Eurotium cristatum culture medium, eurotium cristatum culture method and eurotium cristatum counting method

Abstract

The invention provides an eurotium cristatum culture medium, an eurotium cristatum culture method and an eurotium cristatum counting method.The eurotium cristatum culture medium is prepared from dark green tea leachate, saccharose, ammonium sulfate, soy peptone, potassium chloride, monopotassium phosphate, anhydrous magnesium sulfate, chloramphenicol and agar, specifically, the dark green tea leachate is 1%-1.5% of unfermented dark green tea leachate, and the saccharose is added into the dark green tea leachate. The eurotium cristatum cultured by the culture medium has more obvious bacterial colony characteristics, improves the counting accuracy and reliability, can overcome the standard of Eurotium cristatum detection methods specified in GB / T9833.3 and GB / T32719.5 for identifying harmful bacteria in Standard of Food Safety Standard Food Microbiology Inspection Mould and Yeast Counting (GB 4789.15-2016), and has the advantages of high accuracy, high accuracy and high reliability. The detection technology for detecting the eurotium cristatum in the tea leaves is insufficient and unsuitable.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial detection, and in particular belongs to a culture medium for Eurotium cristatum, a culture method for Eurotium cristatum and a counting method. Background Art

[0002] Eurotium cristatum, as a unique fungus, belongs to the phylum Eumycota; Mycobionta, class Ascomycetes, subclass Euascomycetes, order Eurotiales, family Eurotiaceae, genus Eurotium. Its asexual form is called A. punctatus, which plays a vital role in tea processing, especially in the "flowering process" of Fu'er tea. The unique flavor and quality of Fu'er tea are largely due to the growth and reproduction of Eurotium cristatum.

[0003] In the standards for Fu'er tea, such as "Compressed Tea Part 3: Fu'er Brick Tea" (GB / T9833.3-2013) and "Dark Tea Part 5: Fu'er Tea" (GB / T32719.5-2018), the number of Eurotium cristatum is clearly listed as one of the important indicators for determining the quality of Fu'er tea. This regulation not only reflects the importance of Eurotium cristatum in the production process of Fu'er tea, but also highlights its unique role in improving the quality of tea. However, in actual operation, how to accurately and efficiently detect the number of Eurotium cristatum has become a problem that needs to be solved urgently.

[0004] At present, the detection of Eurotium cristatum mainly relies on the "National Food Safety Standard Food Microbiology Inspection Mold and Yeast Count" (GB 4789.15-2016). However, this standard is mainly for the detection of molds and yeasts in food, and its culture medium formula and detection method are not completely applicable to the detection of Eurotium cristatum. Molds, usually regarded as "moldy fungi", have various colony morphologies, including velvety, flocculent or spider-web-like, which often cause food contamination and even produce toxins. Yeast, on the other hand, is a fungus that can ferment organic matter. Its colony morphology is similar to that of bacteria, but the colonies are larger and thicker. The detection standards for these two types of microorganisms are mainly based on the limit principle, that is, the measured value is less than the index value. However, as a probiotic, the more Eurotium cristatum there is in tea, the better, which is completely opposite to the detection standards for molds and yeasts.

[0005] The use of Eurotium cristatum (CGMCCNO.8730) is limited to tea leaves, and it is a traditional food processing fungus that is allowed to continue to be used in the "List of Fungi that Can Be Used in Food". During the "flowering period" and the initial drying period of Fu'er tea, the activity of Eurotium cristatum and the quality of tea leaves show a significant positive correlation. However, once the tea leaves are dried to become finished Fu'er tea, the correlation between the activity of Eurotium cristatum and the quality of tea leaves becomes unclear. Therefore, it is one-sided to judge the fermentation degree of Fu'er tea based solely on the number of Eurotium cristatum, and other factors need to be considered comprehensively.

[0006] Although GB 4789.15-2016 is widely used in the field of food microbiology testing, it has many shortcomings in the detection of Eurotium cristatum. First, the standard does not set specific sample preparation requirements for tea and Fu'er tea, which often leads to the situation that different inspectors often have very different sampling results for the same sample during laboratory testing. Even if the same inspector uses different pretreatment methods, the results may have orders of magnitude deviations. This irregularity not only affects the accuracy of the test results, but also limits the application of Eurotium cristatum in tea quality evaluation.

[0007] Secondly, the closter of Eurotium cristatum has a unique closed theca structure, which makes it impossible for the current GB 4789.15-2016 method to fully open the closed theca in the subsequent steps, and thus it is impossible to accurately detect the true number of Eurotium cristatum in Fuzhuan tea. In addition, some fast-growing molds will inhibit the growth of Eurotium cristatum, and the specific operating steps such as sample preparation, dilution type, and homogenization method in GB 4789.15-2016 are not clear, which also increases the uncertainty of the test results.

[0008] Finally, although the Bengal rose culture medium specified in GB 4789.15-2016 is suitable for the growth of mold, it is not the most suitable culture medium for the growth of Eurotium cristatum. Therefore, in the actual detection process, there are often large differences in the results of the mold count of Eurotium cristatum. This not only affects the accuracy of the test results, but also limits the scope of application of Eurotium cristatum in tea quality evaluation. Summary of the invention

[0009] Abstract: In order to solve the problems existing in the prior art, the present invention provides a culture medium for Eurotium cristatum, a culture method for Eurotium cristatum and a counting method, aiming to overcome the problem that the existing detection method for Eurotium cristatum is insufficient and unsuitable for detecting the detection technology of Eurotium cristatum in tea according to the "National Food Safety Standard Food Microbiology Examination Mold and Yeast Count" (GB4789.15-2016) standard for identifying harmful bacteria, which is stipulated in GB / T9833.3 and GB / T32719.5.

