Fusarium pseudograminearum effector protein fpE01 and its application in wheat disease resistance

Abstract

The present application relates to the technical field of genetic engineering, and discloses a false smut fungus effector protein FpE01 and application thereof in wheat disease resistance. The amino acid sequence of the false smut fungus effector protein FpE01 is shown as SEQ ID NO. 1. The nucleotide sequence of the coding gene of the false smut fungus effector protein FpE01 is shown as SEQ ID NO. 2. The present application adopts the false smut fungus effector protein FpE01 and application thereof in wheat disease resistance, constructs a knock-out mutant of the coding gene FpE01, determines the toxicity function of the coding gene FpE01 in the process of the false smut fungus invading wheat, and then uses the effector protein to construct a wheat strain resistant to stem base rot, thereby providing an excellent wheat material for cultivating a stem base rot resistant variety.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the Fusarium pseudograss effector protein FpE01 and its application in wheat disease resistance. Background Technology

[0002] Wheatcrown rot (WCR), caused by *Fusarium pseudograminearum*, is a significant soil-borne disease in wheat production. The main symptom is browning and rotting of the base of the wheat stem, which can lead to seedling blight and whiteheads in severe cases. Wheatcrown rot occurs and causes significant damage in countries such as Australia, the United States, and Canada. In normal years, it causes an average yield loss of about 9.5%, reaching up to 35% in epidemic years. In recent years, this disease has become widespread in the Huang-Huai-Hai winter wheat region, showing a trend of increasing severity each year. Currently, the disease incidence in Henan and Hebei provinces is as high as 65.1% and 81.4%, respectively, seriously threatening wheat production. Due to a lack of understanding of the pathogenic mechanism, it is difficult to develop a sustainable and effective control strategy, leading to the increasing severity of the disease year by year. Therefore, elucidating the pathogenic mechanism of *Fusarium pseudograminearum* infecting wheat is an urgent need for the development of targeted control technologies and the breeding of resistant varieties.

[0003] During plant infection, pathogens secrete numerous effector proteins into host cells, playing a crucial role in the invasion, colonization, and spread of pathogens. The interaction mechanisms between pathogen effector proteins and host target proteins typically involve multiple molecular levels. The metabolic pathways of these interaction targets are often important disease resistance and physiological metabolic pathways in the host plant. However, effector proteins from different types of pathogens exhibit significant differences. Therefore, research on effector protein-host interactions is essential for understanding plant disease resistance mechanisms and creating resistant materials. Currently, little is known about the biochemical activities of *Fusarium graminearum* effector proteins and how they regulate plant immune responses, especially regarding *Fusarium graminearum* effector proteins. Summary of the Invention

[0004] The purpose of this invention is to provide the Fusarium graminearum effector protein FpE01 and its application in wheat disease resistance. A knockout mutant of the encoding gene FpE01 was constructed, and the toxic function of the encoding gene FpE01 in the process of Fusarium graminearum infecting wheat was determined. Then, using this effector protein, a wheat line resistant to stem rot was constructed, providing excellent wheat material for the breeding of stem rot resistant varieties.

[0005] To achieve the above objectives, the present invention provides Fusarium pseudograss effector protein FpE01, the amino acid sequence of which is shown in SEQ ID NO.1.

[0006] The present invention also provides a coding gene for the above-mentioned Fusarium pseudograss effector protein FpE01, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0007] The present invention also provides the application of the above-mentioned Fusarium pseudograss effector protein FpE01 or the above-mentioned encoding gene in wheat resistance to stem rot.

[0008] Furthermore, the effector protein FpE01 plays a role in the interaction between Fusarium pseudograss and wheat.

[0009] Furthermore, the encoding gene was upregulated during Fusarium graminearum infection of wheat.

[0010] The present invention also provides the application of the above-mentioned Fusarium pseudograss effector protein FpE01 or the above-mentioned encoding gene in reducing the pathogenicity of Fusarium pseudograss.

