outbreak by directly detecting the viral load in the animal body. This traditional technical framework mainly covers two core methods of virus isolation test and haemadsorption test (HAD). Compared with serological detection technology which relies on antibody response, etiological detection method can provide direct evidence of virus existence, but its operation process is relatively complicated, the detection period is longer, and there is a risk of false negative, so it is more suitable for virus isolation culture and basic molecular biology research scenes. Immunological methods include immunofluorescence test, immunoblot test, enzyme-linked immunosorbent assay, and immunochromatographic test paper method. Immunological methods are fast and convenient, but the sensitivity fluctuation, lag and cross-reaction problems limit their accuracy. The widely used technical means in the field of viral nucleic acid analysis include polymerase chain reaction (PCR) and its derivative technology-real-time fluorescent quantitative PCR (qPCR) and other molecular biology methods. The core advantage of this kind of technology system is its excellent detection sensitivity, which can realize the accurate identification of extremely small amount of viral genetic material. In China, research teams have successively developed qPCR detection technologies for different diagnostic targets. Among them, double and multiple qPCR detection technologies can accurately identify and diagnose the co-infection of two or more pathogens, providing strong support for clinical diagnosis and treatment.

[0004] Molecular diagnostic techniques developed based on viral genome sequences are widely used in the field of virus detection due to their excellent detection sensitivity. Currently, the research community mainly chooses B646L ,EP402R , K205R , P10 and MGF-360-14L Using specific gene fragments as core detection targets, a nucleic acid detection system for African swine fever virus (ASFV) was successfully constructed. The selection of these gene loci is based on their key functions or conserved characteristics throughout the viral life cycle, providing molecular biology-level technical support for the accurate identification of ASFV. (WOAH recommended...) B646L Quantitative real-time PCR (qPCR) is one of the mainstream methods currently available (WOAH.2008). However, the high variability of the ASFV genome may limit the detection of single targets. The genome of African swine fever virus (ASFV) presents a double-stranded linear DNA structure, with a total length of approximately 170 kb. Its genomic structure can be divided into three functional regions: a central core region containing highly conserved coding sequences, flanking regions consisting of a 40.5 kb left variable region and a 20 kb right variable region composed of tandem repeats and multigene family (MGF) gene clusters. Different ASFV isolates (or genotypes) contain five types of MGFs in their genomes, namely... MGF100 , MGF110 , MGF300 , MGF50 5 and MGF360( Chapman et al. (2008) stated that MGFs play important roles in determining cell tropism, inhibiting interferon responses, and inflammatory responses. In recent years, multigene families (MGFs) have attracted attention due to their important roles in viral replication and immune evasion. For example, K205R Quantitative real-time PCR of genes has been shown to have superior performance compared to... B646L The amplification efficiency was significantly higher (99.8% vs. 95%), suggesting that identifying other functional genes as detection targets may improve diagnostic efficacy. Researchers Luo et al. (2023) found that... MGF-300-1L This is a highly conserved, non-essential early gene of ASFV, encoding a protein with a transmembrane region and glycosylation and phosphorylation modifications. Located in the cytoplasm, it exhibits poor immunogenicity, laying the foundation for further investigation into the function of MGF-300-1L protein in the ASFV replication cycle. However... MGF-100-1L The MGF gene, as the encoding gene of a core functional protein of ASFV, is highly conserved across different strains, and its mechanisms of involvement in host immune regulation have not yet been fully explored. Existing literature largely focuses on the pathogenic mechanism of the MGF gene, while the development of its use as a diagnostic target remains a gap. Therefore, this invention aims to… MGF-100-1L Using genes as targets, a fluorescent PCR detection method for ASFV nucleic acid was established to provide technical support for the early prevention and control of ASFV. Summary of the Invention

[0005] The present application aims to overcome the deficiencies of the prior art, and provides a primer probe combination for fluorescent quantitative PCR detection of African swine fever virus, which has high specificity and sensitivity and can quickly and accurately detect ASFV.

