Modification of serratia marcescens and application of serratia marcescens in spermidine production

Abstract

The invention discloses modification of serratia marcescens and application of the serratia marcescens in spermidine production, and belongs to the field of synthetic biology. A metabolic engineering modification method is adopted, a novel exogenous pathway is introduced, various product inhibition of a spermidine synthesis pathway is relieved, a spermidine transport system is changed, the enzymatic activity of a key pathway is strengthened, the serratia marcescens engineering bacterium capable of producing spermidine at high yield is obtained, the concentration of spermidine in a shake flask supernatant reaches 26.8 g / L, and the strain has a good application prospect. Good industrial application prospects are realized.

Description

Technical Field

[0001] The invention relates to the transformation of Serratia marcescens and application thereof in spermidine production, belonging to the technical field of bioengineering. Background Art

[0002] Spermidine, whose molecular formula is NH 2 (CH 2 ) 3 NH(CH 2 ) 4 NH 2 , widely present in microorganisms, plants and animals, is an important physiologically active substance. Spermidine is a multifunctional polyamine that plays an important role in a variety of biological processes, including cell proliferation, differentiation, DNA stability and cell stress response. In industrial production, spermidine is often used as a catalyst for certain plastics and polymers, and is used as a plant growth regulator in the agricultural field.

[0003] Although spermidine has a wide range of applications in industry and agriculture, traditional chemical synthesis methods have a series of problems. They usually require the use of highly toxic chemical reagents, which not only poses a threat to the safety of operators, but also leads to environmental pollution and waste disposal problems. In addition, the synthetic products usually require multi-step reactions, which are complicated and inefficient, resulting in low yields.

[0004] Compared with chemical synthesis, the synthesis of spermidine using microorganisms has some significant advantages. The microbial synthesis process is relatively environmentally friendly and does not require the use of highly toxic reagents, reducing the negative impact on the environment. Secondly, biosynthesis can be carried out under mild conditions, reducing energy consumption and production costs. Most importantly, microorganisms have diverse metabolic pathways that can synthesize spermidine from naturally occurring metabolites. However, existing microbial production methods also have limitations. The stability of the production strain is a key issue, especially during long fermentation processes, when microorganisms may lose the ability to synthesize spermidine. In addition, the yield of spermidine is usually not high enough and needs to be improved through metabolic engineering methods. The fermentation process may also be complicated and require careful design and optimization. Therefore, modifying microorganisms through genetic engineering to make them produce high spermidine is one of the methods to solve the current problem of spermidine production by microbial fermentation. Summary of the invention

[0005] The present invention finds that Serratia marcescens has excellent performance in growth rate and metabolic adaptability, and can grow under a variety of nutritional sources and environmental conditions; and the metabolic network of Serratia marcescens has naturally adapted to the synthesis of polyamines, which provides a natural production advantage for it. Compared with traditional Escherichia coli (1.5g / L), Serratia marcescens shows a higher tolerance to spermidine (7g / L), which is conducive to the high-concentration production of spermidine. Therefore, the present invention provides a genetically engineered Serratia marcescens bacterium, introduces a new way to synthesize spermidine from an exogenous source, and uses Serratia marcescens as a host to produce spermidine in high yield.

[0006] The first object of the present invention is to provide a genetically engineered bacterium of Serratia marcescens, wherein the engineered bacterium is introduced with an exogenous spermidine synthesis pathway and contains genes of carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine urea hydrolase.

[0007] In one embodiment, the carboxyaminopropyl agmatine dehydrogenase can be a carboxyaminopropyl agmatine dehydrogenase from any source; alternatively, it can be a carboxyaminopropyl agmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrio acetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, etc. Further alternatively, it is from Spirochaeta thermophila DSM 6578 or Denitrovibrio acetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobacter coccineus YM16-304.

[0008] In one embodiment, the carboxyaminopropyl agmatine decarboxylase can be a carboxyaminopropyl agmatine dehydrogenase from any source; alternatively, it can be a carboxyaminopropyl agmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrio acetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, etc. Further alternatively, it is from Spirochaeta thermophila DSM 6578 or Denitrovibrio acetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobacter coccineus YM16-304.

[0009] In one embodiment, the aminopropylagmatine urea hydrolase can be a carboxyaminopropylagmatine dehydrogenase from any source; alternatively, it can be a carboxyaminopropylagmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrioacetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, etc. Further alternatively, it is from Spirochaeta thermophila DSM 6578 or Denitrovibrio acetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobacter coccineus YM16-304.

[0010] In one embodiment, the engineered bacteria also knock out the gene encoding the repressor protein argR and construct an argA negative feedback mutant.

[0011] In one embodiment, the argA negative feedback mutant of the engineered bacteria is a mutant in which the 40th base C of the argA gene is mutated to T, and the encoded histidine is changed to tyrosine, thereby significantly increasing the production of arginine.

[0012] In one embodiment, the engineered bacteria also utilizes a strong promoter to replace the natural promoter of the gene lysC encoding aspartate kinase, the gene asd encoding aspartate semialdehyde dehydrogenase, the argA gene encoding N-acetylglutamate synthetase, the argH gene encoding arginine succinate lyase, and the speA gene encoding arginine decarboxylase. For example, the strong promoter trc is used to replace the natural promoters of lysC, asd, argA, argH, and speA to enhance the expression of aspartate kinase, aspartate semialdehyde dehydrogenase, N-acetylglutamate synthetase, arginine succinate lyase, and arginine decarboxylase. Optionally, the strong promoter sequence is shown in SEQ ID NO.187.

