Streptomyces mobaraensis for overexpressing chitosanase

Abstract

The invention discloses streptomyces mobaraensis for overexpressing chitosanase, and belongs to the technical field of genetic engineering. According to the invention, smCsn46 is integrated near a high expression site tg of streptomyces mobaraensis through a CRISPR (clustered regularly interspaced short palindromic repeats) technology, a recombinant strain smY2022-delta tg-smCsn46 is constructed and obtained, and the enzyme activity of the strain can reach 5.52 U / mL after the strain is fermented for 48 hours. The invention also verifies the enzymatic properties of smCsn46, and provides the application of the smCsn46 in the aspect of hydrolysis preparation of chitosan oligosaccharide of DP 2-6, thereby laying a theoretical foundation for the application of the smCsn46 in different fields.

Description

Technical Field

[0001] The invention relates to a chitosanase-overexpressing streptomyces mobara, belonging to the technical field of genetic engineering. Background Art

[0002] Chitosanase (Csn, EC: 3.2.1.132) is a class of glycohydrolases that can specifically catalyze the cleavage of β-1,4-glycosidic bonds in chitosan to form chitooligosaccharides (COS) or glucosamine (GlcN). Chitosan is a linear polysaccharide, a biopolymer of D-glucosamine (GlcN) linked by β-1,4-glycosidic bonds generated by partial deacetylation of chitin. In the carbohydrate database (CAZy), Csn belonging to glycoside hydrolases (GH) are divided into six types according to sequence similarity, namely GH3, GH5, GH8, GH46, GH75, and GH80. According to the current literature statistical data analysis, Csn from GH46 has been widely characterized, mainly from bacteria, especially Streptomyces and Bacillus. Chitosanase is widely used. It can be used to produce chitooligosaccharides with different polymerization degrees, marine biological waste treatment, plant disease prevention and control, gene delivery, etc. Its product COS has multiple biological activities, such as antiviral, antimicrobial and antitumor.

[0003] Compared with the traditional use of acid and alkali to treat chitosan, enzymatic production has attracted more attention due to its advantages such as environmental protection, high specificity and controllability of the final product. However, the existing chitosanase cannot meet the requirements of industrial production, and new high-yield strains need to be explored. Csn is widely distributed in nature, mainly in microorganisms and plant tissues, and can be extracted from fungi, bacteria and even viruses. Most of the characterized Csn are derived from bacteria, and mainly from Bacillus and Streptomyces. Chitosanase from Streptomyces sp.N174 and Streptomyces griseus HUT 6037 have been expressed and characterized in Pichia pastoris. Although Streptomyces is the main source of chitosanase and a favorable candidate host for chitosanase expression, the expression level is very low. Sujata et al. isolated a chitosanase high-yield strain Streptomyces sp. (no.6) from the soil, with an enzyme activity of 6U / mL, which is the maximum value reported in Streptomyces. Mariana et al. expressed CsnA from Streptomyces coelicolorA3(2) in Streptomyces lividans TK24, but the enzyme activity was only 0.461 U / mL. Therefore, it is necessary to develop new chitosanase and achieve efficient enzyme expression. Summary of the invention

[0004] The invention provides an engineered strain of Streptomyces maoyuanensis expressing chitosanase, which expresses a chitosanase encoding gene smCsn46 shown in SEQ ID NO:2.

[0005] In one embodiment, the engineered Streptomyces mobaraensis strain is based on Streptomyces mobaraensis smY2022-Δtg as a starting strain; the Streptomyces mobaraensis mY2022-Δtg is disclosed in "Efficient Production of a Thermostable Mutant of Transglutaminase by Streptomyces mobaraensis".

[0006] In one embodiment, the chitosanase encoding gene smCsn46 is integrated and expressed in the 399 bp regulatory sequence upstream of the tg site promoter on the Streptomyces mobaraensis smY2022-Δtg genome.

[0007] In one embodiment, the engineered Streptomyces mobaraensis strain is based on the above-mentioned Streptomyces mobaraensis smY2022-Δtg as a chassis cell, and a chitosanase expression frame is integrated 399 bp upstream of the promoter at the tg site on the genome.

[0008] In one embodiment, the expression cassette contains a promoter, a signal peptide and a chitosanase encoding gene smCsn46.