[0006] A second object of the present application is to provide a kit comprising the above primer and probe combination.

[0007] A third object of the present application is to provide the use of the above primer and probe combination.

[0008] A fourth object of the present application is to provide a fluorescent quantitative PCR method for detecting African swine fever virus for non-diagnostic purposes.

[0009] To achieve the above objects, the present application adopts the following technical solutions: A primer probe combination for fluorescent quantitative PCR detection of African swine fever virus, the primer probe combination is specific primer probe combination 1 or specific primer probe combination 2; The specific primer probe combination 1 comprises: Upstream primer: 5'-GCTGAGTTTACTAAATTATGC-3' (SEQ ID NO. 1) Downstream primer: 5'-GGAGTTTCTGAAATAAAGATATG-3' (SEQ ID NO. 2) Probe: 5'-ATCCATCAATCACAATGCAACTTCCTT-3' (SEQ ID NO. 3), the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group; The specific primer probe combination 2 comprises: Upstream primer: 5'-GGCTCCAGGAGGATCTTATTTTATT-3' (SEQ ID NO. 4) Downstream primer: 5'-CCATCTTCTGGATGCTTTACAACTAA-3' (SEQ ID NO. 5) Probe: 5'-CAGATAATATGACTGAGGAGTT-3' (SEQ ID NO. 6), the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group; The fluorescent reporter group and the fluorescent quencher group in the specific primer probe combination 1 and the specific primer probe combination 2 are the same, the fluorescent reporter group is FAM, and the fluorescent quencher group is BHQ1.

[0010] A fluorescent quantitative PCR kit for detecting African swine fever virus, comprising the primer and probe combination described above.

[0011] Use of the primer and probe combination described above in the preparation of a reagent or kit for detecting African swine fever virus.

[0012] A fluorescent quantitative PCR method for detecting African swine fever virus, comprising the following steps: (1) extracting nucleic acid from the sample to be detected: a conventional viral DNA extraction kit in the art can be used, such as AxyPrep™ body fluid viral DNA / RNA extraction kit. (2) using the primer and probe combination described above to perform a fluorescent quantitative PCR amplification reaction with the nucleic acid extracted in step (1) as a template; (3) determining whether the sample contains African swine fever virus according to the results of the fluorescent quantitative PCR amplification: if a specific fluorescent amplification curve appears and Ct≤38, it is determined to be positive, indicating that the sample contains ASFV; otherwise, it is negative.

[0013] The system of the fluorescent quantitative PCR amplification reaction is: 2x Pro Taq HS Probe Premix 12.5 μL, the upstream primer MGF-100-1L-F1 and the downstream primer MGF-100-1L-R1 each 0.75-1.0 μL (for example, 1.0 μL), the probe MGF-100-1L-T 0.75 μL, the template 3 μL, and RNase-free water supplemented to 25 μL. Among them, the final concentration of the upstream primer and the downstream primer is 300-400 nmol / L, and the final concentration of the probe is 300 nmol / L. Preferably, the final concentration of the upstream primer and the downstream primer is 400 nmol / L.

[0014] The conditions of the fluorescent quantitative PCR amplification reaction are: pre-denaturation at 95℃ for 2 min; then 95℃ for 10 s, 52-58℃ for 30 s (annealing and extension), for a total of 40 cycles. Preferably, the annealing temperature is 54℃.

[0015] The beneficial effects of the present application are: The present application brings many beneficial effects in the field of African swine fever virus (ASFV) detection through innovative design of primer and probe combination, optimization of detection system and selection of specific target gene, as follows: High sensitivity: the established qPCR method has a detection limit as low as 0.87 copies / µL, which is comparable to the WOAH recommended method, and can accurately detect extremely low concentration of viral nucleic acid, providing strong support for early detection of viruses.

