Binding proteins that specifically bind to glomerular basement membrane, methods of making and use

Abstract

The application provides a binding protein specifically binding to glomerular basement membrane, a preparation method and application, and relates to the technical field of biotechnology. The binding protein contains a heavy chain variable region and a light chain variable region, the complementarity determining region of the heavy chain variable region includes an amino acid sequence identical to VH-CDR1, VH-CDR2 and VH-CDR3 of the heavy chain variable region shown in SEQ ID NO. 1; the complementarity determining region of the light chain variable region includes an amino acid sequence identical to VL-CDR1, VL-CDR2 and VL-CDR3 of the light chain variable region shown in SEQ ID NO. 2. The binding protein has good specific binding capacity to the glomerular basement membrane antigen, and can be used for identification of anti-glomerular basement membrane antibodies or glomerular basement membrane antigens, and diagnosis and detection of anti-glomerular basement membrane antibody positive diseases and / or vasculitis.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a binding protein that specifically binds to the glomerular basement membrane, its preparation method, and its application. Background Technology

[0002] The following statements are provided only as background information in relation to the present invention and do not necessarily constitute prior art.

[0003] Antiglomerular basement membrane (GBM) antibody disease is an autoimmune vasculitis characterized by the deposition of anti-GBM antibodies in the basement membrane of the kidneys or alveoli. Typical clinical manifestations include acute renal failure with or without diffuse alveolar hemorrhage. The primary diagnostic criterion is the detection of anti-GBM antibodies in serum or tissues. This disease has a rapid onset, fast progression, poor prognosis, and high mortality rate. Most untreated patients rapidly progress to end-stage renal disease (ESRD) in the early stages of the disease, and anti-GBM antibodies are detectable in approximately one-third of patients. Therefore, anti-GBM antibody detection plays a crucial role in the diagnosis of vasculitis, particularly small vasculitis, allowing for early diagnosis and treatment and limiting its potential for infection and destruction of other organs.

[0004] Currently, most common anti-GBM antibodies in diagnostic kits are derived from human positive serum, but serum sources are difficult to obtain and there are significant batch-to-batch variations. Other methods include using hybridoma technology to produce rabbit or mouse monoclonal antibodies, or purifying polyclonal antibodies from positive serum of immunized animals and then conjugating them with human IgG. These methods are complex, time-consuming, and costly. Therefore, developing high-affinity recombinant anti-GBM monoclonal antibodies that are easy to obtain, can be mass-produced, and widely used, especially for clinical diagnostic kits, is of great significance and value.

[0005] In view of this, the present invention is hereby proposed. Summary of the Invention

[0006] The purpose of this invention is to provide a binding protein that specifically binds to the glomerular basement membrane, exhibiting good specific binding ability to glomerular basement membrane antigens. Based on the binding protein provided by this invention, another objective is to provide its applications. A further objective of this invention is to develop a binding protein with good binding activity and specific binding to the glomerular basement membrane using a simpler method, which can be used for the identification of glomerular basement membrane antigens and for diagnostic testing of diseases and / or vasculitis with positive anti-glomerular basement membrane antibodies.

[0007] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0008] Definition of noun:

[0009] Glomerular Basement Membrane (GBM) is an important component of the kidney glomerulus, and is essential for maintaining the normal filtration function of the kidney. Under an electron microscope, GBM can be divided into three layers from inside to outside, including an inner loose layer, a dense layer and an outer loose layer, and the thickness is about 240-370 nm. GBM is mainly composed of matrix and negatively charged proteoglycans, including type IV collagen, laminin and other proteoglycan substances. In this paper, "glomerular basement membrane antigen" and "GBM antigen" refer to the antigen of glomerular basement membrane that can be combined with natural anti-glomerular basement membrane antibody, which can be complete glomerular basement membrane or partial components from glomerular basement membrane. The specific binding protein provided by the present application (hereinafter also referred to as "GBM binding protein") can bind to the above-mentioned glomerular basement membrane antigen.

[0010] In this paper, the technical term "binding protein" refers to a protein that binds to a specific antigen, which generally refers to all proteins and protein fragments containing complementarity determining regions (CDR regions). The binding protein can be an antibody. The terms "antibody" and "full-length antibody" include polyclonal antibodies and monoclonal antibodies. In addition, the term "antibody" includes naturally occurring antibodies and non-naturally occurring antibodies, including, for example, chimeric, bifunctional and humanized antibodies, as well as related synthetic isoforms. Non-naturally occurring antibodies are also referred to herein as "recombinant antibodies", and the term "antibody" can be used interchangeably with "immunoglobulin".

[0011] The binding protein can also be an antigen-binding fragment containing part or all of the CDR of the antibody, which lacks at least some of the amino acids present in the full-length chain of the antibody but can still specifically bind to the antigen. Such fragments have biological activity because they bind to target antigens and can compete with other antigen-binding molecules (including intact antibodies) for binding to a given epitope. Such fragments are selected from, but not limited to, F(ab')2, Fab', Fab, Fv (consisting of VH and VL), ScFv (single-chain antibody, VH and VL are connected by a connecting peptide), dsFv (disulfide stabilized Fv fragments, dsFv), bispecific antibody, nanobody and any one of the minimum recognition units of antibodies. In addition to the above functional fragments, any fragment with increased half-life is also included.

[0012] The term "variable region" or "variable domain" refers to the amino-terminal portion of the heavy or light chain of an antibody that is involved in recognizing and binding the antigen, the sequence and arrangement of amino acids of which determines the specificity of the antibody for the antigen. The heavy chain variable domain can be referred to as "VH". The variable domain of the light chain can be referred to as "VL". The variable domains contain the antigen binding sites. The variable regions of the heavy and light chains each consist of three complementarity determining regions (CDRs) connected by four framework regions (FRs). The extent of the framework and CDR regions has been precisely defined, for example, in Kabat (see Sequences of Proteins of Immunological Interest, E. Kabat et al.) and Chothia, any CDR defining method known in the art, including combinations of methods, can identify the CDRs of a variable domain. The CDRs in each chain are held together in close proximity by the FRs and with respect to each other, the variable regions of the heavy and light chains, VL / VH, can be obtained by arranging the numbered CDRs and FRs in the following combinations: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0013] The term "constant region" or "constant domain" refers to the constant region of an antibody light chain alone or in combination, or the constant region of an antibody heavy chain. The heavy chains of an antibody have a variable domain (VH), followed by a number of constant domains or regions, such as one or more of hinge, CH1, CH2, CH3, and CH4, the CH1 domain is adjacent to the VH domain and is amino-terminal to the hinge region of the antibody heavy chain, and does not form part of the Fc region of the antibody; the hinge region includes the portion of the heavy chain molecule connecting the CH1 domain to the CH2 domain; the N-terminus of CH2 is usually the C-terminus of CH3 domain, the CH3 domain usually forms the C-terminal portion of the antibody, in some antibody classes, such as IgM and IgE, the constant region also includes a CH4 domain. The constant region of an antibody can be derived from the constant region of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, and IgD, as well as their subclasses and mutated forms.