[0010] To achieve the above-mentioned purpose, the present invention provides the following technical scheme: a culture medium for Aspergillus niger, wherein the raw materials include dark tea extract, sucrose, ammonium sulfate, soy peptone, potassium chloride, potassium dihydrogen phosphate, anhydrous magnesium sulfate, chloramphenicol, and agar, wherein the dark tea extract is specifically 1% to 1.5% unfermented dark tea extract.

[0011] Furthermore, the dark tea extract is obtained by boiling 10 g to 15 g of dark tea with 1 L of distilled water for 10 min to 15 min and filtering; Each liter of culture medium contains sucrose: 36.0g / L~40.0g / L, ammonium sulfate 2.5g / L~3.0g / L, soy peptone 4.0g / L~6.0g / L, potassium chloride 3.8g / L~4.2g / L, potassium dihydrogen phosphate 1.0g / L~1.5g / L, anhydrous magnesium sulfate 1.0g / L~1.3g / L, chloramphenicol 0.1g / L, and agar 15g / L~20g / L.

[0012] Further, the dark tea extract is obtained by boiling 10 g of dark tea with 1 L of distilled water for 10 min to 15 min and filtering; Each liter of culture medium contains 38g / L sucrose, 3.0g / L ammonium sulfate, 4.0g / L soy peptone, 3.8g / L potassium chloride, 1.0g / L potassium dihydrogen phosphate, 1.0g / L anhydrous magnesium sulfate, 0.1g / L chloramphenicol, and 18g / L agar powder.

[0013] Further, sucrose, ammonium sulfate, soy peptone, potassium chloride, potassium dihydrogen phosphate, anhydrous magnesium sulfate and agar are added to the dark tea extract, and water is added to make up to one liter, heated to melt, the pH value is adjusted to 7.2±0.2, sterilized, and chloramphenicol is added to obtain a culture medium for Eurotium cristatum.

[0014] The present invention also provides a method for culturing Eurotium cristatum, the specific steps of which are as follows: Take tea samples, place them in sterile medium, and shake or pat them to obtain a uniform sample solution; The sample homogenate is diluted in a gradient manner, and the sample homogenate with gradient concentrations is mixed with the above-mentioned Eurotium cristatum culture solution respectively by pouring plate method; Let it stand until the culture medium of Eurotium cristatum is completely solidified, then place the plate upright for culture of Eurotium cristatum.

[0015] Furthermore, the tea sampling method is as follows: (1) Brick-shaped tea and cake-shaped tea: For tea weighing more than 200g, the sample should be evenly distributed at 5 to 7 points according to the “rice” sampling method. Each sampling point should take no less than 10g of sample, and the total sample should be no less than 100g. The sample should be crushed and homogenized to obtain the sample. For tea leaves weighing more than 50g and less than or equal to 200g, the sample should be evenly distributed at 5 to 6 points according to the "rice" sampling method. Each sampling point should take no less than 10g of sample, and the total amount of the sample should be no less than 100g. The sample should be crushed and homogenized to obtain the sample. For teas with a mass of less than or equal to 50g, randomly select a number of tea samples / cakes from the average sample, crush and homogenize to obtain the sample, and the total amount of the sample shall not be less than 50g; (2) Ball-shaped tea and bowl-shaped tea: For tea leaves weighing more than 50g, randomly select 1 to 4 points of the tea and divide the tea into four equal parts according to the shape of the product. The total amount of the sample should be no less than 100g. The samples are crushed and homogenized to obtain the samples. If the weight of a single tea is less than or equal to 50g, a number of tea samples shall be randomly selected from the average sample, crushed and homogenized to obtain the sample, and the total amount of the sample shall not be less than 50g; (3) Preparation of samples of teas other than compressed tea: Take one average sample, the total amount of the sample shall not be less than 50g.

[0016] Furthermore, in the step of sampling tea leaves, placing them in a sterilization medium, and shaking or beating them to obtain a sample homogenous solution, the sterilization medium is specifically sterile distilled water or sterile physiological saline. The specific steps for preparing the sample homogenous solution are as follows: Weigh 25 g of sample and mix it with 225 mL of sterile distilled water, shake it, and obtain a 1:10 diluted sample solution; or weigh 25 g of sample and mix it with 225 mL of 0.85% sterile saline, beat it for 1 min~2 min, and obtain a 1:10 diluted sample solution.

[0017] Furthermore, the bacterial liquid of Aspergillus cristatus is mixed with the above-mentioned Aspergillus cristatus culture liquid, and allowed to stand until the Aspergillus cristatus culture medium is completely solidified, and the plate is placed upright and cultured at 28±1°C for 3 to 5 days. The Aspergillus cristatus grown on the culture medium has typical colony morphology characteristics, and the colonies are yellow or golden round colonies. The colony boundaries on the back of the plate are clear and all yellow, and the plate count can be performed.