[0016] High specificity: The specific detection results show that the method has no cross-reaction with swine fever virus, pseudorabies virus, porcine parvovirus, porcine circovirus type 2 and foot-and-mouth disease virus, and can accurately distinguish ASFV from other common pig viruses, effectively avoiding misdiagnosis.

[0017] High accuracy and repeatability: In the detection of clinical samples, the method has high consistency compared with the WOAH recommended method (Kappa = 0.903, p < 0.01), indicating that the detection result is reliable; at the same time, good repeatability ensures the stability and repeatability of the detection result under different experimental conditions and operators.

[0018] Clinical application value: In the detection of clinical samples, the detection rate of weak positive samples of the method is significantly improved, and the timely detection of weak positive samples is crucial for the early prevention and control of African swine fever, which helps to prevent the further spread of the virus. The excellent specificity and sensitivity enable the method to accurately detect the presence of the virus in the early stage of viral infection, providing a more efficient technical means for the early diagnosis of African swine fever and gaining valuable time for subsequent prevention and control measures. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 : Recombinant plasmid pET28-ASFV-MGF_100-1L map.

[0020] Figure 2 : The results of the determination of the combination of primers and probes.

[0021] Figure 3 : The results of the determination of the optimal primer and probe concentration.

[0022] Figure 4 : The results of the determination of the annealing temperature.

[0023] Figure 5 : Standard curve of TaqMan qPCR.

[0024] Figure 6 : Specificity verification amplification curve. DETAILED DESCRIPTION

[0025] The application will be further described in detail below in combination with specific examples, but the embodiments of the application are not limited thereto. The test methods in the following examples are usually carried out according to conventional experimental conditions, unless otherwise specified.

[0026] The materials and instruments used in the application are as follows: Virus nucleic acid: Classical swine fever virus (CSFV), pseudorabies virus (PRV), porcine parvovirus disease virus (PPV), swine foot-and-mouth disease O type, A virus (FMDV), porcine circovirus type 2 (PCV2) cDNA or DNA is preserved by the Foot-and-Mouth Disease and Emerging Disease Epidemiology Laboratory of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

[0027] Main instruments and reagents: The AxyPrepTM body fluid virus DNA / RNA extraction kit used in the present application is purchased from the production base of Corning Life Sciences (Wujiang) Co., Ltd. in China; the plasmid extraction kit is purchased from Tiangen Biochemical Technology Co., Ltd. (Beijing); 2x Pro Taq HS Probe Premix is purchased from Aikewei Biological Engineering Co., Ltd. (Hunan); real-time fluorescent quantitative PCR instrument (ABI QuantStudio5) and ultramicro spectrophotometer NanoDropOne are purchased from ThermoFisher Company (USA).

[0028] Example 1 Design of primers and probes The present application is based on ASFV CN / GS / 2018 strain MGF_100-1L Based on the nucleotide sequence information of the gene, two sets of specific primer-probe combinations were designed (Table 1). The above-mentioned key reagents for nucleic acid amplification were synthesized by General Biological (Anhui) Co., Ltd.

[0029] The ASFV CN / GS / 2018 MGF_100-1L gene was synthesized and constructed into the pET28a(+) vector, named pET28-ASFV-MGF_100-1L, which was completed by Wuhan Jin Kai Rui Biological Engineering Co., Ltd. The pET28-ASFV-MGF_100-1L recombinant plasmid sequencing was correct, and the recombinant plasmid map is shown in Figure 1 , the standard plasmid was extracted and the concentration was measured as 28.5667 ng / µL, A260 / A280 was 1.83, the full length of the plasmid was 5761 bp, and the copy number per microliter was calculated as 4.52×10 9 .

