Rice bacterial blight resistance related protein XA50 and coding gene and application thereof

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice XA50 protein related to bacterial blight resistance as well as a coding gene and application of the rice XA50 protein. Experimental results prove that the resistance of a complementary transgenic plant of the Xa50 to the bacterial leaf blight is remarkably enhanced, and the resistance of a knockout transgenic plant of the Xa50 gene to the bacterial leaf blight is remarkably reduced. The rice Xa50 gene provided by the invention has the function of positively regulating and controlling the disease resistance of rice, can be used for improving the resistance of rice to bacterial blight, and has important significance for cultivating a new variety of bacterial blight resistant rice.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and in particular relates to an XA50 protein related to rice resistance to bacterial blight and a coding gene and application thereof. Background Art

[0002] Rice ( Oryza sativa L) is one of the most important food crops in the world and is vulnerable to a variety of pathogens during its growth. Xanthomonas oryzae pv. oryza , Xoo ) is the most serious and widespread bacterial disease in rice production. The main characteristics of bacterial blight are strong suddenness and rapid spread of infection. At present, its scope of occurrence has spread to rice-producing areas around the world, which can lead to a 20%-50% reduction in production throughout the year. In severe cases, there will be no harvest, posing a serious threat to agricultural production and food security. Chemical control of rice bacterial blight is not only costly and ineffective, but also environmentally unfriendly. Cultivating and promoting disease-resistant varieties is currently the most fundamental, economical and safest way to prevent and control bacterial blight. The cloning and functional research of disease-resistant genes is of great significance for the study of the molecular mechanism of rice disease resistance and molecular disease-resistant breeding.

[0003] At present, there are 48 rice bacterial blight resistance genes that have been internationally registered and reported in journals, of which 16 members have been isolated and cloned. According to the type of disease resistance gene encoding product and disease resistance mechanism, they are mainly divided into six types: NLR (nucleotide-binding leucine-rich repeat receptors), receptor-like kinases, cell wall-associated kinases (WAK), γ subunit of transcription factor ⅡA, E (executor) and SWEET. Plant WAK is a special type of receptor-like kinase, which consists of an extracellular domain, a transmembrane domain and an intracellular kinase domain. Among them, the extracellular domain is usually directly connected to the cell wall. As a protein kinase that connects the cell wall and the cytoplasm at the same time, it often has multiple biological functions, such as regulating plant growth and development, participating in signal transduction and activating disease resistance. The multiple roles of WAK not only have important scientific research value, but also have great application potential in the synergistic improvement of comprehensive rice traits. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a protein XA50 for resistance to rice bacterial blight and its encoding gene and application. The rice Xa50 gene has the function of positively regulating the disease resistance of rice and can be used to improve the resistance of rice to bacterial blight, which is of great significance for breeding new rice varieties resistant to bacterial blight.

[0005] The purpose of the present invention can be achieved by the following technical solutions: A rice bacterial blight resistance protein XA50 has an amino acid sequence as shown in SEQ ID No.3.

[0006] At the same time, the present invention also provides a gene encoding the rice bacterial blight resistance protein XA50, and the gene has a nucleotide sequence as shown in SEQ ID No.2.

[0007] The present invention also provides an expression vector, a recombinant bacterium or a host cell of the gene.

[0008] Meanwhile, the present invention also provides the rice bacterial blight resistance protein XA50, or the application of its encoding gene in improving rice bacterial blight resistance.

[0009] The application is further applied in the cultivation of rice resistant to bacterial blight.

[0010] The present invention also provides a method for cultivating rice resistant to bacterial blight, which comprises the steps of over-expressing the gene in target plants by genetic engineering methods, and screening plants with enhanced ability to resist bacterial blight.

[0011] The method further comprises the step of cultivating a rice variety resistant to bacterial blight.

[0012] The method further comprises the step of hybridizing the obtained plants or varieties with enhanced resistance to bacterial blight with other varieties to obtain rice varieties with expected performance.