[0014] The present application does not limit the manner in which the GBM binding proteins are obtained. In some alternative embodiments, the binding proteins are obtained by expressing the polynucleotides encoding the binding proteins in cells after the polynucleotides are ligated to vectors. The vectors can be introduced into eukaryotic cells, particularly mammalian cells, to construct cells that express the binding proteins. In other alternative embodiments, the binding proteins can also be obtained by recombinant genetic techniques known to those skilled in the art or by peptide synthesis, such as automated peptide synthesizers (e.g., automated peptide synthesizers sold by Applied Biosystems, etc.); antigen binding fragments can also be produced by enzymatic cleavage of antigen binding molecules (including whole antibodies), such as pepsin or papain cleavage; or by chemical cleavage, such as methods that chemically reduce disulfide bonds to obtain the antigen binding fragments described above.

[0015] The terms "specifically recognizes," "selectively binds," "selectively binds," and "specifically binds" or similar terms mean the binding of a binding protein to an epitope on a predetermined antigen. Typically, a binding protein binds to an epitope with a K -5 M, such as a K -5 M, 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M, or 10 -10 M or less. D The K D values of antibodies can be determined using methods well established in the art. Other standard assays for evaluating the binding ability of a ligand, such as an antibody, to a target are known in the art, including, for example, ELISA, Western blot, RIA, and flow cytometry analysis.

[0016] The term "signal agent" as used herein refers to a substance that is capable of providing a detectable signal that can be observed directly by the naked eye or detected by conventional instruments accepted in the art; the signal agent can provide the signal directly, such as color (e.g., colloidal gold, colored microspheres), fluorescence (fluorescent molecules), magnetism, radiation, or luminescence; or indirectly, such as through a reaction in which the signal agent is involved subsequently, such as catalyzing the reaction of a specific substrate to produce any of the above signals.

[0017] The term "polynucleotide" herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-, double- or multi- stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. A polynucleotide can encode the above-mentioned binding proteins, optionally encoding a sense or an antisense strand. A polynucleotide can be naturally occurring, synthetic, recombinant, or any combination thereof. The terms "polynucleotide" and "nucleic acid" are used interchangeably herein.

[0018] The term "vector" herein refers to a nucleic acid vehicle into which a polynucleotide can be inserted. When the vector is capable of directing the expression of a polynucleotide inserted into it, the vector is referred to as an expression vector. A vector can be introduced into a cell by transformation, transduction or transfection, so that the cells carry and express the genetic material elements carried by the vector.

[0019] The vectors are well known to those skilled in the art, and include but are not limited to: plasmids, episomal plasmids, minicircles, phagemids, cosmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or P1 -derived artificial chromosomes (PAC); bacteriophages such as lambda phage or M13 phage, and animal viruses, etc. Animal viruses that can be used as vectors include but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex viruses), poxviruses, baculoviruses, papillomaviruses, papova viruses. In some embodiments, the vectors of the present application comprise regulatory elements commonly used in genetic engineering, such as enhancers, promoters, internal ribosome entry sites (IRES) and other expression control elements (such as transcription termination signals, or polyadenylation signals and polyU sequences, etc.).

[0020] As used herein, the expressions "cell," "cell line," and "cell culture" are used interchangeably and all such designations include progeny. The progeny can not necessarily be completely identical to the original parent cell, due to natural, accidental, or deliberate mutation, differences in the genomic DNA can exist, in morphology, and / or in phenotype. "Transformant" and "transformed cell" include the original subject cell and cultures derived from it. Cells can be prokaryotic cells or eukaryotic cells, prokaryotic cells such as, but not limited to, E. coli, Bacillus sp., or Staphylococcus sp. Eukaryotic cells include, but are not limited to, mammalian cells, insect cell lines, plant cells, and fungal cells. Mammalian host cells include human, mouse, rat, canine, monkey, porcine, caprine, bovine, equine, and hamster cells, including but not limited to Chinese hamster ovary (CHO) cells, NSO, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), A549 cells, 3T3 cells, and HEK-293 cells.

[0021] As used herein, the terms "purified" or "isolated" in relation to a polypeptide or nucleic acid means that the polypeptide or nucleic acid is not in its natural milieu or in its natural form. Thus, the term "isolated" includes a polypeptide or nucleic acid removed from its original environment, e.g., if it is naturally occurring, from the natural environment. For example, an isolated polypeptide is typically free of at least some of the proteins or other cellular material with which it is ordinarily associated or mixed in vivo. An isolated polypeptide includes a naturally produced polypeptide contained in cell lysates, purified or partially purified forms of the polypeptide, recombinant polypeptides, the polypeptide expressed or secreted by a cell, and the polypeptide in a heterologous cell or culture. In relation to nucleic acids, the terms isolated or purified indicate, for example, that the nucleic acid is not in its natural genomic context (e.g., in a vector, as an expression cassette, linked to a promoter, or artificially introduced into a heterologous cell).

[0022] As used herein, "anti-glomerular basement membrane antibody-positive disease" refers to a disease capable of causing a patient's anti-glomerular basement membrane antibody level to be higher than when the patient does not have the disease. Exemplary anti-glomerular basement membrane antibody-positive diseases include, but are not limited to, anti-GBM disease in small vessel vasculitis (also known as Goodpasture's syndrome, anti-basement membrane glomerulonephritis, Goodpasture's disease, or pulmonary hemorrhage-nephritis syndrome).

[0023] As used herein, unless otherwise indicated, any number is used to distinguish one entity or action from another, and does not necessarily require or imply any actual such relationship, order, or degree of importance between the entities or actions, e.g., numbers (I), (II), (III), (IV), (V), (VI), and (VII).

[0024] As used herein, "optionally," "optional," "may" or "may" means that the subsequently described event or circumstance can or can not occur, and the description includes instances where the event or circumstance occurs and instances where it does not.

[0025] As used herein, the term "comprising" or "including" means including the recited elements, integers or steps, but not excluding any other elements, integers or steps.

[0026] In a first aspect, a GBM binding protein is provided, which comprises a heavy chain variable region and a light chain variable region.

[0027] The heavy chain variable region comprises complementarity determining regions VH-CDR1, VH-CDR2 and VH-CDR3; and the light chain variable region comprises complementarity determining regions VL-CDR1, VL-CDR2 and VL-CDR3.