[0030] MGF_100-1LNucleotide sequence of the gene: GGATCCATGGGAAACAAAGAAAGTAAGTATCTGGAGATGTGCTCGGAAGAAGCATGGTTAAACATTCCCAATATTTTCAAATGCATTTTCATAAGAAAACTGTTTTATAACAAATGGCTTAAATACCAGGAAAAAAAACTAAAAAAGAGTTTGAAACTGCTGAGTTTTTACCATCCCAAAAAAGATTTTGTAGGAATAAGAGACATGCTACAAATGGCTCCAGGAGGATCTTATTTTATTACAGATAATATGACTGAGGAGTTTTTAATGTTAGTTGTAAAGCATCCAGAAGATGGGAGTGCTGAGTTTACTAAATTATGCCTTAAAGGAAGTTGCATTGTGATTGATGGATACTACTATGATAATCTTCATATCTTTATTTCAGAAACTCCTGATATATACAAATATCCCTTGATTCGTTATGATAGATAACTCGAG (SEQ ID NO. 7) The pET28-ASFV-MGF_100-1L recombinant plasmid was diluted 100,000 times as a template. The reaction system was configured according to the ProTaq HS premixed probe method qPCR kit instructions, and the specific composition was as follows: 2x Pro Taq HS Probe Premix 12.5 μL, probe 0.75 μL (0.3 μM), upstream primer and downstream primer 0.75 μL (0.3 μM) each, template 3 μL, RNase free water supplemented to 25 μL. The amplification condition was: pre-denaturation 95 °C for 2 min; 95 °C for 10 s, 58 °C for 30 s, a total of 40 cycles. The lowest Ct value and the highest ΔR were selected, if the Ct value was close, then the ΔR (fluorescence intensity increase value) was considered first, to determine the best primer and probe combination. By comparing the Ct value and the ΔR value, the optimal primer and probe combination was screened. The results showed that the first group of primer and probe combination (MGF-100-1L-F1 / R1 / T1) had lower Ct value and higher ΔR value ( Figure 2 ), so it was determined as the preferred combination for subsequent experiments.

[0031] Example 2 Optimization of real-time fluorescent quantitative PCR reaction system conditions The pET28-ASFV-MGF_100-1L recombinant plasmid diluted 100,000 times was used as a template to optimize the reaction conditions of the preferred first group of primer probe combinations. The specific settings are as follows: the primer stock solution was diluted by gradient dilution process to form four working concentrations of 100 nmol / L, 200 nmol / L, 300 nmol / L and 400 nmol / L; the probe solution was simultaneously diluted by equal ratio to form a concentration gradient system of 100 nmol / L to 400 nmol / L. The reaction system was prepared according to the reaction system provided in the ProTaq HS premixed probe qPCR kit instructions, i.e. 2x Pro Taq HS Probe Premix 12.5 μL, primers and probes were added according to the above concentrations, template 3 μL, RNase free water was supplemented to 25 μL. The amplification conditions were as follows: pre-denaturation at 95℃ for 2 min; 95℃ for 10 s, 58℃ for 30 s, for a total of 40 cycles. The lowest Ct value and the highest ΔR were selected, and if the Ct values were close, the ΔR value was considered first to determine the optimal primer and probe concentration. The annealing temperature was set to 52, 54, 56, 58, 60 and 62℃, and the optimal annealing temperature was determined by the same method.

[0032] Primer and probe concentration optimization: The primer concentration gradient (100 nmol / L, 200 nmol / L, 300 nmol / L, 400 nmol / L) and the probe concentration gradient (100 nmol / L, 200 nmol / L, 300 nmol / L, 400 nmol / L) were set, and the optimal concentration was determined by qPCR amplification according to the Ct value and ΔR value. The results showed that when the final concentrations of the upstream and downstream primers were both 400 nmol / L and the final concentration of the probe was 300 nmol / L, the reaction effect was best Figure 3 ).

[0033] Annealing temperature optimization: The annealing temperature gradient (52℃, 54℃, 56℃, 58℃, 60℃, 62℃) was set, and qPCR amplification was performed. The results showed that 54℃ was the optimal annealing temperature Figure 4 ).