[0018] The present invention also provides a method for counting Eurotium cristatum, which is to perform plate counting on the Eurotium cristatum cultured by the above-mentioned culture method, specifically comprising: Select yellow or golden, round, compact colonies of Eurotium cristatum with water droplets, and plates with the same dilution and the number of colonies of Eurotium cristatum between 10 CFU and 150 CFU, and count the typical colonies. For atypical or suspicious colonies, the spore morphology is confirmed under a microscope by preparing slides, and after confirmation, it is included in the total number of E. coronaria colonies.

[0019] Furthermore, the counting rules for the number of colonies on two plates with the same dilution are as follows: (1) If the number of colonies on all plates is greater than 150 CFU, count the plate with the highest dilution and record the other plates as too many to count. The result is calculated by multiplying the average number of colonies by the highest dilution factor; (2) If the colony count on all plates is less than 10 CFU, the calculation should be based on the average colony count of the lowest dilution multiplied by the dilution factor; (3) If no colonies grow on any dilution plate, the result will be calculated as less than 1 multiplied by the lowest dilution factor; (4) If the colony counts on the plates of all dilutions are not between 10 CFU and 150 CFU, and some of them are less than 10 CFU or greater than 150 CFU, the calculation shall be based on the average colony count closest to 10 CFU or 150 CFU multiplied by the dilution factor.

[0020] Compared with the prior art, the present invention has at least the following beneficial effects: The present invention provides a culture medium for Eurotium guanidinum, which is specially designed for the detection and cultivation of Eurotium guanidinum in tea. The raw materials of the culture medium of the present invention include multiple components such as black tea extract, sucrose, ammonium sulfate, soy peptone, etc., and these components together provide an ideal growth environment for Eurotium guanidinum. Among them, the addition of black tea extract not only provides the special nutrients required by Eurotium guanidinum, but also enhances the selectivity of the culture medium for Eurotium guanidinum, so that the growth of other non-target microorganisms is inhibited. In addition, the culture medium is also optimized specifically for the growth requirements of Eurotium guanidinum, including selecting suitable carbon sources (sucrose), nitrogen sources (soy peptone), inorganic salts (such as potassium chloride, potassium dihydrogen phosphate), etc., to provide the best growth environment for Eurotium guanidinum. Under the premise of not affecting the culture effect, sucrose with lower cost is selected as the carbon source, which reduces the cost of the culture medium.

[0021] Furthermore, during the preparation process of the culture medium of the present invention, the quality and stability of the culture medium are ensured by precisely controlling the addition amount of various raw materials and the preparation conditions, such as heating and melting, adjusting the pH value, sterilization and the like. This not only improves the availability of the culture medium, but also ensures the accuracy and reliability of the test results.

[0022] In addition, the culture medium of the present invention also has the advantages of short culture time and high efficiency. By optimizing the formula and preparation conditions of the culture medium, the growth rate of the cristatum on the culture medium is significantly improved, thereby shortening the detection time from the traditional 5 days to 3 days, greatly improving the detection efficiency.

[0023] The method for cultivating Eurotium cristatum of the present invention adopts standardized sample preparation steps, including tea sampling, preparation of sample homogenate, etc., to ensure the uniformity and representativeness of the sample. This is of great significance for improving the accuracy and stability of the test results. Secondly, the method adopts the pouring plate method for cultivation, which is simple and quick to operate and easy to promote and use in the laboratory. At the same time, due to the optimization of the culture medium and the enhancement of selectivity, the growth of Eurotium cristatum on the culture medium is more vigorous, and the colony characteristics are more obvious, thereby facilitating the identification and counting of the inspectors.

[0024] In addition, the present invention also considers the influence of different tea types and shapes on sampling and preparing sample homogenate, and provides detailed sampling and preparation steps, so that the method has wide applicability. Whether it is brick-shaped tea, cake-shaped tea, spherical tea or other types of tea, the method can be used to detect and culture Eurotium cristatum.

[0025] The method for counting the crown-shaped Eurotium of the present invention adopts a selective culture medium and optimized culture conditions, so that the growth of the crown-shaped Eurotium on the culture medium is more vigorous, and the colony characteristics are more obvious, thereby improving the accuracy and reliability of the counting. Secondly, in the counting process, the method adopts strict counting rules and steps, such as selecting the crown-shaped Eurotium colonies with typical colony characteristics for counting, confirming the spore morphology of atypical or suspicious colonies under a microscope, etc., to ensure the accuracy and reliability of the counting. In addition, the method also takes into account the influence of different dilutions on the counting results, and provides detailed counting rules and steps, such as when the number of colonies on all plates is greater than 150 CFU, the plate with the highest dilution is counted; when the number of colonies on all plates is less than 10 CFU, the average number of colonies with the lowest dilution is multiplied by the dilution multiple, etc. The adoption of these rules and steps makes the counting results more accurate and reliable, and provides strong technical support for the quantitative detection of the crown-shaped Eurotium in tea.

[0026] In summary, the present invention can solve the problem that there is currently no special quantitative counting method and sample preparation method for Eurotium cristatum in tea, and facilitates the operation and identification of inspectors through standardized sample preparation and research on a culture medium suitable for the growth of Eurotium cristatum. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a microscopic morphological picture of Eurotium cristatum under a microscope; Figure 2 It is a data graph of the detection values ​​of Eurotium cristatum at the same dilution in Bengal red culture medium and the culture medium of the present invention; Figure 3 It is a real picture of the growth of Eurotium cristatum with the same dilution in the Bengal red medium and the counting plate of the medium of the present invention; Figure 4 The slant images are of 50 strains prepared by colony culture, purification and separation of Eurotium cristatum from different tea samples from different enterprises on the culture medium of the present invention.