[0028] The VH-CDR1 comprises an amino acid sequence identical to VH-CDR1 of the heavy chain variable region shown in SEQ ID NO. 1, the VH-CDR2 comprises an amino acid sequence identical to VH-CDR2 of the heavy chain variable region shown in SEQ ID NO. 1, the VH-CDR3 comprises an amino acid sequence identical to VH-CDR3 of the heavy chain variable region shown in SEQ ID NO. 1, the VL-CDR1 comprises an amino acid sequence identical to VL-CDR1 of the light chain variable region shown in SEQ ID NO. 2, the VL-CDR2 comprises an amino acid sequence identical to VL-CDR2 of the light chain variable region shown in SEQ ID NO. 2, and the VL-CDR3 comprises an amino acid sequence identical to VL-CDR3 of the light chain variable region shown in SEQ ID NO. 2.

[0029] It can be understood that the amino acid sequence of other regions in the variable region shown in SEQ ID NO. 1 or 2, except for the CDR region, is not used to limit the GBM binding protein provided by the present application, for example, the GBM binding protein provided by the present application can contain a framework region which can be different from the framework region in the variable region shown in SEQ ID NO. 1 or 2. The CDR region in the variable region shown in SEQ ID NO. 1 or 2 can be divided according to the optional manner known in the art. Alternatively, VH-CDR1, VH-CDR2, VH-CDR3, VL-CDR1, VL-CDR2 and VL-CDR3 of the variable region are defined by any one of Kabat, Chothia, IMGT, ABM or Contact definition system or a combination of multiple definition systems. Taking Kabat, Chothia, IMGT, ABM or Contact definition as an example, the amino acid sequence of CDR is shown in Table 1:

[0030] Table 1 Heavy chain CDRs of the VH as shown in SEQ ID NO. 1

[0031]

[0032] Table 2 Light chain CDRs of the VL as shown in SEQ ID NO. 2

[0033]

[0034] In an alternative embodiment, the GBM binding protein has a VH-CDR1, a VH-CDR2 and a VH-CDR3 of the heavy chain variable region as defined in Table 1, and has a VL-CDR1, a VL-CDR2 and a VL-CDR3 of the light chain variable region as defined in Table 2. In the IMGT definition, for example: the amino acid sequence of the VH-CDR1 is as shown in SEQ ID NO. 11, the amino acid sequence of the VH-CDR2 is as shown in SEQ ID NO. 16, the amino acid sequence of the VH-CDR3 is as shown in SEQ ID NO. 19; the amino acid sequence of the VL-CDR1 is as shown in SEQ ID NO. 22, the amino acid sequence of the VL-CDR2 is RVS, and the amino acid sequence of the VL-CDR3 is as shown in SEQ ID NO. 25.

[0035] In an alternative embodiment, the remaining part of the sequence of the CDR region, except for the CDR region, is derived from one or more of the following species: rabbit, bovine, equine, bovine, porcine, ovine, caprine, rat, mouse, dog, cat, camel, donkey, deer, mink, chicken, duck, goose, turkey, cock, human and mutants thereof.

[0036] In an alternative embodiment, the heavy chain variable region further comprises at least one framework region, for example one framework region, two framework regions, three framework regions or four framework regions.

[0037] In an alternative embodiment, the light chain variable region further comprises at least one framework region, for example one framework region, two framework regions, three framework regions or four framework regions.

[0038] In an alternative embodiment, the framework region VH-FR1 of the heavy chain variable region comprises an amino acid sequence identical to the VH-FR1 of the heavy chain variable region as shown in SEQ ID NO. 1; and / or, the framework region VH-FR2 comprises an amino acid sequence identical to the VH-FR2 of the heavy chain variable region as shown in SEQ ID NO. 1; and / or, the framework region VH-FR3 comprises an amino acid sequence identical to the VH-FR3 of the heavy chain variable region as shown in SEQ ID NO. 1; and / or, the framework region VH-FR4 comprises an amino acid sequence identical to the VH-FR4 of the heavy chain variable region as shown in SEQ ID NO. 1. In an alternative embodiment, the framework region VL-FR1 of the light chain variable region comprises an amino acid sequence identical to the VL-FR1 of the light chain variable region as shown in SEQ ID NO. 2; and / or, the framework region VL-FR2 comprises an amino acid sequence identical to the VL-FR2 of the light chain variable region as shown in SEQ ID NO. 2; and / or, the framework region VL-FR3 comprises an amino acid sequence identical to the VL-FR3 of the light chain variable region as shown in SEQ ID NO. 2; and / or, the framework region VL-FR4 comprises an amino acid sequence identical to the VL-FR4 of the light chain variable region as shown in SEQ ID NO. 2.

[0039] In an alternative embodiment, the framework region VL-FR1 of the light chain variable region comprises an amino acid sequence identical to VL-FR1 of the light chain variable region as set forth in SEQ ID NO. 2; and / or, the framework region VL-FR2 comprises an amino acid sequence identical to VL-FR2 of the light chain variable region as set forth in SEQ ID NO. 2; and / or, the framework region VL-FR3 comprises an amino acid sequence identical to VL-FR3 of the light chain variable region as set forth in SEQ ID NO. 2; and / or, the framework region VL-FR4 comprises an amino acid sequence identical to VL-FR4 of the light chain variable region as set forth in SEQ ID NO. 2.

[0040] In an alternative embodiment, the amino acid sequence of the heavy chain variable region of the GBM binding protein is as set forth in SEQ ID NO. 1 and the amino acid sequence of the light chain variable region is as set forth in SEQ ID NO. 2.

[0041] In an alternative embodiment, the GBM binding protein is an antibody or an antigen binding fragment comprising a constant region.

[0042] In an alternative embodiment, at least a portion of the constant region sequence of the GBM binding protein is a human constant region sequence.

[0043] In an alternative embodiment, the constant region sequence of the GBM binding protein is selected from a portion or the entire constant region sequence of any one of IgGl, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD, including their subclasses and mutant forms.

[0044] In an alternative embodiment, the GBM binding protein comprises a heavy chain constant region.

[0045] In an alternative embodiment, the heavy chain constant region sequence of the GBM binding protein is selected from a portion or the entire constant region sequence of human IgGl, preferably comprising CHI, CH2 and CH3 of the constant region of human IgGl.

[0046] In an alternative embodiment, the amino acid sequence of the heavy chain constant region is as set forth in SEQ ID NO. 3.

[0047] In an alternative embodiment, the GBM binding protein comprises a light chain constant region.

[0048] In an alternative embodiment, the light chain constant region sequence is selected from a light chain constant region of a mouse.