[0011] The present invention also provides the application of the above-mentioned Fusarium pseudograss effector protein FpE01 or the above-mentioned encoding gene in the breeding of wheat varieties resistant to stem rot.

[0012] The present invention also provides a method for breeding wheat varieties resistant to stem base rot, wherein the silent fragment of the above-mentioned coding gene is transferred into wheat material to obtain wheat varieties with silent coding genes.

[0013] Furthermore, the nucleotide sequence of the silent fragment encoding the gene is shown in SEQ ID NO.3.

[0014] Furthermore, a vector for interfering with the silencing fragment of the coding gene was constructed, and Agrobacterium-mediated transformation was introduced into wheat embryos to obtain transgenic wheat with the silencing coding gene.

[0015] The advantages and positive effects of the *Fusarium graminearum* effector protein FpE01 described in this invention and its application in wheat disease resistance are as follows:

[0016] 1. Reverse genetics was used to analyze the FpE01 gene encoding an effector protein of *Fusarium graminearum*. FpE01 was upregulated during stem rot infection. Gene knockout technology was used to knock out FpE01, and its toxic function during *Fusarium graminearum* infection was determined. FpE01 was cloned into an interference vector, and wheat embryos were transformed using Agrobacterium-mediated transgenic technology. The resulting transgenic wheat plants exhibited resistance to *Fusarium graminearum*.

[0017] 2. In this invention, transgenic plants with the FpE01 gene silenced exhibit resistance to Fusarium graminearum. Therefore, this effector protein can be used to create strains resistant to stem rot, providing excellent wheat material for the breeding of stem rot-resistant varieties.

[0018] 3. Compared with traditional disease-resistant breeding technology, the plant disease-resistant genetic engineering technology can overcome reproductive isolation and incompatibility between species and distant hybridization, and achieve targeted improvement of target traits in a shorter period of time, providing crops with more comprehensive, continuous and broad-spectrum protection.

[0019] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0020] Figure 1 This is a flowchart illustrating the verification method of the Fusarium pseudograss effector protein FpE01 in the breeding and improvement of wheat varieties in this invention.

[0021] Figure 2 This is a schematic diagram of the expression profile analysis of the gene FpE01 encoding the effector protein of Fusarium graminearum in an embodiment of the present invention;

[0022] Figure 3 This is a schematic diagram of the phenotypic results of knocking out the coding gene FpE01 in an embodiment of the present invention, where A is the phenotypic result and B is the disease index;

[0023] Figure 4 Structural diagram of the gene FpE01 interference vector in this embodiment of the invention;

[0024] Figure 5 This diagram illustrates the phenotypic results of stem-base rot fungus inoculation into transgenic plants with silenced FpE01 encoding gene in this embodiment of the invention. WT represents wild-type plants, and RNi-L3 and RNi-L5 represent the L3 and L5 lines of the T3 generation of transgenic plants with silenced FpE01 encoding gene. A represents the phenotypic results, and B represents the disease index. Detailed Implementation

[0025] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0026] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0027] Unless otherwise defined, the instruments, equipment and reagents used in this invention are all commercially available.

[0028] Wild-type strain 2035 was isolated and preserved from diseased tissue at the base of wheat stems in Wuqiao by the Fungal Diseases Laboratory of the Institute of Plant Protection, Hebei Academy of Agricultural and Forestry Sciences.

[0029] Figure 1This is a technical roadmap for the present invention. An embodiment of the present invention provides a method for verifying the function of the gene FpE01 encoding a Fusarium graminearum effector protein, comprising: S101, obtaining FpE01 transgenic wheat, and performing molecular detection on the obtained FpE01 transgenic wheat; S102, inoculating T3 generation transgenic plants with Fusarium graminearum, identifying the disease resistance of the transgenic plants, and determining the function of the gene FpE01.