[0028] Figure 5 This is the result of response surface design with potassium chloride, ammonium sulfate and dark tea extract as variable factors. DETAILED DESCRIPTION

[0029] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0030] The invention provides a culture medium for Eurotium cristatum, the raw materials of which include dark tea extract, sucrose, ammonium sulfate, soy peptone, potassium chloride, potassium dihydrogen phosphate, anhydrous magnesium sulfate, chloramphenicol and agar; (1) The dark tea extract is specifically 1% to 1.5% unfermented dark tea extract. 10g to 15g of dark tea is boiled with 1L of distilled water for 10min to 15min, and then filtered with gauze to remove the residue to obtain the dark tea extract for use; (2) Other ingredients and contents are: sucrose: 36.0 g / L~40.0 g / L, ammonium sulfate 2.5 g / L~3.0 g / L, soy peptone 4.0 g / L~6.0 g / L, potassium chloride 3.8 g / L~4.2 g / L, potassium dihydrogen phosphate 1.0 g / L~1.5 g / L, anhydrous magnesium sulfate 1.0 g / L~1.3 g / L, chloramphenicol 0.1 g / L, agar 15 g / L~20 g / L; (3) Add sucrose, ammonium sulfate, soy peptone, potassium chloride, potassium dihydrogen phosphate, anhydrous magnesium sulfate and agar to the dark tea extract to obtain a mixed solution, add distilled water to make up the mixed solution to 1 L, heat to dissolve, and adjust the pH value of the mixed solution to 7.2±0.2.

[0031] (4) After the mixed solution is divided into aliquots, sterilize it at 121℃ for 15 min and set aside. Before pouring into the plates, dissolve chloramphenicol in a small amount of ethanol and add it to the culture medium for later use.

[0032] When the culture medium of the present invention is used to culture Eurotium cristatum, the specific steps are as follows: Step 1: Preparation of compressed tea samples (1) Brick-shaped tea and cake-shaped tea: For single tea weighing more than 200g, use the “R” shaped sampling method, evenly distribute 5 to 7 points, sample no less than 10g at each sampling point, use thickened pure stainless steel tea cone or sampling drill to take samples, the total sample amount should be no less than 100g, then crush and fully mix the sample for 60s before use.

[0033] For single tea weighing more than 50g and less than or equal to 200g, use the “R” shaped sampling method, evenly distribute 5 to 6 sampling points, sample no less than 10g at each sampling point, use a thickened pure stainless steel tea cone or sampling drill, the total sample amount should be no less than 100g, then crush the sample and mix it thoroughly for 60s before use.

[0034] For teas with a mass of less than or equal to 50g, randomly select several pieces / cakes of tea from the average sample, crush them, mix them thoroughly and homogenize them for 60s before use. The total amount of the sample shall not be less than 50g.

[0035] Finally, weigh 25 g of the sample into a conical flask containing 225 mL of sterile distilled water and shake it thoroughly to obtain a 1:10 dilution.

[0036] Alternatively, weigh 25 g of the sample and put it into a homogenizing bag containing 225 mL of 0.85% sterile saline. Beat it with a slapping homogenizer for 1-2 minutes to make a 1:10 sample solution for later use.

[0037] (2) Ball-shaped tea and bowl-shaped tea: For single tea weighing more than 50g, randomly select 1 to 4 points of the tea and divide the tea body into four equal parts according to the shape of the product using a thickened pure stainless steel tea cone. The total amount of the sample should be no less than 100g. Then, the obtained sample should be crushed and fully mixed for 60s before use.

[0038] For teas with a mass of less than or equal to 50g, a number of tea samples shall be randomly selected from the average sample, crushed and fully mixed for 60s before use, and the total amount of the sample shall not be less than 50g; Finally, weigh 25 g of the sample into a conical flask containing 225 mL of sterile distilled water and shake it thoroughly to obtain a 1:10 dilution.

[0039] Alternatively, weigh 25 g of the sample and put it into a homogenizing bag containing 225 mL of 0.85% sterile saline. Beat it with a slapping homogenizer for 1-2 minutes to make a 1:10 sample solution for later use.

[0040] (3) Preparation of samples of teas other than compressed tea: Take one portion of the average sample, weigh 25 g of the sample into a conical flask containing 225 mL of sterile distilled water, and shake thoroughly to obtain a 1:10 dilution.

[0041] Or take one portion of the average sample, weigh 25g of the sample and put it into a homogenizing bag containing 225mL of 0.85% sterile saline, and beat it with a slapping homogenizer for 1min-2min to make a 1:10 sample solution for later use.