[0034] The final optimal qPCR reaction system was: 2 x Pro Taq HS Probe Premix 12.5 μL, upstream primer MGF-100-1L-F1 (400 nmol / L final concentration) 1.0 μL, downstream primer MGF-100-1L-R1 (400 nmol / L final concentration) 1.0 μL, probe MGF-100-1L-T1 (300 nmol / L final concentration) 0.75 μL, template 3 μL, RNase-free water supplemented to 25 μL. The optimal amplification conditions were: pre-denaturation at 95°C for 2 min; then 95°C for 10 s, 54°C for 30 s (annealing and extension), for a total of 40 cycles.

[0035] Example 3 Establishment of standard curve Based on the existing literature reported plasmid DNA molecule quantitative model, the absolute number of plasmid DNA molecules per microliter of standard solution was deduced (Huang et al., 2019). The ultramicro UV spectrophotometer was used to analyze the nucleic acid purity of pET28-ASFV-MGF_100-1L recombinant plasmid, and the detection result showed that the OD 260 / OD 280 ratio was 1.83, which met the quality requirements of the experimental system for plasmid purity. After molecular quantitative calculation, the molecular concentration of the recombinant plasmid was determined to be 4.52 x 10 9 copies / µL.

[0036] In order to establish the standard curve of ASFV, the concentration of recombinant plasmid pET28-ASFV-MGF_100-1L was adjusted to 1 x 10 8 copies / µL, and the recombinant plasmid standard was serially diluted by 10 times, a total of 8 concentration gradients, 10 8 copies / µL to 10 1 copies / µL. Using these standards as templates, the optimized qPCR system and conditions were used for amplification, and the standard curve was successfully constructed by dynamic monitoring of fluorescence signal and cycle threshold analysis. The standard curve was plotted with the logarithmic value of the copy number of the standard as the X axis and the corresponding Ct value as the Y axis. The linear equation of the standard curve was Y = -3.304X + 38.793, and the correlation coefficient R 2 = 0.99 (P Figure 5 = 0.01), indicating that within the range of 10 1 to 10 8 copies / µL, the fluorescence signal intensity and the logarithm of the template copy number showed a high linear correlation.

[0037] Example 4 Sensitivity detection The sensitivity test was performed by gradient dilution of 10 0 ~10 -10 copies / µL. Based on the optimized TaqMan probe real-time fluorescence quantitative PCR technology system, the amplification reaction was performed by systematic gradient dilution experiment, and the minimum recognizable copy number concentration of the detection system for whole genome DNA was determined, and the sensitivity of the established qPCR method was compared and evaluated with the WOAH method.

[0038] The sensitivity test was performed by gradient dilution of 10 0 ~10 -10 copies / µL. The results showed that the detection limit of the established qPCR method was 0.87 copies / µL, and the sensitivity was equivalent to the WOAH method (Table 2) Example 5 Specificity detection The optimized qPCR method was used to amplify ASFV CN / GS / 2018, PRV, PCV2, PPV, FMDV nucleic acids to verify the specificity of the established method. The whole genome DNA of ASFV CN / GS / 2018 strain was used as a positive control, and the CSFV, PRV, PCV2, PPV, FMDV genomic DNA was detected. The results showed that only the whole genome DNA of ASFV CN / GS / 2018 strain could produce specific fluorescence curve, and the others were negative, indicating that the method had good specificity Figure 6 ).

[0039] Example 6 Reproducibility detection The present application selects 10 3 , 10 5 , 10 7 copy number gradient plasmid standard as template, and performs TaqMan probe real-time fluorescence quantitative PCR amplification experiment. Through the development of intra-batch (intra-batch repeated detection) and inter-batch (different experimental days) repeatability verification, 3 technical repeats are set for each sample, the intra-batch coefficient of variation and inter-batch coefficient of variation are calculated based on statistical method, and the repeatability precision and experimental stability of the quantitative detection system are systematically evaluated. The statistical analysis results show that the intra-batch coefficient of variation of all concentration gradients is less than 1.27%, and the inter-batch coefficient of variation is less than 1.81%, which are strictly controlled below the threshold value of 2.0% (Table 3).