[0049] In an alternative embodiment, the amino acid sequence of the light chain constant region is as set forth in SEQ ID NO. 4.

[0050] In an alternative embodiment, the GBM binding protein is a human-mouse chimeric antibody, the amino acid sequence of the heavy chain of the GBM binding protein is shown in SEQ ID NO. 5, and the amino acid sequence of the light chain is shown in SEQ ID NO. 6.

[0051] In a second aspect, a biological material is also provided, comprising a polynucleotide, a vector, or a cell; wherein the polynucleotide encodes the GBM binding protein described above; the vector carries the polynucleotide; and the cell carries the polynucleotide, or contains the vector, or is capable of expressing the GBM binding protein.

[0052] After the polynucleotide encoding the GBM binding protein is connected to the vector, the above-mentioned vector can be introduced into a eukaryotic cell, especially a mammalian cell, to construct a cell line capable of expressing the GBM binding protein, and the corresponding protein can be obtained by cell expression.

[0053] In an alternative embodiment, the cell used for expressing the GBM binding protein is a 293 cell (human kidney epithelial cell line), preferably a 293F cell.

[0054] In an alternative embodiment, the cell used for expressing the GBM binding protein is a CHO cell (Chinese hamster ovary cell).

[0055] In a third aspect, a method for preparing the GBM binding protein of the first aspect is also provided, comprising culturing a cell capable of expressing the GBM binding protein.

[0056] In an alternative embodiment, the method further comprises transforming a polynucleotide encoding the GBM binding protein into a cell and expressing it, and obtaining the GBM binding protein by purification.

[0057] In an alternative embodiment, the method further comprises synthesizing a polynucleotide containing a gene encoding the GBM binding protein as needed, and / or preparing a suitable expression vector as needed, transforming the expression vector into a desired cell and expressing it, and obtaining the GBM binding protein by purification.

[0058] In an alternative embodiment, the cell is prepared by transforming a polynucleotide encoding the GBM binding protein as described in the first aspect into a cell, the polynucleotide comprises a heavy chain expression plasmid and a light chain expression plasmid, and the transformation comprises co-transforming the heavy chain expression plasmid and the light chain expression plasmid into the cell.

[0059] In an alternative embodiment, a complete heavy chain expression plasmid is constructed by fusing a constant region fragment to the C-terminal of the heavy chain variable region.

[0060] In optional embodiments, the constant region fragment comprises one or more of CH1, CH2 and CH3, preferably comprises CH1, CH2 and CH3.

[0061] In optional embodiments, the cell is a eukaryotic cell, preferably a mammalian cell.

[0062] In optional embodiments, the mammalian cell comprises a 293 cell or a CHO cell, preferably a 293F cell.

[0063] In a fourth aspect, there is also provided use of the GBM binding protein of the first aspect, or the biological material of the second aspect, in any one of (I) to (VIII) below:

[0064] (I) detecting anti-glomerular basement membrane antibodies for non-diagnostic and therapeutic purposes;

[0065] (II) preparing a product for detecting anti-glomerular basement membrane antibodies;

[0066] (III) preparing a product for diagnosing and / or aiding the diagnosis of an anti- glomerular basement membrane antibody positive disease;

[0067] (IV) preparing a product for diagnosing and / or aiding the diagnosis of vasculitis;

[0068] (V) detecting glomerular basement membrane antigens for non-diagnostic and therapeutic purposes;

[0069] (VI) preparing a product for detecting glomerular basement membrane antigens;

[0070] (VII) for isolating, enriching and / or purifying glomerular basement membrane antigens;

[0071] (VIII) preparing a product for isolating, enriching and / or purifying glomerular basement membrane antigens.

[0072] For the use of the above (I) to (IV) aspects, the GBM binding protein can be used as a standard and / or quality control for detection, to provide a reliable reference for the detection result, and can also be used to construct a standard curve.

[0073] In optional embodiments, the anti-GBM antibody positive disease and vasculitis each independently comprises, but is not limited to, anti-glomerular basement membrane (anti-GBM) disease in small vessel vasculitis (also known as Goodpasture syndrome, anti-basement membrane glomerulonephritis, pulmonary hemorrhage-nephritis syndrome or Goodpasture disease).

[0074] In an alternative embodiment, the vasculitis comprises anti-neutrophil cytoplasmic antibody-associated vasculitis, and the GBM-binding protein can be used for the auxiliary diagnosis of anti-neutrophil cytoplasmic antibody-associated vasculitis (AAV) to distinguish whether the subject has anti-GBM disease or anti-neutrophil cytoplasmic antibody-associated vasculitis, because the clinical symptoms of anti-GBM disease are extremely similar to the auxiliary diagnosis of anti-neutrophil cytoplasmic antibody-associated vasculitis (AAV).

[0075] The application of the above (V)-(VIII) aspects can utilize the ability of the GBM-binding protein to specifically target and bind to the GBM antigen to achieve detection, isolation, enrichment and / or purification of the GBM antigen. In an alternative embodiment, when the GBM-binding protein is an immunoconjugate, for example, linked to a signal substance, the localization or real-time detection of the GBM antigen can be achieved by detecting the signal substance. In an alternative embodiment, the detection, isolation, enrichment and / or purification of the GBM antigen is achieved by isolating the anti-GBM antibody-GBM antigen immune complex.

[0076] In an alternative embodiment of the above (II), (III), (IV), (VI) or (VIII) aspects, the skilled person can prepare the corresponding product (such as the above-mentioned immunoconjugate) according to the actual use, and select other reagents in the product composition, including but not limited to one or more of the following: a signal substance, a solid support, a buffer reagent, a salt, a secondary antibody, a chromogenic substrate, a blocking solution, a washing solution, a solvent, an eluent, a coupling agent, a negative control, a positive control, a standard, a quality control and a label.

[0077] In a fifth aspect, a reagent or kit is also provided, which comprises the GBM-binding protein of the first aspect, or the biological material of the second aspect.

[0078] In an alternative embodiment, the kit is used for detecting anti-GBM antibodies, or for diagnosing and / or aiding in the diagnosis of anti-GBM antibody-positive diseases or anti-neutrophil cytoplasmic antibody-associated vasculitis; the kit comprises a standard and / or a quality control, and the standard and / or the quality control contains the GBM-binding protein.

[0079] In an alternative embodiment, the kit is used for diagnosing and / or aiding in the diagnosis of anti-GBM disease.

[0080] In an alternative embodiment, the kit further comprises a detection reagent, and the detection reagent comprises an anti-GBM antibody detection reagent.

