Streptomyces mobaraensis with high yield of phospholipase D

Abstract

The invention discloses streptomyces mobaraensis with high yield of phospholipase D, and belongs to the technical field of gene engineering. According to the invention, 1-2 copies of phospholipase D genes are integrated on a genome through a CRISPR-Cas9 technology, so that the expression quantity of phospholipase D is improved. The phospholipase D hydrolytic activity of the constructed recombinant strain smYS1-PLD2 can reach 244.66 U / mL, phospholipase D can be efficiently produced, antibiotics do not need to be added, and a theoretical basis is laid for efficient expression of other genes in streptomyces mobaraensis.

Description

Technical Field

[0001] The invention relates to a strain of Streptomyces mobaraensis capable of producing high amounts of phospholipase D, belonging to the technical field of genetic engineering. Background Art

[0002] Phospholipase D (EC 3.1.4.4, PLD) can catalyze the conversion of cheap substrate phospholipids (PC) into rare phospholipids with high economic benefits, such as phosphatidylserine (PS), phosphatidylethanolamine (PE), and phosphatidylglycerol (PG). Among them, PS is called "brain vitamin" and has the effects of preventing Alzheimer's disease, improving children's ADHD, and improving memory. At present, rare phospholipids are mainly extracted from animals and plants, especially soybeans and egg yolks, but the composition of natural phospholipids is complex and often composed of a variety of phospholipids with similar physical properties, among which the content of PS is relatively low. In order to obtain high-purity PS, a large amount of organic solution is required for extraction, and the yield is low. In order to overcome these limitations, safer, more economical and efficient methods are needed to produce PS, such as enzyme conversion. The enzyme conversion method has the advantages of mild reaction conditions, easy controllable reaction, high efficiency and simplicity, and is receiving more and more attention.

[0003] PLD genes are widely present in nature and have different physiological functions. Among them, PLD from Streptomyces has been widely studied due to its rich gene sources, wide substrate selectivity, high conversion rate and other advantages. At present, PLD has been successfully expressed in multiple strains, such as E. coli, Bacillus subtilis, Streptomyces lividans, Brevibacillus choshinensis, but the expression hosts are still limited, and most of them are expressed in the form of inclusion bodies, which limits its application in the food industry. Therefore, it is urgent to develop more PLD efficient expression hosts. Summary of the invention

[0004] The present invention provides a PLD gene expression cassette having a nucleotide sequence shown in SEQ ID NO:1.

[0005] The present invention also provides an engineered bacterium of Streptomyces mobaraensis expressing phospholipase D, wherein the coding gene of the phospholipase D is shown in SEQ ID NO:2.

[0006] In one embodiment, the starting strain of Streptomyces mobaraensis is Streptomyces mobaraensis smY2022, which has been disclosed in the paper "Efficient Production of a Thermostable Mutant of Transglutaminase by Streptomyces mobaraensis".

[0007] In one embodiment, the engineered strain of Streptomyces mobara has multiple copies of the PLD gene expression cassette integrated into it.

[0008] In one embodiment, the engineered strain of Streptomyces mobara is integrated with the PLD gene expression cassette at the chi site and / or the tg site.

[0009] The invention also provides a fermentation agent containing the engineered bacteria of Streptomyces mobaraensis.

[0010] The present invention also provides a method for constructing the engineered bacteria of Streptomyces mobara, comprising:

[0011] (1) Connect approximately 1000 bp of upstream and downstream homologous sequences of the tg gene, the promoter gapdhp, and the gene pld to the pCRISPR vector to obtain the plasmid pCRISPR-pld;

[0012] (2) Transform the plasmid pCRISPR-pld into smY2022 using the conjugative transfer method;

[0013] (3) The chi gene upstream and downstream homologous sequences (approximately 1000 bp each) and the PLD expression frame were connected to the pCRISPR vector to obtain the plasmid pCRISPR-chi::pld, which was then transformed into smY2022-PLD by conjugative transfer to obtain the recombinant strain smYS1-PLD2.

[0014] The invention also provides the use of the Streptomyces mobaraensis engineered bacteria in preparing phospholipase D.

[0015] In one embodiment, the application is to culture the engineered Streptomyces mobara in a fish meal fermentation medium at 30-37° C. for 24-72 hours.