[0030] This invention further provides a method for identifying the function of the Fusarium graminearum effector protein FpE01, comprising: real-time quantitative PCR based on qRT-PCR with microtubule β-tubulin (TUB) as an internal control, using specific primers for the effector protein gene FpE01 to determine the expression level of gene FpE01 at different infection times of Fusarium graminearum infection of wheat; knocking out the gene encoding FpE01 of Fusarium graminearum effector protein FpE01 using homologous recombination gene knockout technology, the pathogenicity of the knockout mutant is significantly lower than that of the wild type, and the full-length FpE01 gene is reintroduced into the knockout mutant, the pathogenicity phenotype is restored to that of the wild type, verifying the toxic function of FpE01 in the process of Fusarium graminearum infection.

[0031] Example 1: Identification and expression pattern of effector genes in Fusarium pseudograss

[0032] 1.1 Extraction of total RNA from pathogenic bacteria:

[0033] (1) Sample collection: Germinated wheat seeds were soaked in 1×10 5 The inoculum was soaked in a 2035 (wild-type strain) bacterial solution at a concentration of / mL for 15 minutes, then air-dried. Germinated wheat seeds inoculated with the strain were placed in glass petri dishes and incubated at 25℃. Samples were taken at four time points after inoculation (24h, 48h, 72h, and 96h). The samples were then quickly stored at -80℃ for total RNA extraction.

[0034] (2) RNA extraction and first-strand cDNA synthesis: RNA was extracted using the RNAprep Pure kit (Tiangen Biotech Co., Ltd.) and purified. First-strand cDNA synthesis was then performed using the RevertAid™ first-strand cDNA synthesis kit; detailed instructions are provided in the user manual.

[0035] (3) Using wheat-Fusarium oxysporum interaction cDNA extracted from samples at different infection time points as templates, and the Fusarium oxysporum microtubule β-tubulin (TUB) gene as an internal reference gene (FpTUB-F: 5'-CTTACGGCGACCTGAACTACCTTG-3' (SEQ ID NO.4) and FpTUB-R: 5'-AGCGAATCCGACCATGAAGAAGTG-3' (SEQ ID NO.5)), real-time quantitative PCR was performed using specific quantitative primers for the effector protein gene FpE01 (FpE01Q-F: 5'-ACCCTACCAAGGTTGATGC-3' (SEQ ID NO.6) and FpE01Q-R: 5'-GTCGGTCCAGAAGGAGAAG-3' (SEQ ID NO.7)). The expression levels of gene FpE01 at different infection times in wheat infected with stripe rust are as follows: Figure 2 As shown, the PCR reaction system was as follows: 12.5 μL TBgreen quantitative MiX, 2 μL template, 0.5 μL each of forward and reverse primers, and 9.5 μL RNA-free water. The reaction program was as follows: 95℃ pre-denaturation for 10 min; 95℃ for 15 s; 60℃ for 15 s; 72℃ for 20 s; 40 cycles.

[0036] Figure 2 The expression profile of gene FpE01 at different time points after wheat was inoculated with Fusarium graminearum 2035 was presented. The expression of gene FpE01 began to be upregulated 1 day after Fusarium graminearum infection of wheat stem base, and reached its highest level on the 3rd day, indicating that gene FpE01 may play a toxic role in the interaction between wheat and Fusarium graminearum.

[0037] 1.2 Expression of effector proteins in Nicotiana tuberculosis:

[0038] The candidate effector gene FpE01 sequence was modified by removing the leading signal peptide, and then amplified by PCR using a high-fidelity enzyme. The pYBA1132 plasmid was digested with BamHI and SalI restriction endonucleases. The PCR product was purified, ligated into the pYBA1132 vector using a one-step cloning method, and transformed into *E. coli* DH5α competent cells. Positive clones were detected using a PCR system with universal primers 1132-F (5'-TTGGTTGAAACAGAAGCGATAA-3'(SEQ ID NO.8)) and 1132-R (5'-TTGGTTGAAACAGAAGCGATAA-3'(SEQ ID NO.9)). Plasmids were extracted according to the plasmid miniprep kit instructions, and then plasmids with correct bands were sent to Sangon Biotech for sequencing. The sequencing information was compared with the sequence information provided by the *Fusarium graminearum* genome database. Complete sequence alignment indicates successful vector construction.