[0040] Example 7 Clinical sample detection and WOAH method compliance rate comparison 90 clinical inactivated samples provided by the National African Swine Fever Regional Reference Laboratory (Lanzhou) were extracted with the virus NDA extraction kit. The samples were detected by the method established in this study and the method in the WOAH Terrestrial Manual 2019 edition at the same time, and the coincidence rate of the two detection methods was compared.

[0041] The method established in this application and the qPCR method recommended by WOAH were used to detect 90 clinical samples at the same time, the Kappa value was calculated, and the coincidence of the two methods was compared. The results showed that the Kappa value of the detection results of the two methods was 0.903, p<0.01, indicating that the two methods had high consistency, and the detection rate of weak positive samples (Ct>35) was significantly improved (4 weak positive samples were detected, and the WOAH method was not detected), indicating that the method established in this experiment had higher sensitivity for clinical samples.

[0042] Note: p value less than 0.05 means certain consistency, Kappa<0.2 means poor consistency; 0.2~0.4 means general consistency; 0.4~0.6 means moderate consistency; 0.6~0.8 means strong consistency; 0.8~1.0 means very strong consistency.

[0043] The application successfully establishes a fluorescence quantitative PCR method based on African swine fever virus MGF-100-1L Gene, and comprehensively evaluates its application value in ASFV detection. Compared with previous studies, the application shows significant innovation and breakthrough in target selection, method optimization and function research. Previous studies have focused on B646L 、 MGF360-13L 、 E183L and other genes in the selection of ASFV detection targets. The WOAH recommended B646L Gene detection system, as the industry gold standard, has been verified by a large number of studies. The application selects MGF-100-1L Gene, which belongs to the left variable region multi-gene family (MGFs) of ASFV. This region has significant sequence differences in different strains. However, through whole genome alignment, it is found that MGF- 100-1L It has a unique conservative feature in the epidemic strain, breaking the traditional understanding that the variable region is not suitable for detection targets. This innovative selection of target genes complements the method based on B646L Gene by Yu Bin et al. B646L Located in the right variable region), providing the possibility of double-target verification for ASFV complex genome detection.

[0044] The sensitivity of the method reaches 0.87 copies / µL, which is comparable to the method developed by Ge Hailiang et al. (2024) E301R (1.6 x 10 1 copies / µL). The prevalence of current low virulence strains of ASFV (such as genotype II attenuated strains) leads to missed detection by traditional detection methods. MGF-100-1L The gene remains stable expression in low virulence strains, and forms a complementary detection window with B646L easily mutable sites, effectively solving the problem of "early diagnosis of low strain" pointed out by Hu Ling et al. (2015). In clinical sample detection, the method established in the present application has higher consistency and higher sensitivity than the WOAH recommended method. This result not only verifies the reliability and accuracy of the method, but also lays a foundation for its wide application in clinical practice. By comparing the performance of the two methods in clinical sample detection, the present application further emphasizes the advantages of MGF-100-1L the gene as a detection target. With the continuous prevalence of ASFV in the global scope, it is essential to establish a rapid, accurate and sensitive detection method for epidemic control. The present application provides new scientific basis and technical means for the detection and prevention and control of ASFV by innovative target selection and method optimization.