[0016] Beneficial effects: The present invention integrates the phospholipase D gene at the tg and / or chi sites of the genome through CRISPR-Cas9 technology, thereby increasing the expression of phospholipase D. Under the mediation of the strong promoter gapdhp, the recombinant strain smY2022-PLD2 constructed by integrating PLD at the tg site and the chi site simultaneously increased by 26% and 31% compared with the integration at the tg site (194.29U / mL) and the integration at the chi site (187.20U / mL), respectively, and the hydrolysis activity of secreted expression of PLD reached 244.66U / mL. The strain of the present invention is a food safety strain, and no antibiotics need to be added during the fermentation process, and has a wide range of application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of the construction of smY2022-PLD1.

[0018] Figure 2 Schematic diagram of the construction of smY2022-PLD2.

[0019] Figure 3 Schematic diagram of the construction of smY2022-Δtg.

[0020] Figure 4 PCR validation diagram of smY2022-Δtg, smY2022-PLD1 and smY2022-PLD2.

[0021] Figure 5 SDS-PAGE analysis of smY2022-Δtg, smY2022-PLD1 and smY2022-PLD2.

[0022] Figure 6 SDS-PAGE analysis of purified PLD.

[0023] Figure 7 Analysis of the enzymatic properties of PLD. DETAILED DESCRIPTION

[0024] The detection methods involved in the following embodiments are as follows:

[0025] Determination method of hydrolysis activity of PLD:

[0026] 150μL of substrate solution (10mM PC, 5% TritonX-100 (w / v)) was mixed with 150μL of substrate buffer (0.2MTris-HCl pH 7.5, 5% TritonX-100 (w / v), 0.01M CaCl2) and incubated at 50℃ for 5min. 100μL of enzyme solution diluted to an appropriate concentration was added, and after reacting at 50℃ for 10min, 200μL of stop solution (1M Tris-HCl pH8.0, 0.5M EDTA) was immediately added and heated in a 100℃ metal bath for 15min to terminate the reaction. After returning to room temperature, 200μL of color development solution (0.1M Tris-HCl pH 8.0, 5mM 4-ATT, 8mM phenol) and 1U peroxidase and 1U choline oxidase were added. After color development at 37℃ for 60min, A500nm was measured after dilution of 1:8. During the standard curve drawing process, the enzyme solution was replaced by the choline chloride standard solution, and the other experimental steps were the same. The hydrolysis activity (U) of phospholipase D was defined as the amount of enzyme required to catalyze the substrate PC to generate 1 μmol of choline per minute under the optimal reaction conditions of the enzyme.

[0027] Purification and desalting of PLD:

[0028] The supernatant of the recombinant strain smY2022-PLD was collected after fermentation for 72 hours, purified by nickel column affinity chromatography, desalted by ultrafiltration tube, and the enzymatic properties were determined.

[0029] Determination of optimal reaction temperature and temperature stability:

[0030] The optimal reaction temperature is to measure the hydrolysis activity of PLD at different temperatures, and take the highest hydrolysis activity as 100% to calculate the relative enzyme activity at different temperatures. Temperature stability is to incubate the enzyme solution at different temperatures, measure the residual enzyme activity at different incubation times, and take the enzyme activity at 0 min as 100% to calculate the relative enzyme activity of samples at different incubation times.

[0031] Determination of optimal pH and pH stability:

[0032] The optimum pH is to measure the hydrolysis activity of PLD under substrate buffer conditions of different pH values, and take the highest hydrolysis activity as 100% to calculate the relative enzyme activity under different pH values. The pH stability is to store PLD in buffers of different pH values, measure the residual enzyme activity at different storage times, and take the enzyme activity at 0 min as 100% to calculate the relative enzyme activity of samples at different storage times.

[0033] The primer sequences involved in the above examples are shown in Table 1.

[0034] Table 1 Primer sequences

[0035]

[0036] Note: Lowercase letters represent homologous sequences cloned in one step.

[0037] The culture medium and fermentation conditions involved in the following examples are as follows:

[0038] GYM solid medium: 10g / L glucose, 4g / L yeast extract, 3g / L malt extract, 20g / L agar powder;

[0039] Seed culture medium: 20 g / L glycerol, 20 g / L peptone, 5 g / L yeast extract, 2 g / L K2HPO4, 2 g / LMgSO4, pH 7.2.

[0040] Fish meal fermentation medium: 20g / L glycerol, 75g / L fish meal peptone hydrolyzate, 5g / L yeast extract, 5.5g / L corn syrup powder, 5.5g / L ammonium sulfate, 2g / L MgSO4, 2g / L K2HPO4, pH 7.0-7.2.