[0013] The present invention creates a new rice bacterial blight resistance germplasm CX315 by distant hybridization with wild rice, uses 10 bacterial blight pathogens to identify the resistance level of multiple strains during the tillering stage, then constructs a localized isolation population, controls the rice bacterial blight resistance gene by map-based cloning, and then verifies the function of the gene by gene complementation and gene editing technology, and finally successfully isolates a rice bacterial blight resistance gene: Xa50. The experimental results show that: CX315, compared with the susceptible receptor parent JG30, has extremely significantly improved resistance to the rice bacterial disease bacterial blight, and can be effectively applied to the molecular improvement of rice disease resistance, and has great development and application prospects.

[0014] Compared with the prior art, the present invention has the following advantages and beneficial effects: The present invention discloses the amino acid sequence of rice bacterial blight resistance protein XA50, as well as the sequence of its encoding gene and the sequence of its coding region, and verifies the function of the gene by gene complementation and gene editing technology. Experimental results show that the resistance of Xa50-complemented transgenic plants to bacterial blight is significantly enhanced, and the resistance of Xa50-gene knocked-out transgenic plants to bacterial blight is significantly reduced. The rice Xa50 gene provided by the present invention has the function of positively regulating the disease resistance of rice, can be used to improve the resistance of rice to bacterial blight, and is of great significance for cultivating new rice varieties resistant to bacterial blight. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0016] Figure 1 It is a multi-strain inoculation identification of the new disease-resistant germplasm CX315 and the recipient parent King Kong 30 (JG30).

[0017] Figure 2 This is the fine-scale mapping map of the Xa50 gene.

[0018] Figure 3 This is a comparison chart of the expression levels of Xa50 in CX315 and JG30 after inoculation with T7174.

[0019] Figure 4 This is a comparison of the inoculation phenotypes of Xa50 complementary transgenic materials and CRISPR / Cas9 gene-edited transgenic materials in the T1 generation of bacterial blight. Among them, A: a comparison of the phenotype of leaf lesions inoculated with bacterial blight fungus T7174; B: a comparison of the length of leaf lesions inoculated with bacterial blight fungus T7174. DETAILED DESCRIPTION

[0020] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto.

[0021] In order to more fully explain the implementation of the present invention, the following provides an implementation example of the rice bacterial blight resistance gene Xa50. These implementation examples are merely illustrative and not limiting of the scope of the present invention. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0022] Example 1. Obtaining material CX315 and identifying bacterial blight inoculation The applicant's laboratory created a material CX315 resistant to bacterial blight by distant hybridization with wild rice. The characteristics of this material have been stably inherited after multiple generations of self-pollination. In the tillering stage, 10 bacterial blight pathogens were used for inoculation and identification. It was found that this material showed resistance to all tested strains, and its lesion length was significantly shorter than that of the susceptible parent JG30 ( Figure 1 ).

[0023] Example 2: Genetic analysis and fine mapping of the Xa50 gene The F1 generation was obtained by hybridizing CX315 with the indica rice variety IR24 susceptible to bacterial leaf blight. T7174 was used to inoculate the F1 at the tillering stage, and all F1 showed resistance. The F2 segregation population was obtained by selfing the F1, with a total of 2342 plants. T7174 was used to inoculate the F1 at the tillering stage, and 1767 plants showed resistance and 575 plants showed susceptible. The resistance-susceptibility segregation ratio was calculated and the chi-square test was performed, which showed that the resistance-susceptibility segregation ratio was 3:1, which was in line with the Mendel's single dominant gene inheritance law, indicating that the resistance of this material was controlled by a dominant single gene (Table 1).

[0024] Table 1 Genetic analysis of bacterial blight-resistant material CX315

[0025] The rice genome reference sequence Shuhui 498 (R498) database (https: / / www.mbkbase.org / rice) and the IR24 sequence of the applicant's laboratory were used to search for the same XA50 Tightly linked molecular markers preliminarily located the candidate gene in rice chromosome 11. R498 and IR24 sequences were compared within this range to find the different sequences. Primers were designed using the Primer designing tool of the NCBI database (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome). The product fragment range was about 100-500bp, and a total of 80 pairs of primers were designed.