[0009] In one embodiment, the nucleotide sequence of the expression cassette is shown in SEQ ID NO:3.

[0010] In one embodiment, the nucleotide sequence of 399 bp upstream of the tg site promoter is shown in SEQ ID NO:4.

[0011] The present invention also provides a microbial agent containing the engineered Streptomyces mobaraensis smY2022-Δtg-smCsn46.

[0012] In one embodiment, the mass of spores of Streptomyces mobaraensis smY2022-Δtg-smCsn46 in the microbial agent is ≥ 8% of the total mass of the microbial agent.

[0013] The present invention also provides the use of the engineered Streptomyces mobaraensis smY2022-Δtg-smCsn46 or the microbial preparation in preparing chitosanase.

[0014] In one embodiment, the application is to ferment the Streptomyces mobaraensis smY2022-Δtg-smCsn46 or the microbial preparation in a culture medium to obtain a fermentation supernatant containing chitosanase.

[0015] In one embodiment, the fermentation is carried out at 28-30°C and 200-250 rpm.

[0016] In one embodiment, the fermentation is carried out at 30°C and 220 rpm in a shaking incubator.

[0017] The present invention also provides the use of the recombinant Streptomyces mobaraensis in preparing chitosanase.

[0018] The present invention also provides the use of the Mobara Streptomyces smY2022-Δtg-smCsn46 or the microbial agent in preparing chitosan oligosaccharides.

[0019] In one embodiment, the application is to ferment the Streptomyces mobaraensis smY2022-Δtg-smCsn46 or the microbial agent to prepare chitosanase, and then use the chitosanase as a catalyst for preparing chitosan.

[0020] Beneficial effects:

[0021] The present invention identifies the chitosanase gene from Streptomyces mobara, and integrates and expresses it at a high expression site (TGase site) in the original host through CRISPR technology, obtaining the recombinant strain smY2022-Δtg-smCsn46, and the enzyme activity is as high as 5.52U / mL after 48h of shake flask fermentation. smCsn46 was treated in an acidic environment for 2h, and the residual enzyme activity was higher than 70%; its optimal reaction was 50°C, and after being treated at 50°C and below for 2h, the enzyme activity was almost unchanged, and the thermal stability was good. The present invention produces chitosan oligosaccharides of DP 2-6 by enzymatic hydrolysis reaction, and the degree of polymerization of the product decreases as the hydrolysis time is prolonged, which is expected to become a powerful tool for producing chitosan oligosaccharides. The present invention uses CRISPR technology to achieve gene integration and traceless editing, which is more conducive to industrial production applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 For smCsn46 sequence analysis.

[0023] Figure 2 Schematic diagram of the construction process of recombinant smY2022-Δtg-smCsn46.

[0024] Figure 3Fermentation curves and SDS-PAGE analysis diagrams of smY2022-Δtg and smY2022-Δtg-smCsn46; wherein, (a) is the fermentation curves of smY2022-Δtg and smY2022-Δtg-smCsn46; (b) is the SDS-PAGE analysis diagram of smY2022-Δtg; (c) is the SDS-PAGE analysis diagram of smY2022-Δtg-smCsn46.

[0025] Figure 4 Graph showing the enzymatic properties of smCsn46; wherein, (a) is the relative enzyme activity of smCsn46 at different reaction temperatures; (b) is the temperature stability of smCsn46; (c) is the relative enzyme activity of smCsn46 at different reaction pHs; and (d) is the pH stability of smCsn46.

[0026] Figure 5 This is the analysis diagram of the hydrolysis products of smCsn46. DETAILED DESCRIPTION

[0027] The detection methods involved in the following embodiments are as follows:

[0028] The chitosanase activity was determined by:

[0029] In a 5mL centrifuge tube, add 350μL of colloidal chitosan (concentration of 10g / L, chitosan with a deacetylation degree of 95% (Yuanye, Shanghai) was dissolved with 1M glacial acetic acid, and then the pH was adjusted to 5.5 with 1M sodium acetate), 50μL of sample, and react at 50℃ for 15 minutes. After the reaction, immediately add 600μL of DNS solution and boil in water for 5 minutes to develop color. Finally, add 3mL of ddH2O to dilute and measure the absorbance at 520nm. The enzyme activity unit (U) is defined as the amount of enzyme required to produce 1μmol of reducing sugar per minute under the above-mentioned measurement conditions (GlcN is used as a standard).