[0039] The constructed recombinant vector FpEP-1132 was transformed into Agrobacterium GV3101 competent cells using electroporation. Positive transformants were detected using universal primers 1132-F and 1132-R. Positive transformants were picked and cultured in LB medium containing 50 μg / mL kanamycin at 28℃ and 220 rpm for 2 days. The cells were then collected by centrifugation at 4500 rpm for 3 minutes. The cells were then analyzed by electroporation with 10 mL of MgCl2 (10 mmol·L⁻¹). -1 Wash the bacterial cells three times, then continue washing with MgCl2 (10 mmol·L⁻¹). -1 ) Float to OD 600 =0.5. Select tobacco leaves that are 4-6 weeks old. Draw a circle with a diameter of about 1 cm on the lower epidermis with a marker and inject the solution into the circle. After injection, the tobacco leaves are placed in a constant temperature environment at 25℃ with a photoperiod of 16 hours of light and 8 hours of darkness. Each treatment is replicated in 3 groups, with 9 leaves of basically the same growth condition in each group. Observe the leaf symptoms continuously for 3-7 days.

[0040] The candidate effector gene FpE01 can inhibit BAX-induced programmed cell death, meaning that this gene may have a toxic function in inhibiting plant defense responses, and will be used in subsequent experimental studies.

[0041] Example 2: Pathogenic Function Analysis of Candidate Effector Genes in Fusarium graminearum

[0042] 2.1 Knockout of effector gene FpE01:

[0043] Based on the effector gene FpE01 sequence, upstream primer 1F / 2R, downstream primer 3F / 4R, detection primer 5F / 6R, hygromycin phosphatase H850-F / H852-R, 7F / H855R, and H856F / 8R, and complementary primer FpE01C-F / R were designed using Premier 5.0 software. Primers 2R and 3F contain homologous sequences at their 5′ ends to the hygromycin phosphatase sites, while primer FpE01C-F / R contains sequences at its 5′ end homologous to the pFL2 XhoI restriction site. Primer sequences and related parameters are shown in Table 1.

[0044] Table 1 Primers for FpE01 gene knockout

[0045]

[0046]

[0047] Genomic DNA extracted from wild-type fungus 2035 was used as a template to amplify upstream and downstream fragments L1 and L2 using primers 1F / 2R and 3F / 4R, respectively. Fragments H1 and H2 of hygromycin were amplified using primers HYG / F+HY / R and YG / F+HYG / R. pCB1003 was used as a template (40 ng / 50 μL), and the annealing temperature was set to 63 °C. The PCR products were then recovered by gel extraction (gel extraction kit from Sangon Biotech, see its instruction manual).

[0048] First step of overlap PCR: PCR system (without primers): 5 μL 10×Tap buffer; 4 μL MgCl2; 4 μL dNTPs (2.5 mM); 40 ng each of template 1 (H1+L1) and template 2 (H2+L2); 0.6 μL FastPfu enzyme; add sterile water to 50 μL. First step program: 95℃, 3 min; 95℃, 30 s; 64.5℃, 40 s; 72℃, 50 s (15 times); 72℃, 10 min; 4℃ forever.

[0049] Step 2 of overlap PCR: Add 1 μL each of primer 1F+HY / R and primer YG / F+4R to the mixture from step 1, and supplement with 0.3 μL of high-fidelity enzyme. Step 2 program: 95℃, 3 min; 95℃, 30 s; 61.5℃, 40 s; 72℃, 50 s (35 times); 72℃, 10 min; 4℃ forever.

[0050] Electrophoresis detection: Dilute the correctly detected PCR product 10-fold and amplify it using primers 1F+HY / R and YG / F+4R. If the target band is correctly detected by gel electrophoresis, concentrate the PCR product (>150 μg). The concentrated product is the gene knockout cassette.