[0081] In an alternative embodiment, the kit is used for diagnosing and / or aiding in the diagnosis of anti-neutrophil cytoplasmic antibody-associated vasculitis, and the kit further comprises detection reagents for anti-myeloperoxidase antibodies and / or anti-proteinase 3 antibodies.

[0082] In an alternative embodiment, the kit further comprises a solid support.

[0083] In an alternative embodiment, the GBM-binding protein in the reagent or kit is coupled to a solid support; or the GBM-binding protein in the reagent or kit is packaged separately from the solid support. By coupling the GBM-binding protein to a solid support, the GBM-binding protein can be used to capture GBM antigens in a sample to be tested. Alternatively, by coupling the GBM-binding protein to a solid support, the GBM-binding protein can be used to purify GBM antigens.

[0084] In an alternative embodiment, the anti-GBM antibody detection reagent comprises a solid support coupled to a GBM antigen.

[0085] In an alternative embodiment, the kit further comprises a signal agent.

[0086] In an alternative embodiment, the GBM-binding protein in the reagent or kit is coupled to a signal agent; or the GBM-binding protein in the reagent or kit is packaged separately from the signal agent. By coupling the GBM-binding protein to a signal agent, the GBM-binding protein can be used to localize detection of GBM antigens or to detect GBM antigens in a sample by Western blotting.

[0087] The reagent or kit described above optionally further comprises one or more of the following reagents and / or consumables that are well known to those skilled in the art for use in detecting reactions or purifying proteins, including but not limited to, buffer reagents, salts, secondary antibodies, chromogenic substrates, blocking solutions, washing solutions, solvents, eluents, coupling agents, negative controls, positive controls, standards, quality controls, and labels.

[0088] The reagent or kit described above can be used in any of the generally accepted immunodetection methods in the art, including but not limited to immunofluorescence staining, flow sorting, immunoblotting, immunohistochemistry, ELISA, immunochromatography, or immunomagnetic beads. Those skilled in the art can formulate other reagents in the reagent or kit according to the corresponding detection method, which is not limited by the present application.

[0089] The signal agent in any of the embodiments described above includes but is not limited to one or more of the following: enzymes, luminescent labels, fluorescent microspheres, colored microspheres, latex microspheres, colloidal gold, quantum dots, biotin, streptavidin, radionuclides, radiocontrast agents, paramagnetic ions, metals, and photosensitizers.

[0090] Examples of enzymes can be, but are not limited to, alkaline phosphatase or horseradish peroxidase, luminescent labels can be, but are not limited to, fluorescent proteins, synthetic small molecules or polymeric dyes, etc., specific examples include, but are not limited to, one or more of Alexa 350, Alexa 405, Alexa 430, Alexa 488, Alexa 555, Alexa 647, AMCA, Aminocoumarin, BODIPY 630 / 650, BODIPY 650 / 665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, 5-Carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein, 5-Carboxy-2',4',5',7'-tetrachlorofluorescein, 5-Carboxyfluorescein, 5-Carboxyrhodamine, 6-Carboxyrhodamine, 6-Carboxytetramethylrhodamine, Cascade Blue, Cy2, Cy3, Cy5, Cy7, 6-FAM, Dansyl chloride, Fluorescein, HEX, 6-JOE, NBD (7-Nitrobenzo-2-oxa-l,3-diazole), Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, Phthalic acid, Terephthalic acid, Isophthalic acid, Cresyl Fast Violet, Cresyl Blue Violet, Brilliant Cresyl Blue, p-Aminobenzoic acid, Erythrosin, Phthalocyanine, Azomethine, Cyanine, Xanthine, Succinylfluorescein, Rare earth cryptate, Europium trisbipyridine diamine, Europium cryptate or chelate, Diamine, Bis-allophycocyanin, La Jolla Blue dye, Allophycocyanin B, Allophycocyanin C, Allophycocyanin R, Thiamine, Phycoerythrin, Phycoerythrin R, REG, Rhodamine Green, Rhodamine isothiocyanate, Rhodamine Red, ROX, TAMRA, TET, TRIT (tetramethylrhodamine isothiol), Tetramethylrhodamine, and Texas Red. Fluorescent microspheres, colored microspheres, and latex microspheres are independently selected from the art-acceptable products, for example, from commercially available products. Radionuclides include, but are not limited to 110 In、 111 In、 177 Lu、 18 F、 52 Fe、 62 Cu、 64 Cu、 67 Cu、 67 Ga、 68 Ga、 86 Y、 90 Y、 89 Zr、 94 mTc、 94 Tc、 99 mTc、 120 I、123 I, 124 I, 125 I, 131 I, 154-158 Gd, 32 P, 11 C 13 N、 15 O、 186 Re、 188 Re、 51 Mn, 52 mMn, 55 Co、 72 As、 75 Br、 76 Br、 82 mRb and 83 One or more of Sr. Paramagnetic ions include, but are not limited to, one or more of chromium (III), manganese (II), iron (III), cobalt (II), nickel (II), copper (II), neodymium (III), samarium (III), ytterbium (III), gadolinium (III), vanadium (II), terbium (III), dysprosium (III), holmium (III) and erbium (III).

[0091] The solid-phase support in any of the above embodiments includes, but is not limited to, microtubes, columns, microparticles, nitrocellulose membranes, chromatography matrices, or side-flow devices; more specifically, it can be, but is not limited to, enzyme-labeled wells, immunochromatographic test strips, or magnetic beads. The chromatography matrix can be any known chromatography matrix acceptable in the art, including but not limited to polystyrene, polysaccharide polymers, or silica gel. In optional embodiments, the chromatography matrix includes gel particles.

[0092] This invention discloses a GBM-binding protein, which is further used to prepare a human-mouse chimeric recombinant monoclonal antibody. This invention has the following beneficial effects:

[0093] (1) This invention provides a sequence-known GBM binding protein and its preparation method, which can be recombinantly expressed in vitro. The operation is simple, time-consuming, and the production process is controllable with small batch-to-batch differences, showing good application prospects.

[0094] (2) The binding protein provided by this invention has good affinity, with an affinity constant of up to 5.01E-10, and can specifically bind to glomerular basement membrane antigens. It can be used for the detection of glomerular basement membrane or its components, including but not limited to the use of liquid chromatography-array, immunofluorescence staining, flow cytometry, fluorescent microspheres and other techniques to identify glomerular basement membrane antigens; the binding protein can also be coupled with a chromatographic matrix for immunoaffinity chromatography purification of glomerular basement membrane antigens to improve antigen purity.