[0030] Determination of specific enzyme activity:

[0031] The specific enzyme activity assay is to dilute the purified enzyme solution to 0.4-0.6 mg / mL with MES buffer (50 mM, pH 6.0), measure the enzyme activity and protein concentration, and calculate the specific enzyme activity parameters.

[0032] Detection and identification of smCsn46 hydrolysis products:

[0033] The purified enzyme solution (final concentration of 8U / mL) was added to 10g / L colloidal chitosan, and reacted at 50℃ for 30min, 1h, 2h, 4h, and 8h, respectively, and then boiled for 10min to inactivate. Centrifuged at 10000g for 10min, the supernatant was taken and filtered with a 0.22μm filter membrane. The degree of polymerization of the product was analyzed on a high performance liquid chromatography (Shimadzu) using an Asahipak NH2P-50 4E column (4.6mm ID×250mm). The mobile phase was acetonitrile / H2O (70:30, v / v), the flow rate was 1mL / min, the column temperature was 30℃, and the detector was a differential refractometer.

[0034] The primer sequences involved in the following examples are shown in Table 1.

[0035] Table 1. Primer sequences

[0036]

[0037]

[0038] Note: The underlined sequences are homologous sequences cloned in one step.

[0039] The culture medium and fermentation conditions involved in the following examples are as follows:

[0040] GYM solid medium: 10g / L glucose, 4g / L yeast extract, 3g / L malt extract, 20g / L agar powder;

[0041] Basic fermentation medium: 20g / L glycerol, 20g / L peptone, 5g / L yeast extract, 20g / L soybean powder, 4g / L K2HPO4, 2g / L KH2PO4, 2g / L CaCO3, 2g / L MgSO4;

[0042] Seed medium: 20 g / L glycerol, 20 g / L peptone, 5 g / L yeast extract, 2 g / L K2HPO4, 2 g / LMgSO4, pH 7.2;

[0043] Fish meal fermentation medium: 20g / L glycerol, 75g / L fish meal peptone, 5g / L yeast extract, 5.5g / L corn syrup powder, 5.5g / L ammonium sulfate, 2g / L MgSO4, 2g / L K2HPO4, pH 7.0-7.2.

[0044] The fermentation conditions of Streptomyces mobara involved in the following examples are:

[0045] The Streptomyces mobara strain was first cultured on a GYM solid plate at 30°C for 4-5 days, spores and hyphae were scraped into a shake flask containing 30 mL of seed culture medium using an inoculation loop, and cultured in a shaker at 30°C and 220 rpm for 24 hours to obtain a Streptomyces mobara seed solution; the seed solution was inoculated into a shake flask containing 30 mL of fish meal fermentation medium at an inoculation rate of 8%, and fermented at 30°C and 220 rpm.

[0046] Example 1 smCsn46 sequence analysis

[0047] Based on the identification of extracellular highly expressed proteins of S. mobaraensis DSM40587, chitosanase was confirmed to be an extracellular highly expressed protein. According to the sequencing results of the S. mobaraensis DSM40587 genome, there is only one chitosanase sequence in the genome. The smCsn46 signal peptide sequence was predicted using SignalP-4.1 (SignalP 4.1-DTU Health Tech-Bioinformatic Services), and it was found that there was a signal peptide cleavage site between positions 37 and 38. At the same time, other GH46 family chitosanases from Streptomyces in the CAZy database were input into SignalP-4.1 to remove the signal peptide. The amino acid sequences after removing the signal peptide were imported into clustalW (https: / / www.genome.jp / tools-bin / clustalw) for comparison and visualized using ENDscript / ESPript (http: / / espript.ibcp.fr / ESPript / cgi-bin / ESPript.cgi). By comparison, it was found that smCsn46 (Genbank accession number: UBI35095.1) contained the conserved catalytic sites E77 and D95 ​​shared by the chitosanase of the GH46 family, and the sequence similarity was very high ( Figure 1 ). Afterwards, SWISS-MODEL (http: / / swissmodel.expasy.org / ) was used to model and predict its tertiary structure, and compared with chitosanase from Streptomyces p.N174. The tertiary structures of the two chitosanases were very similar, with an RMSD value of only 0.635 ( Figure 1 ).