[0051] The activated wild-type fungus 2035 was inoculated into 100 mL of CMC liquid medium and cultured for 72 h (25℃, 150 rpm). The medium was filtered through a sterile gauze funnel and centrifuged at 4000 rpm for 8 min at room temperature. The supernatant was discarded, and the spores were transferred to 100 mL of YEPD liquid medium and cultured on a shaker at 25℃, 175 rpm for 12 h. The medium was then filtered through a sterile gauze funnel again, and the mycelium was collected. 0.5 g of mycelium was added to 10 mL of protoplast buffer and mixed in this ratio. The mixture was cultured on a shaker for 2 h (30℃, 90 rpm). The enzymatically digested mixture was filtered through a gauze funnel with two layers of lens paper between the tubes and transferred to a sterile centrifuge tube (50 mL). The mixture was then incubated with 1.2 mol·L⁻¹ hydrochloric acid. -1 Wash with potassium chloride (wash out more protoplasts). Centrifuge at 4000 rpm for 6 min at room temperature. Discard the supernatant, add 10 mL of STC buffer to gently resuspend, and centrifuge at 4000 rpm for 6 min. Adjust the concentration to 1 × 10⁻⁶. 7 / mL. Add two labeled DNA fusion fragments (5μg-10μg each) to a centrifuge tube containing 200μL of protoplasts (50mL), mix well, and incubate at room temperature for 20min. Add 1mL of 40% PTC to the tube, invert and mix well, and incubate at room temperature for 20min. Add 5mL of ampicillin TB3 (50g / mL), and incubate overnight at 25℃ on a shaker at 90rpm. After the hyphae have clumped together, centrifuge and discard the supernatant. Add regeneration semi-solid medium containing hygromycin (120μL / mL), mix well, and pour into plates. Continue culturing at 25℃ until single colonies grow. Pick each single colony and inoculate it onto PDA medium containing hygromycin (120μL / mL). The colonies that eventually grow are the transformants.

[0052] Using genomic DNA as a template, a gene fragment containing its own promoter and termination sequence was amplified using the primer pair FpE01 / CF+FpE01 / CR. The PCR product was concentrated and dissolved in sterile water. The extracted pHZ2 plasmid and the concentrated PCR product were double-digested with restriction endonucleases Pst I and Bam HI (fermentas) in the following system: 5 μL of 10× Greenbuffer, 2 μg of plasmid or PCR product, 2.5 μL of Pst I, 2 μL of Bam HI, and sterile water to a final volume of 50 μL; digestion was performed at 37°C for 8 h, followed by inactivation of the endonucleases at 80°C for 20 min; the digested product was recovered and purified, and dissolved in sterile water. The gel-recovered linear vector pHZ100 and the insert fragment were ligated using ligase T4 in the following system and conditions: 100 ng of vector, 5 μL of insert DNA, and 2 μL of 10× ligase buffer, and sterile water to a final volume of 20 μL. Ligation conditions: Ligation should be performed at 4℃ for at least 2 days. Enzyme inactivation should be achieved by incubation at 80℃ for 20 minutes. Transformants obtained after initial screening with hygromycin were detected by PCR using primers 5F+6R. Transformants with positive results were subjected to phenotypic observation on PDA medium. Transformants with wild-type phenotypes can be used for subsequent experiments.

[0053] 2.2 Toxicity assay of the mutant:

[0054] The mutant and wild-type strains were cultured on PDA plates for 7 days, respectively. The culture trays were then punched with a 6 mm diameter punch and placed in 100 mL of CMC liquid medium. The culture was carried out at 25℃ and 170 rpm with shaking for 5–7 days. The spore suspension concentration for each strain was adjusted to 1 × 10⁻⁶. 5 / mL was used for wheat inoculation. Germinated wheat seeds were immersed in the spore suspension for 15 min, then the suspension was discarded, and the seeds were sown in plastic nutrient pots with sterile sand at the bottom. Each treatment was repeated 3 times, with 4 pots per replicate, and 5 seeds sown in each pot. The pots were then incubated at 22℃ under alternating light and dark conditions for 12 h. The length of diseased stem base in wheat was measured after 21 days, and the disease index was calculated. The results showed that FpE01 gene knockout reduced the pathogenicity of the fungus, indicating that FpE01 and its encoded effector protein play a toxic role in the interaction between stem base rot fungus and wheat. Figure 3 ).