[0042] Step 2: Dilution of the sample (1) Take 1 mL of the 1:10 sample solution and inject it into a test tube containing 9 mL of sterile diluent. Use another 1 mL sterile pipette to pipette repeatedly or mix on a vortex mixer. This solution is the 1:100 sample solution. (2) Prepare a 10-fold serial dilution of the sample solution, using a 1 mL sterile pipette for each incremental dilution; (3) Select 2 to 3 sample solutions of appropriate dilutions. While performing 10-fold incremental dilutions, pipette 1 mL of the sample solution into 2 sterile plates for each dilution. At the same time, take 1 mL of the sterile dilution solution and add it to 2 sterile plates as blank controls. (4) Pour 20 mL to 25 mL of the above-mentioned Eurotium cristatum counting medium cooled to 46°C into a plate (which can be placed in a constant temperature water bath at 46°C ± 1°C for insulation), rotate the plate to mix evenly, and place it on a water table until the Eurotium cristatum culture medium is completely solidified; Step 3: Cultivation of Eurotium cristatum After the agar solidifies, place the plate upright and incubate it in a 28℃±1℃ incubator. Observe and record the results from the 3rd day to the 5th day. Step 4: Typical colony count: (1) The typical colony morphology of E. coronariae on the E. coronariae counting plate is that the colonies are yellow or golden round colonies after 3 days of cultivation. The colonies on the back of the plate have clear boundaries and are all yellow, which can be counted.

[0043] (2) Select yellow or golden-colored, round, compact colonies of Eurotium cristatum with water droplets, and count the typical colonies on plates with a colony count between 10 CFU and 150 CFU at the same dilution. For atypical or suspicious colonies, the spore morphology can be confirmed under a microscope by making slides, and then counted into the total number of E. coronaria colonies after confirmation.

[0044] Step 5: Calculate the initial screening results; Calculate the average of the colony counts on the two plates with the same dilution, and then multiply the average by the corresponding dilution factor. The specific calculation steps are as follows: (1) If the number of colonies on all plates is greater than 150 CFU, count the plate with the highest dilution, and record the other plates as uncountable. The result is calculated by multiplying the average number of colonies by the highest dilution factor; (2) If the colony count on all plates is less than 10 CFU, the calculation should be based on the average colony count of the lowest dilution multiplied by the dilution factor; (3) If no colonies grow on any dilution plate, the result will be calculated as less than 1 multiplied by the lowest dilution factor; (4) If the colony counts on all dilution plates are not between 10 CFU and 150 CFU, and some of them are less than 10 CFU or greater than 150 CFU, the average colony count closest to 10 CFU or 150 CFU is multiplied by the dilution factor for calculation; typical colony count; Step 6. Colony morphology on the culture medium of Eurotium cristatum: The colonies of Eurotium cristatum grow on the plate at 28±1℃ for 3~5 days with a diameter of 20mm~25mm. The hyphae are yellow, dense and low, spreading and growing. The center of the bacteria is darker and the edges are lighter. For further confirmation, at least 3 suspicious colonies are selected from the typical colonies for spore identification under a microscope, such as Figure 1 As shown, under the microscope, the ascus is spherical to nearly spherical; bright yellow in color, aggregated in a spherical shape. The ascospores are biconvex, with two obvious longitudinal cockscomb-like protrusions, and the convex surface of the sporophyte is obviously rough and golden yellow.

[0045] In summary, the present invention can prepare and culture multiple samples at the same time. The standardized sample pretreatment and the culture medium suitable for the growth of Eurotium cristatum can effectively and standardizedly culture, separate and count Eurotium cristatum in tea, optimizing and supplementing the blank of the detection method of Eurotium cristatum in the currently implemented national standards.

[0046] Example 1 1. The present invention clarifies the key steps for detecting Eurotium coronatum in Fu brick tea, adds a sample preparation method, clarifies the sampling operation steps, ensures the uniformity of the sample, and the accuracy and stability of the test results, so that the closed thecocysts of the "golden flower fungus" in Fu brick tea are completely opened, the ascospores are fully released, and the live bacteria count of Eurotium coronatum in Fu brick tea is truly reflected.

[0047] 2. The present invention optimizes the detection medium for Eurotium cristatum in tea. Taking the growth rate of the standard strain of Eurotium cristatum and the colony count of Eurotium cristatum in tea as indicators, the concentrations of carbon and nitrogen sources, inorganic salts (chloride, phosphate, sulfate) and dark tea extract were determined by single-factor experiments. Response surface design was used to optimize the detection medium with potassium chloride, dark tea extract and potassium dihydrogen phosphate as response values, which can shorten the detection time from 5 days to 3 days and improve the efficiency by 40%.

[0048] 4. The present invention determines the optimal culture conditions of Eurotium cristatum and tea detection conditions by optimizing the concentrations of nitrogen source, compound nitrogen source, carbon source, carbon-nitrogen ratio, inorganic salt, phosphate and dark tea extract in solid culture medium.

[0049] 5. The carbon source substances studied by the single-factor experimental screening method for detecting Eurotium cristatum in Fuzhuan tea are glucose and sucrose, but there is no significant difference between the two. Considering the cost factor, sucrose is selected as the best carbon source under the same circumstances.

[0050] 6. The present invention comprehensively analyzed the colony diameter and colony count and found that the optimal carbon-nitrogen ratio for the growth of Eurotium cristatum is 7:1 and the concentration is 4.2%.

[0051] 7. The colony diameter and colony count of the present invention have the same changing trend under two different salt ions and concentrations, both of which increase first and then decrease with the increase of salt ion concentration. The data show that the effect of potassium chloride on colony diameter and count is better than that of sodium chloride, so the best salt ion in the culture medium is potassium chloride.