[0048] Example 2 Construction of recombinant Streptomyces mobara strains

[0049] Streptomyces mobaraensis is the main producer of TGase, and the TGase site is the site with the highest known expression level in smY2022. Therefore, the chitosanase gene was integrated into the tg site instead of the TGase expression cassette.

[0050] The specific steps are as follows:

[0051] (1) Construction of an expression cassette containing the TGase expression vector on the pSET152 plasmid

[0052] Using the whole genome of Streptomyces mobaraensis DSM40587 as a template, the TGase expression frame containing the promoter, signal peptide, TGase open reading frame and terminator was amplified by PCR using primers 152tg-F / 152tg-R (152tg-F: GGGCTGCAGGTCGACTCTAGGTGGTGTTGCCGGGGAGTTAACT GGGA, 152tg-R: ATCGCGCGCGGCCGCGGATCGGTGGGGAGGGGAGCCGGATGCTC).

[0053] The upstream and downstream homologous sequences were connected to the Xbal site of the vector pSET152 using a one-step cloning method to obtain the plasmid pSET152-tg containing the TGase expression cassette (SEQ ID NO: 1).

[0054] TGase expression cassette:

[0055]

[0056] Note: The underline is the promoter region, the wavy line is the signal peptide region, and the double underline is the terminator region.

[0057] Using the whole genome of Streptomyces mobaraensis DSM40587 as a template, primers 152-csn-F / 152-csn-R (152-csn-F: CGGCCACCGGCAGTGGCAGTGCGTCCGCGGCCCCCGCCT C, 152-csn-R: GCTTACACTAGTGGTGGTGGTGGTGGTGGTGCTCGTCGATGCGGTACGCGTCGC CGTA) were used to amplify smCsn46 without its own signal peptide, a total of 771 bp (SEQ ID NO: 2). At the same time, primers 152-F / 152-R (152-F: CCACCACTAGTGTAAGCGGGGAGGGGAGGGGAGG, 152-R: ACTGCCA CTGCCGGTGGCCGC) were used to amplify the pSET152-tg vector fragment with only the TGase expression element (promoter, signal peptide, terminator).

[0058] The smCsn46 fragment was ligated to the vector fragment by one-step cloning to obtain plasmid pSET152-smCsn46.

[0059] smCsn46 sequence: gcgtccgcggcccccgcctccgcccccgcgtcggccctccgcataccggcggccaccgcggccgggctggaggacccgcacaagaaggacatcgccatgcggctcgtctgcagcgcggagaactcctcgctggagtggcgccggtacttcgactacatcgagccctacgacgacggccgcggctacaccggcggcatcatcggcttcacctcgggcaccggcgacatgctgaaactggtcgaggagtacaccaagaagaagcccggcaacccgctcgcgcccttcctgcccgcgctgcgcaaggccaacgggtccgacacccacgccggcctcggcaagcccttcgaggaggcgtggcacaaggccgcccgggacaaggcgttccaggacgcgcaggaggacctgcgcgaccgcatgtacttcgacccggccgtcaggcaggcgaaggaggacgggctgcgcaccctcggccagttcgtctactacgacgcgatggtgatgcacggccccggtgacggcaaggacagcttcggcggcatccgcaaggccgcgctcaagaaggccaaaccgccggcgcgcggcggggacgagaaggcgtacctcgacgcgttcctcgacgcccgcaagaaggtgatgaaggccgagaaggcgcacagcgacaccagccggatcgacatggcccagcgcgtcttcctgaacgacggcaacttcgacctggagccgccgctcaagtggaaggtgtacggcgacgcgtaccgcatcgacgagtag。

[0060] (2) Construction of integration vector

[0061] The linearized plasmid pCRISPomyces-2-2 was digested with BpsI, and the gRNA was annealed at 95°C with primers 300fwT7sense / 300fwT7antisense (300fwT7sense: ACGCCGACCCTGCTGCGTCGATGA, 300fwT7antisense: AAACTCATCGACGCAGCAGGGTCG) at 0.1°C / s, and then connected with Solution I (Takala, Code No. 6022Q) at 16°C overnight to obtain the plasmid pCRISPomyces-sgRNA.