[0013] In one embodiment, the engineered bacteria also knocks out the gene encoding the transporter protein PotABCD, thereby reducing the transfer of spermidine into the cell; optionally, further, the expression of the transporter protein MdtJI that transfers spermidine to the extracellular space is enhanced, for example, by replacing the natural promoter of the MdtJI gene encoding the strong promoter.

[0014] In one embodiment, the engineered bacteria further knock out the thrA and metL genes encoding homoserine synthase; or, after knocking out the thrA and metL genes, the dapA gene encoding dihydropyridinedicarboxylate synthase is further knocked out; or, after knocking out the thrA, metL, and dapA genes, the proC encoding pyrroline 5-carboxylate reductase is further knocked out.

[0015] In one embodiment, the engineered bacteria also has the astA gene encoding arginine N-succinyltransferase knocked out.

[0016] In one embodiment, the gene integration and expression of the genetically engineered bacteria is carried out using the principle of homologous recombination.

[0017] In one embodiment, the knockout gene is knocked out using homologous recombination technology.

[0018] In one embodiment, the gene is knocked out using Crispr / Cas9 gene editing technology.

[0019] The second object of the present invention is to provide an application of a genetically engineered bacterium of Serratia marcescens in producing spermidine.

[0020] Beneficial Effects

[0021] The present invention constructs a Serratia marcescens that can produce spermidine with glucose as raw material based on synthetic biology methods. The production process is simple, the raw materials are easy to obtain and the cost is low, and it has good industrial application prospects. The details are as follows:

[0022] (1) The present invention introduces an exogenous pathway, and realizes a new pathway synthesis of spermidine in Serratia marcescens by introducing exogenous carboxylaminopropyl agmatine dehydrogenase gene, exogenous carboxylaminopropyl agmatine decarboxylase gene, and exogenous aminopropyl agmatine urea hydrolase gene. Compared with the traditional production pathway, the Serratia marcescens genetic engineering bacteria of the present invention can greatly increase the yield of spermidine. When only the exogenous pathway is introduced, the spermidine concentration reaches 5.9 g / L.

[0023] (2) The present invention relieves the feedback inhibition of arginine and the inhibition of the pathway by ArgR, and the production of spermidine after optimization reaches 8.6 g / L.

[0024] (3) The present invention enhances the expression of aspartate kinase encoded by the lysC gene and aspartate semialdehyde dehydrogenase encoded by the asd gene, which are key enzymes for catalyzing the synthesis of aspartate semialdehyde from aspartate; N-acetylglutamate synthetase and arginine succinate lyase encoded by the argA and argH genes, which are the first and last enzymes in the arginine synthesis pathway, respectively; and arginine decarboxylase encoded by the speA gene, which is a key enzyme for catalyzing the further synthesis of agmatine from arginine. The expression of these five enzymes can increase the yield of spermidine to 16.3 g / L.

[0025] (4) The present invention improves the transport pathway of spermidine. PotABCD and MdtJI proteins are proteins that transport spermidine into and out of cells, respectively. Knocking out PotA and enhancing the expression of MdtJI can increase the production of spermidine to 21.4 g / L.

[0026] (5) After knocking out the genes thrA, metL, dapA, and proC, the production of spermidine in the present invention reached 23.3 g / L.

[0027] (6) The present invention further knocks out the ast series genes to increase the production of spermidine to 26.8 g / L. Biological deposit materials The Serratia marcescens HBQA7 in the present invention is taxonomically named Serratiamarcescens HBQA7, which was deposited in the China Center for Type Culture Collection on February 23, 2023, with a deposit number of CCTCC NO: M 2023184, and the deposit address is Wuhan University, Wuhan, China. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the pathway for Serratia marcescens to synthesize spermidine in the present invention. DETAILED DESCRIPTION

[0029] 1. Strains and plasmids involved in the present invention

[0030] pRSFDuet-1, pTrc99a, PKD46, pCP20, T19 vector plasmids, pMD18-T vector plasmids, Escherichia coli BL21 (DE3), Escherichia coli JM109 purchased from Novagen. pBBR1MCS-2 purchased from MiaoLing Plasmid Platform, Serratia marcescens HBQA7 (CCTCC NO: M 2023184) preserved in the laboratory. Illustrative examples of Serratia include, but are not limited to, Serratia fonticola ATCC 29845, Serratia odorifera ATCC 33077, Serratia aplymuthica ATCC 15928, Serratia liquefaciens ATCC 27592, Serratia rubidaea ATCC 19279, Serratia oryzae ATCC 1011, Serratia ureilytica ATCC BAA-2620, Serratia entomophila ATCC 43705, Serratia ficaria ATCC 33105, Serratia marcescens ATCC 13880, and Serratia proteamaculans ATCC 19323, all of which are available from the ATCC culture collection. Serratiasymbiotica DSM 23270, Serratia nematodiphila DSM 21420, Serratia quinivorans DSM 4597 and Serratia grimesi DSM 30063 were purchased from the DSMZ strain bank in Germany. Serratia marcescens HBQA7 was deposited in the China Center for Type Culture Collection, with the deposit number of CCTCC NO: M 2023184.