[0045] In summary, the present application develops a highly efficient and sensitive TaqMan fluorescent quantitative PCR detection primer probe combination and method for African swine fever virus (ASFV). The MGF-100-1LThe gene sequence was analyzed, and specific primers and probe combinations were designed and screened for the conserved region of the gene. By constructing a recombinant plasmid containing the gene fragment as a standard for optimizing the PCR reaction system, an ASFV fluorescence PCR detection method was established, and the specificity, sensitivity, repeatability, and accuracy of the method were evaluated. 90 clinical samples were detected and compared with the WOAH recommended detection method. The results showed that the standard curve linear equation was Y=-3.304X+38.793, and the correlation coefficient was 0.99, indicating good linearity. Sensitivity test found that the detection limit of the established qPCR method was 0.87 copies / µL, and the sensitivity was comparable to that of the WOAH method. Specificity detection verified that the method had no cross reaction with classical swine fever virus, pseudorabies virus, porcine parvovirus, porcine circovirus type 2, and foot-and-mouth disease virus. In clinical sample detection, the method had high consistency with the WOAH recommended method (Kappa = 0.903, p<0.01), and the detection rate of weak positive samples was significantly improved. The invention successfully constructed a fluorescence quantitative PCR detection system based on African swine fever virus MGF-100-1L gene, which showed excellent specificity and sensitivity, and the detection results were highly consistent with those of the existing classical method. This technical breakthrough not only provides a more efficient technical means for early diagnosis of African swine fever virus, but also provides a strong technical support for the subsequent research and development of African swine fever virus vaccine and the in-depth study of the pathogenic mechanism of the virus.

Claims

1. A primer-probe combination for the real-time quantitative PCR detection of African swine fever virus, characterized in that, The primer-probe combination is either specific primer-probe combination 1 or specific primer-probe combination 2; The specific primer-probe combination 1 comprises: Upstream primer: 5'-GCTGAGTTTACTAAATTATGC-3' Downstream primer: 5'-GGAGTTTCTGAAATAAAGATATG-3' Probe: 5'-ATCCATCAATCACAATGCAACTTCCTT-3', wherein the 5' end of the probe is labeled with a fluorescent reporter group and the 3' end is labeled with a fluorescent quencher group; The specific primer-probe combination 2 comprises: Upstream primer: 5'-GGCTCCAGGAGGATCTTATTTTATT-3' Downstream primer: 5'-CCATCTTCTGGATGCTTTACAACTAA-3' Probe: 5'-CAGATAATATGACTGAGGAGTT-3', wherein the 5' end of the probe is labeled with a fluorescent reporter group and the 3' end is labeled with a fluorescent quencher group.

2. The primer-probe combination according to claim 1, characterized in that: The fluorescent reporter group and the fluorescent quencher group are the same in the specific primer-probe combination 1 and the specific primer-probe combination 2. The fluorescent reporter group is FAM and the fluorescent quencher group is BHQ1.

3. A real-time PCR kit for detecting African swine fever virus, characterized in that: It includes the primer-probe combination as described in claim 1 or 2.

4. The use of the primer-probe combination according to claim 1 or 2 in the preparation of reagents or kits for detecting African swine fever virus.

5. A real-time quantitative PCR method for detecting African swine fever virus for non-diagnostic purposes, characterized in that, Includes the following steps: (1) Extract nucleic acid from the sample to be tested; (2) Using the extracted nucleic acid as a template, perform a real-time PCR amplification reaction using the primer and probe combination described in claim 1 or 2; (3) Determine whether the sample contains African swine fever virus based on the results of quantitative real-time PCR amplification.

6. The method according to claim 5, characterized in that: The system for the real-time PCR amplification reaction in step (2) is as follows: 12.5 μL of 2×Pro Taq HS Probe Premix, 0.75-1.0 μL each of the upstream and downstream primers, 0.75 μL of the probe, 3 μL of template, and RNase-free water to 25 μL; wherein the final concentration of the upstream and downstream primers is 300-400 nmol / L, and the final concentration of the probe is 300 nmol / L.

7. The method according to claim 6, characterized in that: The final concentrations of both the upstream and downstream primers were 400 nmol / L.

8. The method according to claim 5, characterized in that: The conditions for the real-time PCR amplification reaction described in step (2) are: pre-denaturation at 95℃ for 2 min; then 95℃ for 10 s, annealing at 54-58℃ for 30 s, for a total of 40 cycles.

9. The method according to claim 8, characterized in that: The annealing temperature is 54°C.