[0026] 21 susceptible plants were selected from the F2 segregation population of CX315 / IR24, and gene linkage analysis was performed using the above 80 primer pairs, and the target gene was located between markers ID11-7 and M11-540 on rice chromosome 11. In this interval, a region without homology was selected to further develop new molecular markers. The exchange plants screened by markers M11-148, M11-204, M11-464, M11-588, M11-602, M11-577 and M11-594 were 10, 7, 3, 2, 1, 3 and 15, respectively. A co-segregation marker M11-489 was screened, so the target gene was finally located between the linkage markers M11-464 and M11-602 at the end of chromosome 11, with a physical interval of 147.7 kb ( Figure 2 ). Genomic DNA was extracted using a one-step method. The specific steps are as follows: (1) Prepare 10x extraction solution: 100mM Tris: weigh 2.422g Tris powder and dissolve it in 100mL deionized water, adjust the pH to 9.5; 5mM EDTA: weigh 0.3722g EDTA powder and dissolve it in the above Tris solution; 1mol / L KCl: weigh 14.91g KCl powder and dissolve it in the above mixed solution. Make up to 200mL, store at room temperature, and dilute the mother solution 10 times when using.

[0027] (2) Sampling: Cut rice leaves of 1 mm to 2 mm in size, place them in a 2 mL centrifuge tube, add 2 steel beads, and draw 200 μL of 1x extract.

[0028] (3) Grinding samples: Place the centrifuge tube containing the sample and the extract on the proofing machine, balance it using the central symmetry method, and proof-mill twice at 1000 rpm, each time for 30 seconds.

[0029] (4) Water bath: Place the ground sample in a 65°C water bath for 30 minutes, and mix by inverting the centrifuge tube every 10 minutes.

[0030] (5) Absorb the supernatant: After the water bath, centrifuge the sample at 12000 rpm for 10 minutes and aspirate 100 μL of the supernatant into a 1.5 mL centrifuge tube or 96-well plate. The supernatant is the rice DNA.

[0031] The PCR reaction system used a 10μL system: 2μL DNA template, 5μL 2×PCR reaction solution, 0.5μL each of forward and reverse primers (10μmol / L), and 2μL ddH2O. The PCR amplification program was as follows: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15s, annealing at 55℃~60℃ for 30s (different primers have different annealing temperatures), extension at 72℃ for 10s (PCR product size should be less than 200bp, 2×PCR reaction solution extension time is 30s / 1kb), 35 cycles; 72℃ extension for 5min, 16℃ for 5min. The PCR product was electrophoresed on a 5% agarose gel, and the gel was photographed and read on a gel imager after the electrophoresis. The primer sequences are shown in Table 2.

[0032] Table 2 Molecular markers used for fine mapping

[0033] Example 3: Determination of candidate genes Based on the 147.7 kb interval of fine positioning, candidate gene prediction was performed in the rice Shuhui 498 genome database, and a total of 14 open reading frames (ORFs) were found. The expression levels of all candidate genes were analyzed, such as Figure 3The expression of ORF5 was significantly upregulated after CX315 was inoculated with T7174, and the gene was not induced to express in the recipient susceptible parent JG30. Therefore, the gene was preliminarily determined to be a candidate gene and named Xa50. Its gDNA has the nucleotide sequence shown in SEQ ID No.1, its cDNA has the nucleotide sequence shown in SEQ ID No.2, and the encoded protein has the amino acid sequence shown in SEQ ID No.3.

[0034] Example 4. Construction of Xa50 gene complementation vector and gene CRISPR / Cas9 editing vector 1. Construction of complementary vector of Xa50 To verify whether the disease resistance of CX315 is caused by Xa50, CX315 was used as a template, Xa50-CF: gagctcggtacccggggatccTACACCTATATAACACTCCTAAATTAGAAAAAA (SEQ ID No. 24), Xa50-CR: caggtcgactctagaggatccTGTGCACAAAAATACATCTCCTTGA (SEQ ID No. 25) as primers, and the full-length sequence including the Xa50 promoter, expression cassette and terminator was successfully obtained by PCR amplification. Subsequently, the PCR product fragment of Xa50 was ligated into the vector pCAMBIA1300 linearized by BamHI single enzyme digestion using the ClonExpress II One Step Cloning Kit (Cat. No. C112-01) of Novazon through homologous recombination. The recombinant product was transferred into E. coli TOP10 by heat shock method and then spread on LB plate containing 50 mg / L kanamycin for growth for 16 hours. The positive clones were selected and the plasmids were sent to Beijing Biotechnology Co., Ltd. for first-generation sequencing. The plasmid with correct sequencing was named pCAMBIA1300-Xa50.