[0031] 2. Fermentation conditions

[0032] The shake flask fermentation medium used in the present invention to verify the yield of the strain is as follows: 10g glucose, 10g yeast extract, 20g NaCl, 50% (v / v) R / 2 medium, 5mL trace metal element stock solution per liter; the R / 2 medium composition is: 2g (NH 4 ) 2 HPO 4, 6.75g KH 2 PO 4 , 0.85 g citric acid, 0.7 g MgSO 4 7H 2 O, pH 6.86; the trace metal element stock solution contains 5M HCl, 10g FeSO per liter 4 7H 2 O, 2.25 g ZnSO 4 7H 2 O, 1gCuSO 4 ·5H 2 O, 0.5 g MnSO 4 ·5H 2 O, 0.23 g Na 2 B 4 O 7 10H 2 O, 2 g CaCl 2 ·2H 2 O, 0.1 g (NH 4 ) 6 Mo 7 O 24 The shake flask fermentation temperature was controlled at 37°C and the initial pH was 7. The liquid volume was 1 / 5 of the shake flask volume. The rotation speed was controlled at 200 rpm and the shake flask fermentation time was 24 hours.

[0033] 3. Determination of spermidine content

[0034] Preparation of OPA derivatization reagent: OPA reagent was prepared by Uren method and Karababa (15). 0.20 g of OPA was dissolved in 9.0 mL of methanol, and 1.0 mL of 0.40 M (pH 9.0) borate buffer and 160 μL of 2-mercaptoethanol (reducing agent) were added. OPA reagent was stored at 4°C.

[0035] Spermidine was first derivatized with o-phthalaldehyde (OPA; Sigma, St. Louis, MO). 50 μL of sample and 450 μL of water were added to 400 μL of methanol. After adding 100 μL of OPA reagent, the mixture was filtered through a 0.2-μm filter membrane and 20.0 μL of the filtrate was immediately injected into the HPLC instrument.

[0036] HPLC detection conditions: Spermidine was detected by the method in reference (Qian, ZG, XXXia, and SYLee, Metabolic engineering of Escherichia coli for the production of putrescine: a fourcarbon diamine. Biotechnol Bioeng, 2009. 104 (4): p. 651-662): Luna 5-μm C18 (2) 100A column (250 × 4.6 mm; Phenomenex) operated at 25 ° C and 0.8 mL / min mobile phase was used for all sample separations. The mobile phase consisted of solvent A (55% methanol in 0.1 M sodium acetate, pH 7.2) and solvent B (methanol). The following gradient was applied: 1-6 min, 100% A; 6-10 min, linear gradient of B from 0% to 30%; 10-15 min, linear gradient of B from 30% to 50%; 15-19 min, linear gradient of B from 50% to 100%; 19-23 min, 100% B; 23-25 ​​min, linear gradient of B from 100% to 30%; 25-28 min, linear gradient of B from 30% to 0% (all in vol %).

[0037] 4. Gene integration expression plan

[0038] The principle of homologous recombination is used for gene integration and expression. Specifically,

[0039] The target gene was amplified using the amplification primer "KZ-F / R" and integrated into the multiple cloning site of the T19 vector plasmid by homologous recombination. The left arm (LA) and the right arm (RA) of the homologous arm were amplified using the 1000bp above and below the target gene as a template and connected to the two ends of the target gene on the T19 vector plasmid to construct the homologous arm. The plasmid with the left and right arms connected was extracted, and the target fragment: LA-trc-target gene-RA was amplified using the plasmid T19-LA-trc-target gene-RA as a template and the corresponding primers. After the PCR product was purified, the template effect was eliminated using the restriction endonuclease DpnI, and the product after enzyme digestion was purified again. The homologous recombination enzyme expression PKD46 plasmid was extracted using a plasmid extraction kit, and after purification, it was transformed into the competent cell Serratia marcescens HBQA7 to construct Serratia marcescens HBQA7-PKD46. After preparing Serratiamarcescens HBQA7-PKD46 competent cells, store them at -80°C for later use. The purified product was transferred into the above-mentioned Serratia marcescens competent cells, and the positive transformants were screened on the resistance plate using the carnamycin resistance marker. To verify whether recombination occurred, PCR was performed using the corresponding primers "target gene-YZ-F" and "target gene-YZ-R". If recombination occurred, a fragment of about 1200 bp could be amplified, otherwise no fragment could be amplified. At the same time, the corresponding PCR method was used on the ampicillin and carnamycin double-resistance plates to verify Serratia marcescens HBQA7PKD46 (kana R ). Then, the kanamycin resistance was eliminated. First, Serratiamarcescens HBQA7 PKD46 (kana R ) competent cells, and the pCP20 plasmid was transformed into Serratia marcescensHBQA7-PKD46 (kana R ) After the cells were in competent state, resistance-eliminated transformants were screened using non-resistance plates and resistant plates, and transformants were identified by colony PCR to screen out transformants that integrated the target gene and eliminated resistance.

[0040] By using the above-mentioned integration expression method and integration operation steps, the mutated gene and the replaced promoter sequence are integrated into the required position of the genome, and the strain is subjected to corresponding metabolic engineering transformation.

[0041] Enzyme digestion reaction system: 10×Q Cut Buffer 5μL, DNA 20μL, ddH 2 O 33μL, endonuclease-1 1μL, endonuclease-2 1μL, mix well, and heat in a 37℃ water bath for 0.5 to 1h.

[0042] Ligation reaction system: 5 μL of Lightning Cloning Enzyme, 1-2 μL of double-digested plasmid (10-100 ng), 4-5 μL of homologous target fragment, ddH 2 Add 0 to 10 μL, mix well, and heat in a 50°C water bath for 30 min.

[0043] DpnI template effect elimination reaction system (60 μL): DpnI 3 μL, PCR purified product 20 μL, 10×FastDigest Buffer 6 μL, ddH 2 O 31 μL.

[0044] PCR amplification target gene reaction system (50 μL): DNA template 1 μL, 5× PrimeSTAR Buffer 10 μL, dNTP Mixture 4 μL, amplification primer 1 μL, amplification primer 1 μL, PrimeSTAR HSDNA Polymerase 0.5 μL, ddH 2 O32.5μL.