[0041] The fermentation conditions of Streptomyces mobara involved in the following examples are:

[0042] The Streptomyces mobara strain was cultured on a GYM solid plate at 30°C for 4-5 days, spores and hyphae were scraped with an inoculation loop into a shake flask containing 30 mL of seed culture medium, and cultured in a shaker at 30°C and 220 rpm for 24 h to obtain a Streptomyces mobara seed solution; the seed solution was inoculated into a shake flask containing 30 mL of fish meal fermentation medium at an inoculum rate of 8%, and fermented at 30°C and 220 rpm. Example 1: Construction of a recombinant Streptomyces mobara strain

[0043] (1) Construction of PLD recombinant strain smY2022-PLD1

[0044] The whole genome of Streptomyces mobaraensis smY2022 (published in the paper "Efficient Production of a ThermostableMutant of Transglutaminase by Streptomyces mobaraensis") was used as a template, and primers TG-FF / FR (TG-FF:cgggcgttttttatctagCACGTACAGGTACGACGGTGGTGGC; TG-FR:atctgaaaggggatacgcC CCGATCACTCGTCCGGGAGTCGAG) and TG-RF / RR (TG-RF:GCGTATCCCCTTTCAGATACTCGCACTAAG; TG-RR:GCTGCTCCTTCGGTCGGA CGTGCGT) were used to PCR amplify the upstream and downstream homologous sequences of the tg gene (shown in SEQ ID NO: 8) about 1000 bp each (SEQ ID NO: 3 and SEQ ID NO: 4), gapdh-F / R amplified promoter gapdhp (gapdh-F: tccgaccgaaggagcagCGGCTCCAAAACCGGCCACTCCGTCA; gapdh-R: acggttcctggcct ctagCCACATCGACCGCGACGTCGACTAC), PLD-F / R amplifies the target gene pld (PLD-F:ccgtccttccgggcccccGCGTCCCCGACCCCCCACCTGGATTCG; PLD-R:atggtgatggtgatggtgGGCTTGGCACAGGCCGCGGGCGTAG).

[0045] The above fragments were connected to the pCRISPR vector using a one-step cloning method to obtain the plasmid pCRISPR-pld. The plasmid pCRISPR-pld was transformed into smY2022 using the conjugative transfer method, and PCR verification was performed using primers Dver-F / R (Dver-F: GGTCTCCGGGATTTGTTCGCATGCC; Dver-R: CATCCTCATGTTCGAACCCACGGGC) ( Figure 4 ) to obtain the recombinant strain smY2022-PLD1 integrated with the gene expression cassette of PLD (SEQ ID NO: 1).

[0046] The gene expression cassette sequence of PLD is as follows:

[0047] gctgctccttcggtcggacgtgcgtctacgggcaccttaccgcagccgtcggctgtgcgacacggacg gatcgggcgaactggccgatgctg

[0048] ggagaagcgcgctgctgtacggcgcgcaccgggtgcggagcccctcggcgagcggtgtgaaacttctg tgaatggcctgttcggttgcttttttt

[0049] atacggctgccagataaggcttgcagcatctgggcggctaccgctatgatcggggcgttcctgcaatt cttagtgcgagtatctgaaaggggata

[0050] cgc CCCGATCACTCGTCCGGGAGTCGAGAAGTGTTACGCCGAACCCCATTCCGCACCATC

[0051] ACCCCTGCCGCCGTGACCGCGGCCGGCAGTCTGCCTCTCGCCGAGAGAGCCACCCGGA

[0052]

[0053] The underline is the promoter sequence; the wavy underline is the signal peptide sequence; the dotted underline is the PLD sequence; the double wavy underline is the His tag; and the double underline is the terminator sequence.