[0035] 2. Construction of CRISPR / Cas9 editing vector for Xa50 CRISPR / Cas9 technology was used to construct a knockout vector for editing the Xa50 gene, and the target sequences used were target sequence 1 and target sequence 2.

[0036] Target sequence 1: CCGCTGGATTCAATGGTGTTAGG (SEQ ID No. 26); target sequence 2: CACGCCGTTCCTGTTTGCGGAGG (SEQ ID No. 27).

[0037] Vector construction was based on the method of Ma et al. (2015) (Ma XL, Zhang QY, Zhu QL, et al. A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants [J]. Mol Plant, 2015, 8 (8), 274-1284).

[0038] (1) Preparation of target linker: Target 1 adapter primer sequences: Xa50-gRT1: 5'-gccgCCGCTGGATTCAATGGTGTT-3' (SEQ ID No. 28), Xa50-OsU6aT1: 5'-aaacAACACCATTGAATCCAGCGG-3' (SEQ ID No. 29).

[0039] Target 2 adapter primer sequences: Xa50-gRT2: 5'-gttgCACGCCGTTCCTGTTTGCGG-3' (SEQ ID No.30), Xa50-OsU6aT2: 5'-aaacCCGCAAACAGGAACGGCGTG-3' (SEQ ID No.31).

[0040] Take 1 μL of each adapter primer (100 μM) and add it to 98 μL ddH2O to dilute to 1 μM. Heat at 90℃ for 30 s and cool to room temperature to complete annealing.

[0041] (2) Enzyme digestion of sgRNA vector: Take 1 μg of LacZ-U6a / LacZ-U6b plasmids, digest with 10U of BsaI in a 25 μL reaction for 20 min, and store in the freezer.

[0042] (3) sgRNA expression cassette ligation reaction: The digested LacZ-U6a and LacZ-U6b plasmids were ligated to the linkers of target 1 and target 2, respectively. Ligation system: 1 μL of 10×T4 DNA ligase Buffer, 0.5 μL of vector plasmid, 0.5 μL of linker, 0.05 μL of T4 DNA ligase (Takara), add water to make up to 10 μL. Ligation was carried out at room temperature for 15 minutes.

[0043] (4) First round of amplification: Each sgRNA expression cassette was divided into 2 PCR reactions, each with a 15 μL reaction system: 0.5 μL of the ligation product was used as a template, and primers UF (CTCCGTTTTACCTGTGGAATCG, SEQ ID No.32) / adapter reverse primer (reaction 1) and adapter forward primer / gR-R (CGGAGGAAAATTCCATCCAC, SEQ ID No.33) (reaction 2) were used for amplification using the high-fidelity PCR enzyme PrimeSTAR® GXL DNA Polymerase (Takara): 0.5 μL of each forward / reverse primer, 2 μL of dNTP Mixture, 5 μL of 5× PrimeSTAR GXL Buffer, 0.5 μL of template, 0.5 μL of PrimeSTAR GXL DNA polymerase, and water was added to make up to 25 μL; 98°C for 3 min; 98°C for 15 s, 55°C for 15 s, 68°C for 15 s, 35 cycles; 68°C for 15 s 5min, 12℃ 5min.

[0044] (5) Second round of amplification: Take 1 μl of the first round PCR product and dilute it 10 times with H2O. Take 1 μl of each product and mix them as templates.

[0045] Target 1 primers, Pps-GGL: TTCAGAggtctcTctcgACTAGTATGGAATCGGCAGCAAAGG (SEQ ID No. 34), Pgs-GG2: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC (SEQ ID No. 35). The PCR product is U6a-sgRNA-Xa50.

[0046] Primers for target 2, Pps-GG2: TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG (SEQ ID No.36), Pgs-GGR: AGCGTGggtctcGaccgACGCGTATCCATCCACTCCAAGCTC (SEQ ID No.37). The PCR product was U6b-sgRNA-Xa50. High-fidelity PCR enzyme PrimeSTAR® GXL DNA Polymerase (Takara) was used for amplification, and the amplification system and procedure were the same as (4).