[0045] PCR amplification program: 30 cycles (98°C for 10 s, 55°C for 10 s, 72°C at 1 kb / min), 72°C for 10 min, and storage at 4°C.

[0046] Colony PCR reaction system: 2×Tag Master Mix 10μL, upstream primer (concentration 10μM) 1μL, downstream primer (concentration 10μM) 1μL, ddH 2 O 8μL, a small amount of colonies or bacterial liquid as template.

[0047] Example 1: Introduction of exogenous spermidine synthesis pathway

[0048] The present invention introduces the CAPADH / CAPADC / APAUH pathway from different microbial strains into Serratia marcescens HBQA7 for heterologous expression. First, carboxyaminopropyl agmatine dehydrogenase, carboxyaminopropyl agmatine decarboxylase and aminopropyl agmatine urea hydrolase from multiple different sources are expressed in Serratia marcescens through plasmids. The enzyme with the highest catalytic efficiency is further selected, and the CAPADH / CAPADC / APAUH pathway is exogenously integrated through homologous recombination. The genome integration position selected by the present invention is upstream of the argA gene of Serratia marcescens HBQA7.

[0049] The specific process is as follows:

[0050] The carboxyaminopropylagmatine dehydrogenase genes stcapadh, dacapadh, gscapadh and iccapadh were cloned from the genomes of Spirochaeta thermophila DSM 6578, Denitrovibrio acetiphilus DSM 12809, Geobacter sulfurreducens KN400 and Ilumatobacter coccineusYM16-304 using amplification primers. The amino acid sequences of the genes were WP_014623968.1, WP_013011851.1, WP_010943175.1 and WP_015442124.1 on NCBI, respectively; The carboxyaminopropylagmatine decarboxylase genes stcapadc, dacapadc, gscapadc, and iccapadc were cloned from the genome of YM16-304, and the amino acid sequences were numbered WP_014623969.1, WP_013011852.1, WP_004513933.1, and WP_015442123.1 in NCBI, respectively; The aminopropylagmatine urea hydrolase genes stapauh, daapauh, lbapauh, and icapauh were cloned from the genome of YM16-304, and the amino acid sequences were numbered WP_014623970.1, WP_013011853.1, WP_015770028.1, and WP_015442122.1 in NCBI, respectively. The three cloned genes were connected to the same pBBR1MCS-2 plasmid to obtain recombinant Serratia marcescens with enhanced expression of the three genes.

[0051] CAPADH and CAPADC in the above-mentioned microorganisms are located in adjacent positions of a gene cluster. Using stcapadh-HindⅢ-F and stcapadc-EcoRⅤ-R as primers and the Spirochaeta thermophila DSM 6578 genome as a template, the target fragment stcapadh-stcapadc was amplified; the first multiple cloning site of the plasmid pBBR1MCS-2 was treated with double enzymes HindⅢ and EcoRⅤ enzymes, and after purification of the enzyme digestion product, the cut plasmid was connected with the amplified target fragment stcapadh-stcapadc, and the connection product pBBR1MCS-2-stcapadh-stcapadc was transferred into JM109 competent cells, and positive clones were selected on the resistance plate card sodium plate, and its correctness was further verified by colony PCR; using stapauh-EcoRⅠ-F and stapauh-SpeⅠ-R as primers, Spirochaeta thermophila DSM 6578 genome as a template, amplify the target fragment stapauh, use double enzymes EcoRⅠ and SpeⅠ to digest the second multiple cloning site of plasmid pBBR1MCS-2-stcapadh-stcapadc, purify the digestion product, and connect it with the amplified target fragment stapauh. The ligation product pBBR1MCS-2-stcapadh-stcapadc-stapauh is transformed into JM109 competent cells, and positive clones are selected on the resistance plate card sodium plate. Colony PCR further verifies its correctness. Select the JM109 strain with the correct connection, extract the plasmid pBBR1MCS-2-stcapadh-stcapadc-stapauh and transform it into the competent cell Serratia marcescens HBQA7 to construct the Serratia marcescens HBQA7-stcapadh-stcapadc-stapauh spermidine synthesis strain. The construction methods of the remaining strains were similar to those of Serratia marcescens HBQA7-stcapadh-stcapadc-stapauh, where carboxyaminopropyl agmatine dehydrogenase, carboxyaminopropyl agmatine decarboxylase and aminopropyl agmatine urea hydrolase from different strains were connected to two multiple cloning sites of the pBBR1MCS-2 plasmid. The connection of other genes was similar to the above. The primer sequences used are shown in Table 1:

[0052] Table 1 Primer sequences (SEQ ID NO. 1-4)

[0053] Primer Name Sequence 5’-3’ SEQ ID stcapadh-HinⅢ-F <![CDATA[GCACCCCAGGC AAGCTT GATGGGCACGGGTGCTCATCAT]]> NO.1 stcapadc-EcoRⅤ-R <![CDATA[GGGCTGCAGGAATTC GATATC TTACGAGAGGCGCCGCTT]]> NO.2 stapauh-EcoRⅠ-F <![CDATA[CGATGATATC GAATTC ATGCGCTATCCCCACTTCCT]]> NO.3 stapauh-SpeⅠ-R <![CDATA[AGTTCTAGA ACTAGT CTACCGCCGGGGTAGATGCC]]> NO.4

[0054] The recombinant Serratia marcescens was transferred to LB medium (10 g / L peptone, 5 g / L yeast powder, 10 g / L NaCl) at a volume ratio of 2%. 600 After reaching 0.6-0.8, IPTG was added at a final concentration of 0.4 mM, and the expression was induced at 20°C for 12 h. After the induction expression was completed, the supernatant was collected by centrifugation at 4°C, 8000 rpm, and 20 minutes. The spermidine concentration in the supernatant was detected by HPLC, as shown in Table 2.