[0095] (3) The binding protein can be used as an antibody in anti-glomerular basement membrane antibody detection, diagnosis / aid diagnosis product of anti-glomerular basement membrane antibody positive disease or vasculitis related disease (such as anti-GBM disease in small vessel vasculitis), for example, as a quality control and / or standard product of anti-glomerular basement membrane antibody detection product; the binding protein as a quality control in a test kit can alleviate the cumbersome operation of immune polyclonal antibody, and the low efficiency of subsequent coupling; it can reduce production cost, stabilize product quality, and significantly improve the reaction value; on the other hand, compared with direct use of human serum, it can also avoid the problems of difficult sample source and high cost. BRIEF DESCRIPTION OF DRAWINGS

[0096] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the drawings needed in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.

[0097] Figure 1 Nucleic acid electrophoretogram of heavy chain (Fd) and light chain (VL) used for constructing library in Example 1;

[0098] Figure 2 Nucleic acid electrophoretogram of Fab gene fragment used for constructing library in Example 1;

[0099] Figure 3 SDS-PAGE protein electrophoretogram of four anti-GBM recombinant antibodies in Example 2. GBM-Ab-non-reduced represents non-reduced SDS-PAGE electrophoretogram result, the size is about 150 kDa, GBM-Ab-reduced represents reduced SDS-PAGE electrophoretogram result, the heavy chain and the light chain are 50 kDa, 25 kDa respectively, GBM-Ab-1 represents No. 1 recombinant antibody, GBM-Ab-2 represents No. 2 recombinant antibody, GBM-Ab-3 represents No. 3 recombinant antibody, and GBM-Ab-4 represents No. 4 recombinant antibody;

[0100] Figure 4 Linear graph of No. 1 recombinant antibody in Example 4;

[0101] Figure 5 SPR method for determining the affinity of one recombinant antibody and GBM protein in Example 5. DETAILED DESCRIPTION

[0102] The technical solutions of the present application will be clearly and completely described below in connection with the embodiments. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0103] In all the following examples, the GBM antigen was purchased from Wuhan Bobaiou Biological Technology Co., Ltd., with the number PB-GBM.

[0104] Example 1 Screening of GBM binding protein

[0105] (I) Preparation of phage display library

[0106] 1) The spleen of the mouse immunized with GBM antigen was taken, and the lymphocytes were separated using mouse lymphocyte separation medium.

[0107] 2) Extraction of RNA: total RNA of the lymphocytes was extracted.

[0108] 3) Reverse transcription: reverse transcription was performed on the extracted total RNA to synthesize cDNA.

[0109] 4) Amplification of antibody gene fragments: using cDNA as a template, the VHand CH1(Fd) regions of the κ and λ light chains and the heavy chain of the antibody were amplified by specific primers.

[0110] 20μL reaction system: 1μL cDNA, 0.8μL Prime F, 0.8μL Prime R, 10μL 2×phantamax master mix, 7.4μL Nuclease-Free Water; reaction program: 95℃ for 30s, 55℃ for 30s, 72℃ for 45s, 30 cycles.

[0111] After the reaction, loading buffer was added to the system, and 1% agarose gel electrophoresis was used for identification. The electrophoresis map is shown in Figure 1 .

[0112] The target bands were cut off, and the antibody heavy chain (Fd, about 750bp) gene fragment and the light chain gene fragment (VL, about 350bp) were recovered, respectively.

[0113] 5) The antibody light chain and heavy chain gene fragments were combined into complete Fab gene fragments by overlapping PCR.

[0114] 25 μL reaction system and procedure: 30 ng of light chain, 4.3 ng of CL+linker, 30 ng of heavy chain, 0.5 μL of sfi I F (upstream primer), 0.5 μL of sfi I R (downstream primer), 12.5 μL of 2x phantamax master mix, Nuclease-Free Water to a total system of 25 μL.

[0115] Reaction procedure: 95 °C for 30 s, annealing 55 °C for 30 s, extension 72 °C for 90 s, 30 cycles.

[0116] After the reaction, loading buffer was added to the system, and 1% agarose gel electrophoresis was used for identification. The electrophoresis map is shown in Figure 2 The target band of about 1500 bp was cut off, and the antibody Fab fragment was recovered.

[0117] Upstream primer sfi I F: 5'>GAGCAGGAGCATAGGAGGATCGGGCGGCGGCC<3' (SEQ ID NO. 27);

[0118] Downstream primer sfi I R: 5'>CCATGGCAATGGTGATTCTGCTGCGCGGCCTGGCC<3' (SEQ ID NO. 28).

[0119] 6) Plasmid construction: The antibody Fab fragment and pComb3xSS plasmid were respectively digested with sfi I enzyme, and were mixed according to a molar ratio of 3:1 of the digested fragments to the plasmid, T4 DNA ligase was added, and the connection was carried out at 16 °C overnight.

[0120] 7) Library construction: The connection product in the previous step was recovered. 1.5 μL of the recovered product was taken, TG1 competent cells were added, mixed, and then transferred to an electrotransformation cup for electrotransformation. The parameter selection was: Bac-Ec1. After electrotransformation, the bacteria were cultured at 37 °C for 1 h, and then transferred to 200 mL of 2xYT medium, 1 / 1000 of ampicillin antibiotic and a final concentration of 2% glucose solution were added, and the culture was carried out at 37 °C, 220 rpm until OD600=0.6. 20 times the number of helper phage M13K07 was added. After mixing, it was placed in a 37 °C shaking bed for stationary infection for 45 min. The bacteria were centrifuged for 15 min, resuspended in 200 mL of new 2xYT+Amp+Kana medium, and the bacteria were shaken at 30 °C, 220 rpm for 14 h for phage amplification. The next day, the supernatant was centrifuged, 1 / 4 volume of 20% PEG6000 was added to precipitate the phage, and PBS was used for resuspension to obtain the phage display library.

[0121] (II) Using phage display library to screen anti-GBM antibodies

[0122] 1) Biotin-coupled GBM protein as target antigen, 1x10 12

[0123] 2) Magnetic beads binding to antigen were added to TG1 bacteria solution, and incubated at 37°C for 45 min. Then, the bacteria solution was activated at 37°C and 220 rpm for 1 h. The bacteria solution after incubation was gradiently diluted and spread on ampicillin plates. The rest of the bacteria solution was added with glucose (final concentration 2%) and 1 / 1000 ampicillin, and the bacteria were cultured at 37°C and 220 rpm for 3 h.

[0124] 3) 10 μL L13K07 was added to the bacteria solution, and incubated at 37°C for 45 min.

[0125] 4) The bacteria solution was centrifuged at 6000xg for 10 min, resuspended with 10 mL 2xYT+Amp+kana medium, and cultured at 30°C and 220 rpm for 14 h to amplify the phages. The supernatant was collected by centrifugation the next day, and 1 / 4 volume of 20% PEG6000 was added to precipitate the phages. The phages were resuspended with PBS to obtain the phages of the first round of screening.