[0055] Example 3: Cultivation of Gene-Silenced Wheat Plants

[0056] This embodiment describes the cultivation of transgenic wheat with the silenced gene FpE01 and its disease resistance identification. The method and procedure are described in [link to documentation]. Figure 1The silenced fragment 1 of gene FpE01 (SEQ ID NO.3: CGGCCAGTTCAGCATGAACTGGAACGGCAACCGTGGTAACCACGTCGG TGGTAAGGGATGGAACCC) was inserted into two positions in the vector via homologous recombination (one fragment was inserted forward and the other was inserted backward to complement each other, thus forming a hairpin structure), to obtain the gene FpE01 interference vector (e.g., Figure 4 As shown), transgenic plants with the FpE01 gene silenced were obtained through Agrobacterium-mediated genetic transformation. PCR detection was performed on the transgenic plants, and two lines, L3 and L5, from the T3 generation were inoculated with wild-type Fusarium graminearum strain 2035. The results showed that the transgenic plants with the FpE01 gene silenced exhibited resistance to Fusarium graminearum. Figure 5 ).

[0057] Therefore, this invention utilizes the aforementioned Fusarium pseudogracilis effector protein FpE01 and its application in wheat disease resistance to construct a knockout mutant of the encoding gene FpE01, determine the toxic function of the encoding gene FpE01 in the process of Fusarium pseudogracilis infecting wheat, and then use this effector protein to construct a wheat line resistant to stem rot, providing excellent wheat material for the breeding of stem rot resistant varieties.

[0058] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. The application of Fusarium graminearum effector protein FpE01 or its encoding gene in wheat resistance to stem rot, characterized by: Knocking out the gene encoding the Fusarium pseudogracilis effector protein FpE01 in silent wheat reduces stem rot; The amino acid sequence of the effector protein FpE01 is shown in SEQ ID NO.1, and the nucleotide sequence of the gene encoding the effector protein FpE01 is shown in SEQ ID NO.

2.

2. The application of the Fusarium pseudobulb effector protein FpE01 or its encoding gene in reducing the pathogenicity of Fusarium pseudobulb, characterized in that: Knocking out the gene encoding the Fusarium pseudogracilis effector protein FpE01 in silent wheat reduces stem rot; The amino acid sequence of the effector protein FpE01 is shown in SEQ ID NO.1, and the nucleotide sequence of the gene encoding the effector protein FpE01 is shown in SEQ ID NO.

2.

3. The application of Fusarium graminearum effector protein FpE01 or its encoding gene in the breeding of wheat varieties resistant to stem rot, characterized by: Knocking out the gene encoding the Fusarium pseudogracilis effector protein FpE01 in silent wheat reduces stem rot; The amino acid sequence of the effector protein FpE01 is shown in SEQ ID NO.1, and the nucleotide sequence of the gene encoding the effector protein FpE01 is shown in SEQ ID NO.

2.

4. A method for breeding a wheat variety resistant to stem rot, characterized in that, The silent fragment of the gene encoding the effector protein FpE01 was transferred into wheat material to obtain wheat varieties with the silent gene. The nucleotide sequence of the gene encoding the effector protein FpE01 is shown in SEQ ID NO.

2.

5. The cultivation method according to claim 4, characterized in that, The nucleotide sequence of the silent fragment encoding the gene is shown in SEQ ID NO.

3.

6. The cultivation method according to claim 4, characterized in that, A vector for silencing gene encoding fragments was constructed and transferred into wheat embryos via Agrobacterium-mediated transformation to obtain transgenic wheat with silenced gene encoding fragments.

Images