[0055] Table 2

[0056]

[0057]

[0058] The use of expression vectors to overexpress key genes for spermidine synthesis will bring a metabolic burden to the bacteria and affect their growth. The expression vectors are structurally unstable and easy to lose during bacterial reproduction, and their copy number in the cells is unstable. The addition of antibiotics affects bacterial growth and pollutes the environment. The increased cost caused by IPTG induction limits the expansion of production scale. Therefore, the strain Serratia marcescens-stcapadh-stcapadc-stapauh with the best induced expression of spermidine synthesis was selected, and the promoter J23119 and ribosome binding site (RBS) B0034 in Serratia marcescens were connected to the stcapadh-stcapadc-stapauh gene to form an exogenous gene expression fragment. According to the aforementioned "4. Gene integration expression plan", the exogenous gene expression fragment was integrated into the knockout strain Serratia marcescens HBQA7 to construct the strain Serratia marcescens-stcapadh-stcapadc-stapauh, named S1, and used as the basic strain for subsequent research.

[0059] The production of S1 spermidine was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 5.9 g / L.

[0060] Example 2: Removing feedback inhibition of important enzymes in the pathway and knocking out repressor proteins

[0061] In the important intermediate process of aspartate semialdehyde and arginine synthesis, there is an important repressor protein that inhibits the synthesis of intermediates and final products. The DNA-binding dual transcriptional regulator encoded by the argR gene (the accession number of the amino acid sequence on NCBI is WP_004933572) inhibits the expression of the arg series genes and the excessive synthesis of the required important intermediates ornithine and arginine. Therefore, in order to ensure the stable and high-speed synthesis of each intermediate, the gene encoding the repressor protein is deleted to increase the metabolic flux.

[0062] In the metabolic pathway of arginine synthesis, N-acetylglutamate synthetase encoded by argA (amino acid sequence accession number on NCBI is ALE97678.1) is subject to feedback inhibition by the product arginine. In order to improve the activity of the enzyme, on the basis of knocking out the argR gene, the gene encoding the enzyme was further mutated to construct a negative feedback mutant, thereby relieving feedback inhibition and obtaining the engineered bacterium Serratia marcescens argA fbr ΔArgR, named S2.

[0063] The specific process is as follows:

[0064] (1) Knockout of the repressor protein ArgR

[0065] The primer designs are shown in Table 3:

[0066] Table 3 Primer sequences (SEQ ID 5-14)

[0067]

[0068]

[0069] The homologous recombination enzyme expression PKD46 plasmid was extracted using a plasmid extraction kit, and after purification, it was transformed into competent cells S1 to construct S1-PKD46. After preparing S1-PKD46 competent cells, they were stored at -80°C for future use. The homologous recombination fragment template plasmid T19 vector was extracted using a plasmid extraction kit, and purified and recovered using a gel tapping recovery kit. Primers ApaI-LA-argR and argR-LA-EcoRI, KpnI-RA-argR and argR-RA-SalI were designed to amplify the corresponding homologous arm LA and RA fragments, and purified and recovered using a gel tapping recovery kit. The plasmid T19 vector was double-digested with ApaI and EcoRI, and the digestion results were detected by electrophoresis. The size after digestion was 5041bp, and the digestion product was purified and recovered. The product after double digestion of the T19 vector was connected to the left arm LA fragment. The connected product was transformed into JM109 competent state, spread on a card sodium resistance plate, screened for positive clone strains, and the results were verified by colony PCR using primers LA-YZ-F and LA-YZ-R. The band size was about 1100bp. The successfully verified strains were sent for sequencing to further confirm that the fragments were successfully connected. The T19 plasmid with the LA fragment connected was double-digested with KpnI and SalI, and the RA fragment was connected using the same method as above, and the connected plasmid was verified. The T19 vector plasmid with the LA and RA fragments connected was extracted, and used as a template, and PCR was performed with primers ApaI-LA-argR and argR-RA-SalI to obtain the target fragment argR-LA-FRT-Kan-FRT-RA. The electrophoresis identification band size was about 3324bp. After the PCR product was purified, the restriction endonuclease DpnI was used to eliminate the template effect. The target fragment argR-LA-FRT-Kan-FRT-RAPCR product after restriction endonuclease DpnI digestion is further purified and transferred into Serratia marcescens HBQA-PKD46 competent cells after purification. The positive transformants are screened on the resistance plate using the carnamycin resistance marker. To verify whether the positive transformants screened have indeed undergone recombination, the positive transformants are used as templates. The primers argR-YZ-F and argR-YZ-R can be used to amplify a fragment of about 1100bp, which can be judged as recombination. Conversely, if no fragment can be amplified, it can be judged as a false positive. While verifying whether the recombination has occurred by PCR amplification, the corresponding PCR verification bacteria are spotted on the ampicillin sodium plate. The correct transformant S1-PKD46 (kana R ) to eliminate carnamycin resistance, firstly, S1-PKD46 (kana R ) competent cells, the extracted pCP20 plasmid was transformed into S1-PKD46 (kana R) After being in competent state, resistance-eliminated transformants were screened using non-resistance plates and resistant plates, and transformants were identified by colony PCR, and transformant S1-△argR with knockout of argR gene and elimination of resistance was screened.