[0126] 5) The phages obtained in the first round of screening were used to repeat steps 1-4 for the second round of screening.

[0127] 6) Monoclonal identification: single clones were selected from the second round of screening and spread on 96-well deep plates, and the phages were amplified by overnight shaking culture.

[0128] Plate coating: GBM antigen was coated on ELISA plates, and BSA was used as a control protein for plate coating, and the plates were incubated at 4°C overnight.

[0129] Blocking: the coating solution was discarded the next day, the plates were washed with PBST, dried, and 3% milk was added for blocking at 37°C for 2 h.

[0130] Primary antibody preparation: the 96-well deep plates were centrifuged, and the supernatant was diluted in 1% milk to a final concentration, and mixed to serve as the primary antibody.

[0131] Primary antibody incubation: the blocking solution was discarded, the plates were washed with PBST, dried, and the primary antibody was added, and incubated at 37°C for 2 h.

[0132] Secondary antibody incubation: the primary antibody was discarded, the plates were washed with PBST, dried, and 1:5000 diluted Anti-M13 Antibody (HRP) secondary antibody was added, and incubated at 37°C for 1 h. The secondary antibody was discarded, the plates were washed with PBST, dried, and color developing substrate was added for color development. After 15 min, stop solution was added to stop the reaction, and the results were read on an enzyme label instrument. ​

[0133] 7) Selected clones with high read value (GBM antigen well OD value >1) and low non-specific binding (BSA control protein well OD value <0.5) for sequencing.

[0134] Light chain sequencing primer: Bomp: 5'>GTGTGGAATTGTGAGCGG<3' (SEQ ID NO. 29);

[0135] Heavy chain sequencing primer: PELB: 5'>ACCTATTGCCTACGGCAGCCG<3' (SEQ ID NO. 30).

[0136] A total of 20 single clones were selected for sequencing, and a total of 4 different GBM binding protein sequences including antigen binding domains were analyzed by sequencing results.

[0137] Example 2: Expression and purification of anti-GBM recombinant monoclonal antibody

[0138] After obtaining the candidate antibody Fab region sequence by sequencing, gene synthesis was performed:

[0139] The vector PTT5 plasmid was selected, and EcoRI + BamHI was used as the cloning site to insert the light chain gene fragment. The light chain constant region sequence is shown in SEQ ID NO. 4, which is a murine sequence.

[0140] The CH1 of the heavy chain was replaced with the CH1 of human IgG1, and the C-terminal was fused with the Fc of human IgG1. The complete heavy chain fragment was constructed by inserting the PTT5 plasmid with EcoRI + BamHI as the cloning site. The heavy chain constant region sequence is shown in SEQ ID NO. 3, which is a human sequence.

[0141] Mammalian cell 293F expression system was used for expression.

[0142] 1) Plasmid extraction: The gene-synthesized plasmids were transformed into TOP10 competent cells, and after 1 h of activation, they were transferred to LB medium for overnight culture at 37°C. The next day, the endotoxin-free plasmid extraction kit was used for extraction, and the corresponding heavy chain plasmid and light chain plasmid were obtained.

[0143] 2) One day before transfection, 293F cells were inoculated in suspension cell culture bottles, and the cell density was controlled at 1 x 10 6 6 / mL.

[0144] 3) The next day, 40 μg of heavy chain plasmid and 80 μg of light chain plasmid were diluted in 6 mL of transfection buffer and gently mixed, 480 μL of PEI was added and gently mixed, and incubated at room temperature for 20 minutes. Dropwise addition to the cells, and the cells were placed in an incubator at 98 rpm, 37°C, 5% CO2 suspension culture.

[0145] 4) After 6 days, the culture supernatant was collected, and IgG was purified by rProtein A column, eluted with 0.1 M Glycine (pH 3.0), and neutralized by adding 1 M Tris (pH 8.0). After elution, the ultrafiltration centrifuge tube was replaced with PBS buffer and concentrated, and the protein concentration was determined, and further concentrated to 1 mg / mL.

[0146] The purity was verified by SDS-PAGE, and the SDS-PAGE was as shown in Figure 3

[0147] Example 3: Determination of the binding activity of the recombinant monoclonal antibody to GBM antigen by chemiluminescence method

[0148] The detection performance of the four recombinant monoclonal antibodies was further tested, and the method was as follows:

[0149] 1) The four recombinant antibodies were diluted by 20, 100, 200, 500, and 1000 times, respectively, and detected (repeated 3 times).

[0150] 2) The concentration value under the mean of each point was calculated and evaluated.

[0151] 3) The average value of the detection concentration and the theoretical concentration were fitted by the least square method to obtain the linear regression equation, and the linearity was investigated.

[0152] The detection results are shown in Table 3.

[0153] Table 3: Binding activity of antibodies 1-4 to GBM antigen

[0154]

[0155] * The concentration value unit is LU / mL Figure 4 as shown in Table 4 and

[0156] Table 4: Linearity of antibody 1

[0157]

[0158]

[0159] According to the results, the titer and linearity of antibody 1 were qualified.

[0160] According to the sequencing results, the sequence of the heavy chain variable region of antibody 1 is shown as SEQ ID NO. 1, and the sequence of the light chain variable region is shown as SEQ ID NO. 2. Further analysis showed that the antigen binding domain comprises the following light chain and heavy chain CDRs, and the complete sequence of the light chain of the corresponding recombinant monoclonal antibody is shown as SEQ ID NO. 6, and the complete sequence of the heavy chain is shown as SEQ ID NO. 5.

[0161] ​Table 1 Heavy chain CDRs of VH as shown in SEQ ID NO. 1

[0162]

[0163] Table 2 Light chain CDRs of VL as shown in SEQ ID NO. 2

[0164]

[0165] Example 4 SPR method for determining the affinity of No. 1 recombinant monoclonal antibody to GBM antigen

[0166] Further determine the affinity of No. 1 recombinant antibody screened to GBM protein:

[0167] 1) Preparation of ligand: dilute the antibody to 10 μg / mL with sample diluent.

[0168] 2) Preparation of analyte: dilute the GBM antigen to 32 μg / mL with sample diluent.

[0169] 3) Chip cleaning: wash the chip with 150 μl / well of regeneration solution, sample diluent, and ultrapure water for 2 times, and dry.

[0170] 4) Ligand immobilization: set the ligand immobilization parameters, and according to the prompt, run the baseline with 50 μL / well of sample diluent, and after the baseline is run, take out the chip plate in the instrument and dry, add 50 μL / well of prepared ligand solution to the chip plate, and perform ligand immobilization.