[0052] 8. After adding different concentrations of black tea extract to the culture medium of the present invention, the colony morphology and counts can grow at concentrations of 0-1.2%. The colony is generally regular and round, dense and villi-like. After adding black tea extract, the golden color can be brightened and the colony growth is significantly promoted. The counting results show an increasing trend. Different concentrations of black tea extract have a significant effect on its growth. The colony diameter and count both show a trend of increasing first and then decreasing. The colony diameter reaches the maximum value when the concentration of black tea extract is 1.0%. When the concentration is less than 0.8%, the difference is significant. When the concentration continues to increase, the colony diameter decreases. Therefore, 1.0% black tea extract is selected.

[0053] 9. The different concentrations of phosphate in the present invention have an impact on the single-point growth of Eurotium cristatum and the detection results in tea samples. On the culture medium with different phosphate concentrations, the colony diameter and count of Eurotium cristatum showed a trend of first increasing and then decreasing, and at a concentration of 0.1%, the colony diameter and count both reached the maximum value. The test data showed that the results of potassium dihydrogen phosphate were better than those of dipotassium hydrogen phosphate, so the best phosphate was 0.1% potassium dihydrogen phosphate.

[0054] 10. The present invention optimizes the medium for detecting Eurotium cristatum in tea. The growth rate of the standard strain of Eurotium cristatum and the colony count of Eurotium cristatum in Fuzhuan tea are used as indicators, and the optimal addition amounts of carbon and nitrogen sources (sucrose, soy peptone, agar powder), inorganic salts (potassium dihydrogen phosphate, magnesium sulfate) and chloramphenicol are determined through single factor experiments.

[0055] Response surface design was used to optimize the test medium with potassium chloride, ammonium sulfate and dark tea extract as variable factors.

[0056] Table 1 Experimental design table of three-factor response surface analysis

[0057] Table 2 Experimental optimization design and results

[0058] Y 冠突散囊菌计数= 220.4-2.25 * A+10.625 * B-9.875 * C-2.0 * AB-7.5 * AC-6.25* BC-11.075 * A 2 -8.325 * B 2 -2.825 * C 2 (Coded value) Y 冠突散囊菌计数 =-5398.175+1432.5 * A+1893.625 * B+1140.625 * C-5.0* AB-187.5* AC-156.25 * BC-276.875 * A 2 -208.125 * B 2 -70.625 * C 2 (Actual value) Table 3 Regression analysis results of the Eurotium cristatum count model and regression coefficient

[0059] The results are as follows Figure 5 As shown, the optimal culture medium composition and conditions are: sucrose 38 g / L, ammonium sulfate 3.0 g / L, soy peptone 4.0 g / L, potassium chloride 3.8 g / L, potassium dihydrogen phosphate 1.0 g / L, magnesium sulfate (anhydrous) 1.0 g / L, chloramphenicol 0.1 g / L, agar powder 18 g / L, and 1% black tea extract.

[0060] Example 2 The present invention selects 52 types of commercially available Fu tea as shown in Table 4, and performs isolation and culture of Eurotium coronatum in Fu tea. The samples of the same production enterprise are tested by the same inspector, and the sample preparation method and culture medium of the present invention (Table 6), and the national standard GB4789-15 test method and Bengal red culture medium (Table 5) are used to isolate and culture Eurotium coronatum in Fu tea. The culture medium plate counting method of the present invention is used to perform colony counting and comparison results are as follows: Table 4 Sources of Fu Tea Samples

[0061] Table 5 GB4789.16-2016 detection method and rose Bengal culture medium

[0062] Table 6 Sample preparation method and culture medium of the present invention

[0063] like Figure 3 The figure is a real picture of the growth of the same dilution of Eurotium cristatum on the Bengal red medium and the medium of the present invention. The average number of Eurotium cristatum cultured with the Bengal red medium for the same sample and the same inspector is 251×10 4 CFU / g; the average number of Eurotium cristatum cultured using the medium of the present invention was 374×10 4 CFU / g; The above test results show that in the actual detection process of GB4789-15 national standard method, "the ascospores of the cleistothecia of the crown-like Ascodium are not fully released, resulting in the culture medium counting result being less than the actual colony count, and unable to truly reflect the number of live bacteria of the crown-like Ascodium in Fuzhuan tea. This is because the sample was not fully shaken or patted during sample preparation in GB4789-15, while after treatment according to the method of the present invention, it was found that the cleistothecia of the crown-like Ascodium in the treated sample homogenate were opened by microscopic examination, and the detection rate can be significantly improved after culture; From Table 5~Table 6 and Figure 2 The test data analysis proves that: for the same sample and the same inspector, the total number of colonies of Eurotium coronarius on the culture medium of the present invention is 1.49 times the total number of colonies on the red Bengal culture medium.

[0064] Therefore, the results of the control experiment of the two culture media prove that the culture media of the present invention is more suitable for the growth of Eurotium guanidinum, has high accuracy, and can more truly reflect the number of Eurotium guanidinum in tea. The culture media of Eurotium guanidinum proposed by the present invention can not only inhibit the growth of bacteria and some fungi, but also control the spread of colonies. On the culture media of Eurotium guanidinum of the present invention, Eurotium guanidinum has relatively unique colony characteristics, which can easily separate it from other fungi; And when the present invention carries out the cultivation of Eurotium guanidinum, the sampling and preparation method of the sample is limited. When preparing the sample, the closed capsule structure of Eurotium guanidinum can be broken by fully shaking or beating with a slapping homogenizer, and the sample is further placed in a culture medium suitable for the growth of Eurotium guanidinum provided by the present invention, so that it can truly reflect the number of Eurotium guanidinum, and significantly improve the detection rate; on the other hand, the uniformity of the sample can be guaranteed, and the parallelism of the test result can be greatly improved, and the result deviation will not be large due to the difference in sampling, which greatly improves the accuracy and stability of the test result, and can more accurately evaluate the quality of Fuzhuan tea. This method can be used for the counting of Eurotium guanidinum in tea leaves. As a preferred embodiment of the present invention, the present invention can solve the problem that there is no special quantitative counting method for the detection of Eurotium guanidinum in Fuzhuan tea and tea leaves.