[0070] (2)argA fbr Construction of mutants

[0071] The argA gene is subject to feedback inhibition by the target product arginine. The present invention mutates the 40th base C of the argA gene to T. After the encoded histidine is changed to tyrosine, the yield of arginine is significantly increased. Therefore, we mutate this site and integrate it into the plasmid pRSFDuet-1 plasmid.

[0072] The specific process is as follows:

[0073] The primer designs are shown in Table 4 below:

[0074] Table 4 Primer sequences (SEQ ID NO.15~18)

[0075] Primer Name Primer Sequence 5’-3’ SEQ ID F-argA-Amplification Primer GTGAAGGAACGTAGTACAGAGCT NO.15 R-argA-Amplification Primer TTACAGATCCGCCAGCAGA NO.16 argA-TB-F CAAGGATTCCGTTACTCAGTC NO.17 argA-TB-R GACGGAATCCTTGCACCAGCT NO.18

[0076] First, the pRSFDuet-1 (high copy) plasmid was extracted using a plasmid extraction kit, and BamHI and HindⅢ were selected for double enzyme digestion. The enzyme digestion system (50 μL) was as follows: 10×Q Cut Buffer 5 μL, plasmid 20 μL, BamHI 1 μL, HindⅢ 1 μL, ddH 2 O 33μL, digested with enzymes and purified. Secondly, the genome of Serratia marcescens HBQA was extracted, and the argA gene fragment was amplified using the genome as a template. After the PCR product was verified, it was connected to the pRSFDuet-1 plasmid after digestion. CaCl 2 The competent cells of E.coli JM109 were prepared by the method, and the pRSFDuet-1 plasmid connected with the argA fragment was transformed into the competent cells. The positive transformants were selected, and the colony PCR was used to identify the successfully transformed strain E.coli JM109-argA. The plasmid pRSFDuet1-argA in E.coli JM109-argA was extracted, and the plasmid was used as a template to perform site-directed mutagenesis of argA. The mutant gene was designed and extracted using the Fast Mutangenesis System kit, and the argA mutant primers argA-TB-F / R were used to amplify argA using the extracted pRSFDuet1-argA plasmid as a template. fbr The PCR amplification system (50 μL) was as follows: 3 μL of plasmid template, 1 μL of argA-TB-F, 1 μL of argA-TB-R, 2× FastPfu Fly PCR SuperMix25μL, ddH 2 O 20μL. The PCR amplification program is: 94℃2-5min, 20-25 cycles (94℃20s, 55℃20s, 72℃2-6kb / min), 72℃10min, and stored at 4℃. Add 1-3μL DMT enzyme to the obtained PCR product for digestion, mix well, and incubate at 37℃ for 1h. After purifying the obtained DMT enzyme digestion product using a PCR product purification kit, take 2-5μL and add it to 50μL JM109 competent cells for transformation. Select the positive transformants, preliminarily identify them by colony PCR, and screen the correct transformant JM109-argA after sequencing by the company. fbr .

[0077] Extraction of transformant JM109-argA fbr Plasmid pRSFDuet1-argA fbr According to the above-mentioned "4. Gene integration expression plan", the gene fragment argA fbr Integrate into the knockout strain S1-△argR to construct strain S1-argA fbr ΔArgR, named S2, for subsequent studies.

[0078] The production of S2 arginine was verified by shake flask culture, and the arginine concentration in the shake flask supernatant was measured to be 8.6 g / L.

[0079] Example 3: Enhanced expression of key enzymes in pathways

[0080] The present invention utilizes a strong promoter trc to replace its natural promoter, strengthen its expression, and promote the synthesis of arginine metabolic flux. Wherein, the trc promoter (sequence: SEQ ID NO.187: 5'-TTGACAATTAATCATCCGGCTCGTATAATG-3') is derived from the pTrc99a plasmid. The aspartate kinase encoded by the lysC gene catalyzes the phosphorylation of aspartate, and the aspartate semialdehyde dehydrogenase encoded by the asd gene catalyzes the phosphorylated aspartate to generate aspartate semialdehyde. In order to enhance the enzyme activity and metabolic flux of the metabolic pathway, the strong promoter trc is utilized to replace its natural promoter, strengthen its expression, and accumulate more target products.

[0081] Using S2 as the starting bacterium, the key enzymes of the synthesis pathway, lysC (the accession number of the amino acid sequence on NCBI is WP_004936686.1), asd (the accession number of the amino acid sequence on NCBI is TEW88852.1), argA (the accession number of the amino acid sequence on NCBI is ALE97678.1), argH (the accession number of the amino acid sequence on NCBI is TEW89265.1) and speA (the accession number of the amino acid sequence on NCBI is TEW85704.1) were further enhanced, and the natural promoter of the gene was replaced by the strong trc promoter to obtain the engineered bacterium S2-P. trc lysC-P trc asd-P trc argA-P trc argH-P trc speA strain.