[0062] The plasmid pSET152-smCsn46 constructed above was used as a template to amplify the smCsn46 expression cassette using primers CSN-F / CSN-R (CSN-F: CGACGGGCCACGAGCTGTAGGGTGGGAGGGGAGCCGGATGCT; CSN-R: ACATCTGACGGACGGATTGTGGTGTTGCCGGGGAGTTAACTGGGAGAC). The smCsn46 expression cassette sequence is:

[0063]

[0064]

[0065] Among them, the underline is the promoter region, the wavy line is the signal peptide region, and the double underline is the terminator region.

[0066] Again, the whole genome of Streptomyces mobaraensis DSM40587 was used as a template, and primers R1000-F / R1000-R and L1000-F / L1000-R were used to amplify the upstream regulatory gene (SEQ ID NO:4) of the tg site and the upstream and downstream homologous sequences of about 1000 bp (SEQ ID NO:5 and SEQ ID NO:6). The three fragments (smCsn46 expression frame, homology arm R1000, homology arm L1000) were connected to the XbaI site of pCRISPomyces-sgRNA by a one-step cloning method to obtain the plasmid pCRISPomyces-smCsn46.

[0067] (3) Integration vector construction

[0068] The plasmid pCRISPomyces-smCsn46 was transformed into smY2022-Δtg (the strain was disclosed in the paper "Efficient Production of a Thermostable Mutant of Transglutaminase by Streptomyces mobaraensis") and cultured for more than 7 days. PCR verification was performed using primers ver-F / ver-R to obtain the recombinant strain smY2022-Δtg-smCsn46.

[0069] Example 3 Fermentation of chitosanase by recombinant bacteria smY 2022-Δtg-smCsn46

[0070] Spores and mycelium of Streptomyces mobaraensis smY 2022-Δtg-smCsn46 were scraped with an inoculation loop and transferred into a shake flask containing 30 mL of seed culture medium, and cultured at 30° C. and 220 rpm for 24 h to obtain seed solution.

[0071] The seed solution was inoculated into a shake flask containing 30 mL of fish meal fermentation medium at an inoculum of 8% (v / v), and fermented at 30°C and 220 rpm for 96 hours, with samples taken every 12 hours. The obtained samples were centrifuged at 10,000 r / min for 10 minutes, and the supernatant was taken to determine the chitosanase (smCsn46) enzyme activity.

[0072] The results showed that compared with the original strain, the SDS-PAGE band at 32 kDa of the recombinant strain was significantly darker ( Figure 3 After 48 h of fermentation, smY 2022-Δtg-smCsn46 reached 5.52 U / mL ( Figure 3 ).

[0073] Example 4 Purification of chitosanase smCsn46

[0074] The supernatant of the strain smY2022-smCsn46 of Example 3 was collected after fermentation for 48 h and HisTrap was used to TM FF purification (MES buffer 50mM pH 6), and then desalting using an ultrafiltration tube. The obtained enzyme protein was collected and tested, and the specific enzyme activity was 37.19U / mg.

[0075] Example 5 Determination of the optimum temperature and temperature stability of chitosanase smCsn46

[0076] Preparation of seed solution: Spores and mycelium of Streptomyces mobaraensis smY 2022-Δtg-smCsn46 constructed in Example 3 were scraped with an inoculating loop and transferred into a shake flask containing 30 mL of seed culture medium and cultured at 30° C. and 220 rpm for 24 h.

[0077] Fermentation of Streptomyces mobaraensis smY 2022-Δtg-smCsn46 to produce enzymes: The seed solution prepared in step (1) was inoculated into a shake flask containing 30 mL of fish meal fermentation medium at an inoculum volume of 8% (v / v), and fermented at 30°C and 220 rpm. After fermentation for 48 h, the supernatant was collected and filtered through a 0.22 μm filter membrane using a HisTrap TM FF was purified and desalted using ultrafiltration tubes.