[0047] (6) The above U6a-sgRNA-Xa50 and U6b-sgRNA-Xa50 were subjected to restriction digestion-ligation reaction with the pYLCRISPR / Cas9PubiH vector to obtain the Xa50 gene knockout vector pYLCRISPR / Cas9Pubi-Xa50. Restriction digestion-ligation reaction system: U6a-sgRNA-Xa50 (10-15ng), U6b-sgRNA-Xa50 (10-15ng), pYLCRISPR / Cas9Pubi-H vector (60-80ng), 10×CutSmart Buffer 1.5μL, 10mM ATP1.5μL, BsaI-HF10U, T4 DNA ligase 35U, add ddH2O to make up to 15μL. Enzyme digestion-ligation reaction program: 37°C 10 min, 10°C 5 min, 20°C 5 min, for 3 cycles; 37°C 3 min, 10°C 5 min, 20°C 5 min, for 10 cycles.

[0048] The reaction product was transformed into Escherichia coli TOP10, positive clones were screened, and the obtained recombinant vector with the correct sequence was named pYLCRISPR / Cas9Pubi-Xa50.

[0049] Example 5: Rice genetic transformation The plasmids of pCAMBIA1300-Xa50 and pYLCRISPR / Cas9Pubi-Xa50 in Example 2 were respectively transferred into the Agrobacterium strain EHA105 by the freeze-thaw method. The EHA105 strain containing the binary plasmid vector pCAMBIA1300-Xa50 was infected with the callus tissue of the susceptible receptor parent JG30 by the Agrobacterium infection method, and after hygromycin screening, the positive callus was then differentiated and rooted to obtain the complementary transgenic plants; the EHA105 strain containing the editing vector pYLCRISPR / Cas9Pubi-Xa50 was infected with the callus tissue of the disease-resistant material CX315 by the Agrobacterium infection method, and after hygromycin screening, the positive callus was then differentiated and rooted to obtain the knockout transgenic plants.

[0050] Example 6: Detection of resistance to bacterial blight in transgenic plants The complementary transgenic positive lines T1 and the Xa50-edited knockout transgenic plant lines T1 KO were inoculated with bacterial blight pathogen T7174, and the leaf lesion length was measured 14 days after inoculation. Figure 4 It can be seen that the lesion length of the positive Xa50 gene complemented transgenic plants is significantly shorter than that of the wild-type JG30; the lesions of the Xa50 gene knockout plants are similar in length to those of JG30, showing disease susceptibility, indicating that Xa50 positively regulates rice resistance to bacterial blight.

[0051] The above results fully demonstrate that Xa50 is a resistance-related protein, which mainly plays a positive regulatory role in the rice disease resistance response process and has utilization value for rice disease resistance breeding.

Claims

1. A rice bacterial blight resistance protein XA50, characterized in that: It has an amino acid sequence as shown in SEQ ID No.

3.

2. A gene encoding the rice bacterial blight resistance protein XA50 as claimed in claim 1.

3. The gene according to claim 2, characterized in that The nucleotide sequence of the gene is shown in SEQ ID No.

2.

4. An expression vector, recombinant bacterium or host cell containing the gene according to claim 2 or 3.

5. The rice bacterial blight resistance protein XA50 as claimed in claim 1, or use of the gene encoding the protein in improving rice bacterial blight resistance.

6. The use according to claim 5, characterized in that The invention is used in cultivating rice resistant to bacterial blight.

7. A method for cultivating rice resistant to bacterial blight, characterized in that: The method comprises the steps of over-expressing the gene as claimed in claim 2 or 3 in target plants by genetic engineering methods, and screening plants with enhanced resistance to bacterial blight.

8. The method according to claim 7, characterized in that The method further comprises the step of cultivating rice varieties resistant to bacterial blight.

9. The method according to claim 7, characterized in that The method also includes the step of hybridizing the obtained plants or varieties with enhanced resistance to bacterial blight with other varieties to obtain rice varieties with expected performance.

Images