[0082] The specific process is as follows:

[0083] According to the lysC of Serratia marcescens HBQA in NCBI, Primer Premier5 was used to design the relevant fragment primers (Table 5). Using the Serratia marcescens HBQA genome as a template and lysC-KZ-F / R as primers, PCR amplified the target gene fragment lysC, and added restriction sites EcoRI and HindⅢ in the upstream and downstream, respectively, and purified the PCR fragment. The pTrc99a plasmid was double-digested with EcoRI and HindⅢ, the digested plasmid was purified, and the purified lysC fragment was connected and transformed into E.coli JM109 competent cells, and the positive transformants were selected. Colony PCR and sequencing were performed using the verification primer lysC-99a-YZ-F / R to verify its correctness. The successfully transformed plasmid pTrc-lysC was extracted and used as a template. BamHI-trc-lysC-F and trc-lysC-SacI-R were used as primers to amplify the target fragment trc-lysC sequence, which was verified to be about 1398bp by gel running and purified. The T19 vector plasmid was double-digested with BamHI and SacI enzymes, and after purification, it was connected and transformed with the trc-lysC fragment. The verification primers trc-lysC-T19-YZF / YZR were used for colony PCR and company sequencing to verify the correct positive transformant T19-trc-lysC. Using the lysC genome in Serratia marcescens HBQA as a template, lysC-LA-ApaI and EcoRI-lysC-LA were used as primers to amplify the left arm fragment LA, and lysC-RA-KpnI and SalI-lysC-RA were used as primers to amplify the right arm fragment RA. After purification, the fragments were connected to the left and right arms of the double-enzyme-digested and purified plasmid T19-trc-lysC, respectively. The verification primers lysC-LA-YZ-F and lysC-LA-YA-R, lysC-RA-YZ-F and lysC-RA-YA-R were used to perform colony PCR for preliminary verification, and the fragments were sent to the company for sequencing to find the plasmid T19-LA-trc-lysC-RA that correctly connected the left and right arms. The plasmid T19-LA-trc-lysC-RA with the left arm and the right arm connected was extracted and used as a template. LysC-LA-ApaI and SalI-lysC-RA were used as primers to amplify the target fragment LA-trc-lysC-RA with a size of about 3700 bp. After the PCR product was purified, the restriction endonuclease DpnI was used to eliminate the template effect.The product after enzyme digestion is further purified and transferred into S2-PKD46 (the homologous recombinase expression plasmid PKD46 is extracted using a plasmid extraction kit, and after purification, it is transformed into competent cells S2 to construct S2-PKD46). In competent cells, positive transformants are screened on resistance plates using the carnamycin resistance marker. To verify whether recombination occurs, primers lysC-YZ-F and lysC-YZ-R can amplify a fragment of about 1000 bp, otherwise, no fragment should be amplified. At the same time, the corresponding PCR verification bacteria are spotted on ampicillin sodium plates. Determine the correct transformant S2-PKD46 (kana. R ). To eliminate carnamycin resistance, S2-PKD46 (kana R ) competent cells, and the pCP20 plasmid was transformed into S2-PKD46 (kana R ) After the competent state, the resistance-eliminated transformants were screened using non-resistant plates and resistant plates, and the transformants were identified by colony PCR. The transformants S2-P that replaced the lysC gene promoter and eliminated resistance were screened. trc lysC.

[0084] According to the above method, the promoters of genes asd, argA, argH and speA were replaced in sequence. trc lysC-P trc asd-P trc argA-P trc argH-P trc speA, and named it S3. The primers used are shown in Table 5 below:

[0085] Table 5 Primer sequences (SEQ ID NO.19~108)

[0086]

[0087]

[0088]

[0089] The production of S3 spermidine was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 16.3 g / L.

[0090] Example 4: Enhanced transport pathways

[0091] PotABCD is a transporter protein that Serratia marcescens absorbs spermidine into cells, so it is knocked out; since the PotABCD protein is composed of four subunits encoded by the gene cluster potA, potB, potC, and potD genes, potA encodes the ATP binding subunit to provide necessary energy for transport, potB encodes the ABC transport membrane subunit PotB, potC encodes the ABC transport membrane subunit PotC, and potD encodes the ABC transport protein periplasmic binding protein, the four genes of the operon are necessary for the correct expression of the operon function, and the deletion of any one gene will inevitably lead to the inactivation of the function, therefore, the ATP binding subunit potA (the accession number of the amino acid sequence on NCBI is TEW94582.1) is deleted in the present invention, the ability of the transferred protein to transport spermidine is weakened, and a strain with improved transport pathway is constructed on the basis of S3. PotA is knocked out according to the method of Red homologous recombination in Example 2 to obtain strain S3-△PotA. MdtJI (amino acid sequence accession numbers TEW81964.1 and TEW81965.1 on NCBI) is a protein that transports spermidine out of cells of Serratia marcescens and is encoded by a gene cluster consisting of the gene clusters mdtJ and mdtI. Therefore, it was enhanced by using the strong trc promoter. According to the method described in Example 2, the promoter was replaced to obtain the strain S3-ΔPotA-P with improved transport pathway. trc MdtJI and named it S4.

[0092] Table 6 Primer sequences (SEQ ID NO.109~136)

[0093]

[0094]

[0095] The production of S4 spermidine was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 21.4 g / L.

[0096] Example 5: Weakening competition approach

[0097] (1) Homoserine competition pathway:

[0098] The intermediate substance aspartate semialdehyde is further converted into homoserine by homoserine synthase encoded by thrA (amino acid sequence accession number on NCBI is TEW91726.1) and metL (amino acid sequence accession number on NCBI is ALE98426.1). In order to eliminate the shunt of the competitive metabolic pathway, the thrA and metL genes were deleted based on strain S4 by Red homologous recombination according to the method described in Example 2 to construct strain S4-△thrA△metL. The obtained strain was named S5-1.

[0099] (2) Lys competition pathway:

[0100] The dihydropicolinate synthase encoded by the dapA gene (the amino acid sequence is accession number TEW94959.1 on NCBI) converts the intermediate substance aspartate semialdehyde into dihydropicolinate. In order to weaken the influence of this branch pathway and allow more aspartate to flow into the metabolic pathway of aspartate semialdehyde synthesis, the strain S4-△thrA△metL was constructed by knocking out the gene dapA using the Red homologous recombination method based on the strain S4-△thrA△metL△dapA according to the method described in Example 1. The obtained strain was named S5-2.