[0065] Example 3 The present invention performs Eurotium cristatum detection on Fuzhuan tea samples from Shaanxi and Hunan, and cultures Eurotium cristatum colonies on the culture medium of the present invention for different tea samples from different enterprises, and then purifies and separates them to prepare 50 strain slants, as shown in Table 7, Figure 4 As shown: Table 7 Sample numbers of Fuzhuan tea from Shaanxi and Hunan

[0066] ITS nucleic acid and morphological identification of Eurotium cristatum strains: The 50 tubes of strains isolated from the culture medium of the present invention were sequenced for ITS nucleic acid sequences, and the sequencing results are as follows: GTGGATCGAGTGCGGGCTCTGGGTCCACCTCCCATCCGTGTCTATCTGTACCCTGTTGCTTCGGCGTGGCCACGGCCCGCCGGAGACTAACATTTGAACGCTGTCTGAAGTTTGCAGTCTGAGTTTTTAGTT AAACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCC TGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGCAACGGGGACGGGCCCAAAAGGCAGTGGCGGCACCATGTCTGGTCCTCGAGCG TATGGGGCTTTGTCACCCGCTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAAAGGGGGAGAGGA The above sequence was compared on NCBI genebank, and the species Aspergillus shevarii with a sequence similarity of 100% was obtained. Aspergillus chevalieri ) and Eurotium cristatum ( Eurotium cristatum ) are consistent.

[0067] 50 tubes of strains isolated from the culture medium of the present invention were sequenced for NS nucleic acid sequences, and the sequencing results are as follows: GTATGCCGGCTTACTAACCAAAAGTATAGGCCTTCTATACTGCGAAACTGCGAATGGCTCATTAAATCAGTTATCGATTATTTGATAGTACCTTACTACATGGATACCTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTAAGCGAATCGCATGGCCTTGCGCCGGTGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTGGCAACGGGTACCGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGGCAATAAATACTGATACGGGGCTCTTTTGGGTCTCGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGCAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGAAGCTGAACCTTGGGTCTGGCTGACCGGTCCGCCTCACCGAGAGTACTGGTCCGGCTGGACCTTTCCTTCTGGGGAACCTCATGGCCTTCACTGTCTGGGGGGGAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAAGGCCTATGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTTCTATTTTGATGGTTTCATAGGACCGCCGTAACTGATTTAATAGGGATAGCCC The sequence was aligned on NCBI genebank, and it was found to be identical to Aspergillus chevalieri and Eurotium cristatum with a sequence similarity rate of 99.42%.

[0068] The above tests determined that the isolated strains all belong to the genus Eurotium, proving that the purity of the Eurotium cristatum in the Fuzhuan brick tea produced in Hunan and Shaanxi and cultured with the Eurotium cristatum culture medium of the present invention is 100%; the gene homology is 99.42%; and it is confirmed that the colony is Eurotium cristatum.

[0069] In summary, the present invention can solve the problem that there is no special quantitative counting method for Aspergillus guanidinii in Fuzhuan tea. The present invention proposes a new Aspergillus guanidinii culture medium, which can not only inhibit bacteria and control the growth of some fungi, but also control the spread of colonies. On the Aspergillus guanidinii culture medium, Aspergillus guanidinii has relatively unique colony characteristics and is easy to be separated from other fungi. The counting result of Aspergillus guanidinii can be obtained through simple primary screening and identification. If a more accurate identification is required, because Aspergillus guanidinii can be clearly distinguished from various other fungi in the genus Eurotium on the culture medium of the present invention, it is only necessary to identify the ITS nucleic acid sequence of the typical colony and determine that the colony belongs to the genus Eurotium, and then the colony can be confirmed to be Aspergillus guanidinii.

[0070] The basic principles and main features of the present invention and the advantages of the present invention are shown and described above. For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic characteristics of the present invention.

[0071] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A culture medium for Eurotium cristatum, characterized in that: The raw materials include dark tea extract, sucrose, ammonium sulfate, soy peptone, potassium chloride, potassium dihydrogen phosphate, anhydrous magnesium sulfate, chloramphenicol, and agar, wherein the dark tea extract is specifically 1% to 1.5% unfermented dark tea extract.

2. A culture medium for Eurotium cristatum according to claim 1, characterized in that: Dark tea extract is obtained by boiling 10g~15g dark tea with 1L distilled water for 10min~15min and filtering; Each liter of culture medium contains sucrose: 36.0g / L~40.0g / L, ammonium sulfate 2.5g / L~3.0g / L, soy peptone 4.0g / L~6.0g / L, potassium chloride 3.8g / L~4.2g / L, potassium dihydrogen phosphate 1.0g / L~1.5g / L, anhydrous magnesium sulfate 1.0g / L~1.3g / L, chloramphenicol 0.1g / L, and agar 15g / L~20g / L.