[0054] (2) Construction of PLD recombinant strain smY2022-PLD2

[0055] Using the whole genome of Streptomyces mobaraensis as a template, primers Chi-FF / FR (Chi-FF: tcgacctgcagcccaagcACGGAACTCCGTTCCTGATAAGGCG; Chi-FR: cgggcgttttttatctagCGAGAACCACGCGTTGCGTTCGTC) and Chi-RF / RR (Chi-RF: gatatcgaattcgtaatcGTACCGCATCGACGAGTAGCGCGTC; Chi-RR: acggttcctggcctctagCCGGAGCTGACCTGGTCCGACCTG) were used to PCR amplify about 1000 bp of upstream and downstream homologous sequences of the chi gene (SEQ ID NO: 7) (SEQ ID NO: 5 and SEQ ID NO: 6), and whole-F / R was used to amplify the PLD expression cassette (whole-F: GCTTGGGCTGCAGGTCGACTCTAGA; whole-R: GATTACGAATTCGATATCGCGCGCGG). The above fragment was connected to the pCRISPR vector by a one-step cloning method to obtain the plasmid pCRISPR-chi::pld. The plasmid pCRISPR-chi::pld was transformed into the strain smY2022-PLD1 constructed in step (1) by the conjugative transfer method, and PCR verification was performed using primers Dver-chi-F / R (Dver-chi-F: GGGAAGCAGCAGCACAAATGGCACGA; Dver-chi-R: GTCCTCGGCCAGGAACACATGGCCG) ( Figure 4 ) to obtain the recombinant strain smY2022-PLD2 in which the gene sequence of chi (SEQ ID NO:7) was replaced by the PLD gene expression cassette sequence (SEQ ID NO:1).

[0056] (3) Construction of the tg deletion strain smY2022-Δtg

[0057] Using the whole genome of Streptomyces mobaraensis (S. mobaraensis DSM40587) as a template, primers dtg-FF / FR (dtg-FF:gccgggcgttttttatctagCCGGTTGTGGGAGAAATCCGGCCGC; dtg-FR:TCGGCTCTACAGCTCGTGGCCCGTC) and dtg-RF / RR (dtg-RF:cacgagctgtagagccgaGGCTCCAAAACCGGCCACTCCGTCA; dtg-RR:ttacggttc ctggcctctagCATCGGCACCACGACCCTCACCGTC) were used to PCR amplify about 1000 bp of upstream and downstream homologous sequences of the tg gene, respectively. The above fragments were connected to the pCRISPR vector using a one-step cloning method to obtain the plasmid pCRISPR-Δtg. The plasmid pCRISPR-Δtg was transformed into smY2022 by conjugative transfer, and PCR verification was performed using primers Dver-F / R (Dver-F: GGTCTCCGGGATTTGTTCGCATGCC; Dver-R: CATCCTCATGTTCGAACCCACGG GC) ( Figure 4 ) to obtain the recombinant strain smYS1-Δtg.

[0058] Example 2: Fermentation of recombinant Streptomyces mobara strains to produce phospholipase D

[0059] The recombinant strains smY2022-PLD1 and smY2022-PLD2 constructed in Example 1 were subjected to shake flask fermentation, and the specific steps were as follows:

[0060] Spores and mycelium of Streptomyces mobaraensis smY2022-PLD1 and smY2022-PLD2 were scraped into a shake flask containing 30 mL of seed culture medium using an inoculation loop, and cultured in a shaker at 30° C. and 220 rpm for 24 h to obtain a seed solution of Streptomyces mobaraensis.

[0061] The seed solution was inoculated into a shake flask containing 30 mL of fish meal fermentation medium at an inoculation rate of 8% (v / v), and fermented at 30° C. and 220 rpm. The fermented solution was centrifuged at 10,000 r / min for 5 min, and the supernatant was taken to detect the PLD hydrolysis activity.

[0062] The results showed that after 72 hours of fermentation, the hydrolase activity of the recombinant strain smY2022-PLD1 reached 194.28U / mL, and the hydrolase activity of the recombinant strain smYS1-PLD2 reached 244.66U / mL, while the PLD hydrolysis activity of the control strain smY2022-Δtg was almost undetectable.

[0063] Example 3: Purification of phospholipase D

[0064] (1) Spores and mycelium of Streptomyces mobaraensis smY2022-PLD1 were scraped with an inoculating loop into a shake flask containing 30 mL of seed culture medium, and cultured in a shaker at 30° C. and 220 rpm for 24 h to obtain a seed solution of Streptomyces mobaraensis.

[0065] (2) The seed solution was inoculated into a shake flask containing 30 mL of fish meal fermentation medium at an inoculum rate of 8% (v / v), and fermented at 30°C and 220 rpm. After smY2022-PLD1 was fermented for 72 h, the fermentation broth was centrifuged at 10,000 r / min for 10 min, and the supernatant was collected. The supernatant was purified by nickel column affinity chromatography, desalted by ultrafiltration tube, and the enzymatic properties were determined.