[0101] (3) Glu has a competitive pathway: glutamate kinase encoded by proB and glutamate semialdehyde dehydrogenase encoded by proA form glutamate semialdehyde, which can be spontaneously converted to pyrroline-5-carboxylic acid, which is converted to proline (Pro) by pyrroline 5-carboxylic acid reductase encoded by proC (the amino acid sequence accession number on NCBI is ALE97888.1). Therefore, in order to prevent the metabolic flow of the competitive pathway, we will delete the gene proC to weaken the pathway. According to the method described in Example 2, based on the strain S4△thrA△metL△dapA, the expression of the competitive pathway gene proC was deleted by the Red homologous recombination method to construct the strain S4△thrA△metL△dapA△proC. The obtained strain was named S5-3.

[0102] The required primers are shown in Table 7 below.

[0103] Table 7 Primer sequences (SEQ ID NO.137-176)

[0104]

[0105]

[0106]

[0107] The production of spermidine of S5-1, S5-2 and S5-3 was verified by shake flask culture. The result showed that the production of spermidine in the supernatant of S5-3 was the highest, with a spermidine concentration of 23.3 g / L.

[0108] Example 6: Knockout of key enzymes in the degradation pathway

[0109] There are two pathways for the utilization and degradation of Arg (competitive pathway): (1) Arg is degraded to N by arginine N-succinyltransferase encoded by the astA gene (the amino acid sequence accession number at NCBI is TEW83071.1). 2-Succinylarginine is further degraded into L-Glu and succinate by the ast series of genes. In order to reduce the degradation of Arg, we weakened the Arg degradation pathway, that is, deleted the astA gene.

[0110] According to the method described in Example 2, strain S5-3 was used as the starting strain of the metabolic pathway, and the gene astA was deleted by Red homologous recombination to prevent further degradation of Arg and allow more metabolic flux to flow to the synthesis of spermidine, thereby obtaining strain S5-3ΔastA, which was named S6. The required primers are shown in Table 8:

[0111] Table 8 Primer sequences (SEQ ID NO.177-186)

[0112] Primer Name Sequence 5’-3’ SEQ ApaI-LA-astA <![CDATA[CGCGCGGATCTTCCAGAGATT GGGCCC GGCCAAAAAACTGATCGAC]]> NO.177 astA-LA-EcoRI <![CDATA[AAGCTTGACGTCCAGGTGCCT CTTAAG AATGCGAACCTCTTCTGAATCA]]> NO.178 KpnI-RA-astA <![CDATA[CACGCTAGCGGATCCGAGCTC GGTACC GTGCTCCCCCTTATTGCACA]]> NO.179 astA-RA-SalI <![CDATA[CGTGCGGACGGCAAGCTGCTA CAGCT ACCACCCCGCCCATGAA]]> NO.180 LA-YZ-F tgaattagaactcggtacgcgcgga NO.181 LA-YZ-R tagagaataggaacttcgaactgca NO.182 RA-YZ-F aacttcgaagcagctccagcctaca NO.183 RA-YZ-R atgattacgccaagtttgcacgcct NO.184 astA-YZ-F GTCCCGGTTTATGCCCCT NO.185 astA-YZ-R cgccctgagtgcttgcggcagcgtg NO.186

[0113] The production of S6 spermidine was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 26.8 g / L.

[0114] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. An engineered bacterium of Serratia marcescens, characterized in that: The engineering bacteria express exogenous carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine urea hydrolase.

2. The engineered bacteria according to claim 1, characterized in that The engineered bacteria knock out the gene encoding the repressor protein argR and construct an argA negative feedback mutant.

3. The engineered bacteria according to claim 1, characterized in that The engineered bacteria utilizes a strong promoter to replace the natural promoters of the gene lysC encoding aspartate kinase, the gene asd encoding aspartate semialdehyde dehydrogenase, the gene argA encoding N-acetylglutamate synthetase, the gene argH encoding arginine succinate lyase, and the gene speA encoding arginine decarboxylase.

4. The engineered bacteria according to claim 2, characterized in that The engineered bacteria utilizes a strong promoter to replace the natural promoters of the gene lysC encoding aspartate kinase, the gene asd encoding aspartate semialdehyde dehydrogenase, the gene argA encoding N-acetylglutamate synthetase, the gene argH encoding arginine succinate lyase, and the gene speA encoding arginine decarboxylase.

5. The engineered bacteria according to any one of claims 1 to 4, characterized in that The engineered bacteria knock out the gene encoding the transporter PotA, or enhance the expression of the transporter MdtJI that transfers spermidine to the extracellular space on the basis of knocking out the gene encoding the transporter PotA.

6. The engineered bacteria according to any one of claims 1 to 4, characterized in that The engineered bacteria also have thrA and metL genes encoding homoserine synthase knocked out; or, based on the knockout of thrA and metL genes, the dapA gene encoding dihydropicolinate synthase is further knocked out; or, based on the knockout of thrA, metL, dapA genes, the proC encoding pyrroline 5-carboxylate reductase is further knocked out.

7. The engineered bacteria according to any one of claims 1 to 6, characterized in that The engineered bacteria knock out the astA gene encoding arginine N-succinyltransferase.

8. An engineered strain of Serratia marcescens according to any one of claims 3 to 7, characterized in that: The strong promoter is the trc promoter.

9. Use of an engineered bacterium of Serratia marcescens according to any one of claims 1 to 4 in producing spermidine.

10. Use of an engineered bacterium of Serratia marcescens according to any one of claims 5 to 7 in producing spermidine.

Images