[0078] Optimum temperature determination: According to the steps of the enzyme activity determination method, the enzyme activity of the purified and diluted enzyme solution was determined at pH 5.5 and 30-80°C. The enzyme activity at 50°C and pH 5.5 was taken as 100%, and the relative enzyme activity at each temperature was calculated.

[0079] Temperature stability determination: Incubate the purified diluted enzyme solution at different temperatures for 0 to 120 min, take samples every 30 min to determine the enzyme activity, take the enzyme activity at 0 min incubation as 100%, determine the enzyme activity according to the steps of the enzyme activity determination method, and calculate the relative enzyme activity of samples with different incubation times.

[0080] The results show that Figure 4 ), the optimal reaction temperature of smCsn46 was 50°C, and the enzyme activity hardly decreased after incubation for 2 h below 50°C.

[0081] Example 6 Determination of the optimal reaction pH and optimal pH of chitosanase smCsn46

[0082] Optimum pH determination: According to the steps of the enzyme activity determination method, the enzyme activity in different pH environments was determined at 50°C, wherein acetic acid-sodium acetate buffer (200 mM) was used for pH 3-6, MES buffer (200 mM) was used for pH 6-7, and Tris-HCl buffer (200 mM) was used for pH 7-9, and the highest point was 100%.

[0083] pH stability determination: The purified smCsn46 was incubated in buffers of different pH values ​​for 120 min, and then the enzyme activity was determined according to the steps of the enzyme activity determination method. The enzyme activity at the highest point was taken as 100%, and the residual enzyme activity was calculated.

[0084] The results show that Figure 4 ), the optimum pH of chitosanase smCsn46 is 5.5, the enzyme is relatively stable in an acidic environment (pH < 7), and the residual enzyme activity is higher than 70% after incubation for 2 hours.

[0085] Example 7 Preparation of chitosan oligosaccharides by enzymatic hydrolysis of chitosan

[0086] Purified enzyme solution was prepared according to the method of Example 4, and 500 μL of enzyme solution with an enzyme activity of 8 U / mL was added to 3.5 mL of 10 g / L colloidal chitosan, and hydrolyzed for different time periods. The results showed that the hydrolysis products of smCsn46 were mainly chitosan oligosaccharides with a degree of polymerization (DP) of 2-6, and the yield of oligosaccharides increased with the extension of hydrolysis time ( Figure 5 ).

[0087] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. An engineered strain of Streptomyces mobaraensis expressing chitosanase, characterized in that: The chitosanase encoding gene smCsn46 shown in SEQ ID NO: 2 was expressed.

2. The Maoyuan Streptomyces engineered bacterium according to claim 1, characterized in that: Streptomyces mobaraensis smY2022-Δtg was used as the starting strain.

3. The Maoyuan Streptomyces engineered bacterium according to claim 1 or 2, characterized in that: The chitosanase encoding gene smCsn46 is integrated into the 399 bp region upstream of the promoter of the tg site on the genome of the Streptomyces mobaraensis.

4. The Maoyuan Streptomyces engineered bacterium according to claim 1 or 2, characterized in that: The Maoyuan Streptomyces engineered bacteria is based on Maoyuan Streptomyces smY2022-Δtg as a chassis cell, and a chitosanase expression frame is integrated into the 399 bp region upstream of the promoter at the tg site of the genome; The expression cassette contains a promoter, a signal peptide and a chitosanase encoding gene smCsn46.

5. The Maoyuan Streptomyces engineered bacterium according to claim 4, characterized in that: The nucleotide sequence of the expression cassette is shown in SEQ ID NO:

3.

6. A microbial agent containing the engineered bacterium of Streptomyces Mobara according to any one of claims 1 to 5.

7. Use of the engineered bacteria of Streptomyces mobaraensis according to any one of claims 1 to 5 or the microbial preparation according to claim 6 in the preparation of chitosanase.

8. A method for preparing chitosanase, characterized in that: The engineered bacteria of Streptomyces mobara described in any one of claims 1 to 5 or the microbial preparation described in claim 6 is fermented in a culture medium, and the chitosanase in the fermentation liquid is collected.

9. The method according to claim 8, characterized in that The fermentation is carried out at 28-30°C and 200-250 rpm.

10. Use of the engineered bacterium Streptomyces mobara according to any one of claims 1 to 5 in the preparation of chitosanase.

Images