[0171] 5) Affinity determination: immediately take out the chip after the ligand immobilization is completed, pour off the ligand solution, and dry. Set the affinity detection parameters, and according to the prompt, add 50 μL / well of prepared analyte for binding and dissociation operations.

[0172] 6) Data processing: set the calculation parameters, and calculate the antigen-antibody affinity. For example, Figure 5 , the affinity constant of No. 1 recombinant antibody to GBM antigen is 5.01E-10.

[0173] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present application, and not to limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement to part or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. An antibody which specifically binds to glomerular basement membrane, characterized in that, comprises a heavy chain variable region and a light chain variable region; the heavy chain variable region comprises complementarity determining regions VH-CDR1, VH-CDR2 and VH-CDR3; and the light chain variable region comprises complementarity determining regions VL-CDR1, VL-CDR2 and VL-CDR3; the VH-CDR1, VH-CDR2 and VH-CDR3 are identical to the VH-CDR1, VH-CDR2 and VH-CDR3 of the heavy chain variable region shown in SEQ ID NO. 1; the VL-CDR1, VL-CDR2 and VL-CDR3 are identical to the VL-CDR1, VL-CDR2 and VL-CDR3 of the light chain variable region shown in SEQ ID NO. 2; the VH-CDR1, VH-CDR2, VH-CDR3, VL-CDR1, VL-CDR2 and VL-CDR3 of the binding protein are defined by any one of Kabat, Chothia, IMGT, ABM or Contact.

2. The antibody according to claim 1, characterized in that, According to the IMGT definition, the amino acid sequence of the VH-CDR1 is shown in SEQ ID NO. 11, the amino acid sequence of the VH-CDR2 is shown in SEQ ID NO. 16, the amino acid sequence of the VH-CDR3 is shown in SEQ ID NO. 19; the amino acid sequence of the VL-CDR1 is shown in SEQ ID NO. 22, the amino acid sequence of the VL-CDR2 is RVS, and the amino acid sequence of the VL-CDR3 is shown in SEQ ID NO.

25.

3. The antibody according to claim 1 or 2, characterized in that, The rest of the sequences of the antibody excluding the CDR regions are derived from one of the following species: rabbit, bovine, equine, porcine, ovine, caprine, rat, mouse, dog, cat, camel, donkey, deer, mink, chicken, duck, goose, turkey, human and mutants thereof.

4. The antibody according to claim 3, characterized in that, the framework region of the heavy chain variable region is identical to the framework region of the heavy chain variable region shown in SEQ ID NO. 1; and / or, the framework region of the light chain variable region is identical to the framework region of the light chain variable region shown in SEQ ID NO.

2.

5. The antibody of claim 1 or 2, wherein the antibody is a whole antibody, F(ab')2, Fab', Fab, Fv, scFv, dsFv or bispecific antibody.

6. The antibody of claim 5, wherein the antibody further comprises a constant region.

7. The antibody of claim 6, wherein at least a portion of the constant region sequence is a human constant region sequence.

8. The antibody of claim 7, wherein the constant region sequence is selected from the group consisting of a partial or complete constant region sequence of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD.

9. The antibody of claim 6, wherein the antibody comprises a heavy chain constant region, and the heavy chain constant region sequence is selected from a human heavy chain constant region.

10. The antibody according to claim 9, characterized in that the amino acid sequence of the heavy chain constant region is shown in SEQ ID NO.

3.

11. The antibody of claim 6, wherein the antibody comprises a light chain constant region.

12. The antibody according to claim 11, characterized in that, the light chain constant region sequence is selected from a mouse light chain constant region, and the amino acid sequence of the light chain constant region is shown in SEQ ID NO.

4.

13. The antibody of claim 5, wherein The antibody is a whole antibody, the heavy chain amino acid sequence is shown as SEQ ID NO. 5, and the light chain amino acid sequence is shown as SEQ ID NO.

6.

14. Biomaterials characterized in that, a polynucleotide, a vector, or a cell; The polynucleotide encodes the antibody of any one of claims 1-13. The vector carries the polynucleotide. The cell carries the polynucleotide or contains the vector and can express the antibody of any one of claims 1-13. The cell is a non-plant cell.

15. A method of producing the antibody according to any one of claims 1 to 13, characterized in that, The cell is cultured as described in claim 14.

16. The method of claim 15, wherein, The cell is prepared by transforming a polynucleotide encoding an antibody comprising any one of claims 1-13 into the cell, wherein the polynucleotide comprises a heavy chain expression plasmid and a light chain expression plasmid, and the transforming comprises co-transforming the heavy chain expression plasmid and the light chain expression plasmid into the cell.

17. The method of claim 16, wherein, The cell is a eukaryotic cell.

18. The method of claim 17, wherein, The cell is a mammalian cell.

19. The method of claim 18, wherein, The mammalian cell is a 293 cell or a CHO cell.

20. The method of claim 19, wherein, The cell is a 293F cell.

21. The antibody of any one of claims 1-13 or the biological material of claim 14 for use in any one of (I)-(VIII): (I) detecting anti-glomerular basement membrane antibodies for non-diagnostic and therapeutic purposes; (II) preparing a product for detecting anti-glomerular basement membrane antibodies; (III) preparing a product for diagnosing and / or aiding in the diagnosis of anti-glomerular basement membrane disease; (IV) preparing a product for diagnosing and / or aiding in the diagnosis of vasculitis; (V) detecting glomerular basement membrane antigens for non-diagnostic and therapeutic purposes; (VI) preparing a product for detecting glomerular basement membrane antigens; (VII) for isolating, enriching, and / or purifying glomerular basement membrane antigens; (VIII) preparing a product for isolating, enriching, and / or purifying glomerular basement membrane antigens; The vasculitis is anti-neutrophil cytoplasmic antibody-associated vasculitis. In any one of (I)-(IV), the antibody is used as a standard or a control.

22. A reagent or kit characterised in that, The reagent or kit comprises the antibody specific to the glomerular basement membrane of any one of claims 1-13 or the biological material of claim 14.

23. The reagent or kit of claim 22, wherein, The kit is used for detecting anti-glomerular basement membrane antibodies, or for diagnosing and / or aiding in the diagnosis of anti-glomerular basement membrane disease or vasculitis, which is anti-neutrophil cytoplasmic antibody-associated vasculitis; the kit comprises a standard and / or a control, and the standard and / or the control contain the antibody.

24. The reagent or kit of claim 23, wherein, The kit is used for diagnosing and / or aiding in the diagnosis of anti-neutrophil cytoplasmic antibody-associated vasculitis, and the kit further comprises detection reagents for anti-myeloperoxidase antibodies and / or anti-proteinase 3 antibodies.

Images