[0066] The results show that ( Figure 6 ), the PLD band obtained after purification was single and the protein concentration was in line with expectations (about 54 kDa).

[0067] Example 4: Determination of enzymatic properties of phospholipase D

[0068] (1) Determination of optimum temperature: The enzyme solution prepared in Example 2 was diluted to an appropriate multiple with Tris-HCl buffer (20 mM pH 7.5), and reacted at 30-80°C for 10 minutes. The enzyme activity at different temperatures was measured, and the relative enzyme activity was calculated with the highest enzyme activity (50°C) as 100%.

[0069] (2) Temperature stability determination: The enzyme solution prepared in Example 2 was incubated at 30-60° C. for 4 hours at different times. Samples were taken every hour and the enzyme activity after incubation was measured. The relative enzyme activity was calculated with the enzyme activity before incubation as 100%.

[0070] (3) Determination of optimum pH: The enzyme solution prepared in Example 2 was reacted in substrate buffers of different pH values ​​(0.2 M phosphate buffer (pH 4-10), 5% Triton X-100 (w / v)) at 50°C for 10 min, and the enzyme activity at different pH values ​​was measured. The relative enzyme activity was calculated with the highest enzyme activity (pH 7.5) as 100%.

[0071] (4) Determination of pH stability: The enzyme solution prepared in Example 2 was incubated in buffer solutions of different pH values ​​(0.2 M phosphate buffer solution, pH 4-10) for 4 hours. Samples were taken every hour and the enzyme activity after incubation was measured. The relative enzyme activity was calculated with the enzyme activity before incubation being taken as 100%.

[0072] The results show that ( Figure 7), the optimum temperature of the recombinant protein is 50°C, at which temperature it still retains 65.0% of its hydrolysis activity after incubation for 1 hour, and 28.7% of its hydrolysis activity after incubation for 4 hours, its optimum pH is 7.5, and it exhibits good stability between pH 5.0-8.0, with the relative enzyme activity remaining above 66.8% after incubation for 1 hour, and above 28.4% after incubation for 4 hours.

[0073] Comparative Example:

[0074] The specific implementation method is the same as Example 1, except that the PLD gene expression cassette is integrated only at the chi site of the genome of Streptomyces smY2022. Fermentation was carried out according to the method of Example 2. The results showed that the enzyme activity at the same fermentation time was 187.20 U / mL.

[0075] The above comparison results show that the recombinant strain smY2022-PLD2 constructed by integrating PLD at both the tg site and the chi site increased the hydrolysis activity of secreted expressed PLD by 26% and 31% respectively compared with single-point integration at the tg site (194.29 U / mL) and integration at the chi site (187.20 U / mL).

[0076] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A phospholipase D gene expression cassette, characterized in that: It has the nucleotide sequence shown in SEQ ID NO:

1.

2. An engineered bacterium of Streptomyces mobaraensis expressing phospholipase D, characterized in that: The amino acid sequence of the phospholipase D is shown in SEQ ID NO:

9.

3. The engineered Streptomyces mobaraensis according to claim 2, characterized in that The phospholipase D gene shown in SEQ ID NO: 2 was integrated and expressed.

4. The engineered Streptomyces mobaraensis according to claim 2 or 3, characterized in that The PLD gene expression frame is integrated into multiple copies of the engineered bacteria of Streptomyces mobara.

5. The engineered bacterium of Streptomyces mobara according to claim 4, characterized in that The engineered bacteria of Streptomyces mobara are integrated with the PLD gene expression frame at the chi site and / or the tg site.

6. The engineered bacterium of Streptomyces mobara according to any one of claims 2 to 5, characterized in that The starting strain of Streptomyces mobaraensis is Streptomyces mobaraensis smY2022.

7. A starter culture containing the engineered bacteria of Streptomyces Mobara according to any one of claims 2 to 6.

8. A method for preparing phospholipase D, characterized in that: The engineered strain of Streptomyces mobara described in any one of claims 2 to 6 is cultured in a culture medium, and the phospholipase D in the fermentation broth is collected.

9. The method according to claim 8, characterized in that The engineered Streptomyces mobaraensis is cultured in a fish meal fermentation medium at 30-37° C. for 24-72 hours.

10. Use of the engineered bacterium Streptomyces mobara according to any one of claims 2 to 6 in the preparation of phospholipase D.

Images