3. A culture medium for Eurotium cristatum according to claim 1, characterized in that: Dark tea extract is obtained by boiling 10g dark tea with 1L distilled water for 10min~15min and filtering; Each liter of culture medium contains 38g / L sucrose, 3.0g / L ammonium sulfate, 4.0g / L soy peptone, 3.8g / L potassium chloride, 1.0g / L potassium dihydrogen phosphate, 1.0g / L anhydrous magnesium sulfate, 0.1g / L chloramphenicol, and 18g / L agar powder.

4. A culture medium for Eurotium cristatum according to claim 2 or 3, characterized in that: Sucrose, ammonium sulfate, soy peptone, potassium chloride, potassium dihydrogen phosphate, anhydrous magnesium sulfate and agar are added to the dark tea extract, and water is added to make up to one liter, heated to melt, the pH value is adjusted to 7.2±0.2, sterilized, and chloramphenicol is added to obtain the cristatum cristatum culture medium.

5. A method for culturing Eurotium cristatum, characterized in that: The specific steps are as follows: Take tea samples, place them in sterile medium, and shake or pat them to obtain a uniform sample solution; The sample homogenate is diluted in a gradient manner, and the sample homogenate with gradient concentrations is mixed with the culture solution of the Eurotium cristatum according to any one of claims 1 to 3 by a pouring plate method; Let it stand until the culture medium of Eurotium cristatum is completely solidified, then place the plate upright for culture of Eurotium cristatum.

6. The method for culturing Eurotium cristatum according to claim 5, characterized in that: The tea sampling method is as follows: (1) Brick-shaped tea and cake-shaped tea: For tea weighing more than 200g, the sample should be evenly distributed at 5 to 7 points according to the "rice" sampling method. Each sampling point should take no less than 10g of sample, and the total sample should be no less than 100g. The sample should be crushed and homogenized to obtain the sample. For tea weighing more than 50g and less than or equal to 200g, the sample should be evenly distributed at 5 to 6 points according to the "rice" sampling method. Each sampling point should take no less than 10g of sample, and the total sample should be no less than 100g. The sample should be crushed and homogenized to obtain the sample. For teas with a mass of less than or equal to 50g, randomly select a number of tea samples / cakes from the average sample, crush and homogenize to obtain the sample, and the total amount of the sample shall not be less than 50g; (2) Ball-shaped tea and bowl-shaped tea: For tea leaves weighing more than 50g, randomly select 1 to 4 points of the tea and divide the tea into four equal parts according to the shape of the product. The total amount of the sample should be no less than 100g. The samples are crushed and homogenized to obtain the samples. If the weight of a single tea is less than or equal to 50g, a number of tea samples shall be randomly selected from the average sample, crushed and homogenized to obtain the sample, and the total amount of the sample shall not be less than 50g; (3) Preparation of samples of teas other than compressed tea: Take one average sample, the total amount of the sample shall not be less than 50g.

7. The method for culturing Eurotium cristatum according to claim 6, characterized in that: In the step of taking tea samples, placing them in a sterile medium, and shaking or beating them to obtain a uniform sample solution, the sterile medium is specifically sterile distilled water or sterile physiological saline. The specific steps for preparing the uniform sample solution are as follows: Weigh 25 g of sample and mix it with 225 mL of sterile distilled water, shake it, and obtain a 1:10 diluted sample solution; or weigh 25 g of sample and mix it with 225 mL of 0.85% sterile saline, beat it for 1 min~2 min, and obtain a 1:10 diluted sample solution.

8. The method for culturing Eurotium cristatum according to claim 5, characterized in that: The bacterial liquid of the Aspergillus cristatus is mixed with the culture liquid of the Aspergillus cristatus, and the mixture is allowed to stand until the culture medium of the Aspergillus cristatus is completely solidified, and a plate is placed upright, and cultured at 28±1° C. for 3 to 5 days. The Aspergillus cristatus grown on the culture medium has typical colony morphology characteristics, and the colonies are yellow or golden round colonies. The colony boundaries on the back of the plate are clear and all yellow, and the plate count can be performed.

9. A method for counting Eurotium cristatum, characterized in that: The plate count of the Eurotium cristatum cultured by the culture method according to any one of claims 5 to 8 is performed, specifically: Select yellow or golden, round, compact colonies of Eurotium cristatum with water droplets, and plates with the same dilution and the number of colonies of Eurotium cristatum between 10 CFU and 150 CFU, and count the typical colonies. For atypical or suspicious colonies, the spore morphology is confirmed under a microscope by preparing slides, and after confirmation, it is included in the total number of E. coronaria colonies.

10. The method for counting Eurotium cristatum according to claim 9, characterized in that: The counting rules for the number of colonies on two plates with the same dilution are as follows: (1) If the number of colonies on all plates is greater than 150 CFU, count the plate with the highest dilution and record the other plates as too many to count. The result is calculated by multiplying the average number of colonies by the highest dilution factor; (2) If the colony count on all plates is less than 10 CFU, the calculation should be based on the average colony count of the lowest dilution multiplied by the dilution factor; (3) If no colonies grow on any dilution plate, the result will be calculated as less than 1 multiplied by the lowest dilution factor; (4) If the colony counts on the plates of all dilutions are not between 10 CFU and 150 CFU, and some of them are less than 10 CFU or greater than 150 CFU, the average colony count closest to 10 CFU or 150 CFU shall be multiplied by the dilution factor for calculation.

Images