Saccharopolyspora spinosa engineering strain with high DNA conversion efficiency as well as construction method and application of saccharopolyspora spinosa engineering strain

Abstract

The invention belongs to the technical field of engineering bacterium modification, and particularly relates to a saccharopolyspora spinosa engineering strain with high DNA (deoxyribonucleic acid) conversion efficiency as well as a construction method and application of the saccharopolyspora spinosa engineering strain, the saccharopolyspora spinosa engineering strain takes saccharopolyspora spinosa Sas001 as a starting bacterium to destroy an endogenous methylation restriction modification (RM) system of the saccharopolyspora spinosa, and the RM system is any one or a combination of RM2, RM5 and RM7. The saccharopolyspora spinosa engineering strain provided by the invention solves the problem of difficulty in DNA (deoxyribonucleic acid) transformation of the saccharopolyspora spinosa, the strain with remarkably improved spinosad yield is obtained, and an important foundation is laid for subsequent construction of high-yield industrial strains easy to transform.

Description

Technical Field

[0001] The invention belongs to the technical field of engineering bacteria transformation, and specifically relates to an engineering strain of Saccharopolyspora spinosa with high conversion efficiency, a construction method and application thereof. Background Art

[0002] Actinomycetes are a type of microorganism with important industrial application value, especially in the field of producing natural product drugs. Actinomycetes can produce a variety of bioactive substances, such as antibiotics, enzyme inhibitors, immunosuppressants, etc. Among them, antibiotics are one of the most important natural products produced by actinomycetes and are a valuable resource library for new drug research and development. However, in practical applications, industrial strains of actinomycetes generally have the following two problems: 1) Difficulty in genetic manipulation: Genetic manipulation of actinomycetes is more complicated than that of other microorganisms. One of the important reasons is that they have a variety of natural defense mechanisms. 2) Low fermentation yield: There is a lack of efficient high-yield breeding technology, a shortage of high-yield strains, and low fermentation yield. This has greatly limited the progress of natural product drug research and development from actinomycetes.

[0003] Spinosad is a type of macrolide antibiotic produced by fermentation of Saccharopolyspora spinosa. It has high efficiency, broad-spectrum insecticidal effects, very low mammalian toxicity and excellent environmental friendliness. It is widely used in agriculture and animal husbandry. It is an outstanding representative of green agricultural antibiotics and has extremely high market value. However, genetic manipulation of Saccharopolyspora spinosa is extremely difficult, and the production level of spinosad is low.

[0004] In order to overcome these limitations and improve the industrial production level of spinosad, it is urgent to construct a strain with simple genetic manipulation and high fermentation yield. Summary of the invention

[0005] The main purpose of the present invention is to solve the problem of difficult DNA transformation of Saccharopolyspora spinosa, thereby laying an important technical foundation for the genetic manipulation and high-yield transformation of spinosad.

[0006] In a first aspect, the present invention provides an engineered strain of Saccharopolyspora spinosa with high DNA conversion efficiency, which adopts the following technical scheme:

[0007] An engineered strain of Saccharopolyspora spinosa with high DNA conversion efficiency, using Saccharopolyspora spinosa Sas001 as a starting bacterium, destroying the endogenous RM system of Saccharopolyspora spinosa, wherein the RM system is any one or a combination of RM2, RM5, and RM7. The Sas001 strain is derived from the wild-type strain DSM44228; first, the spnK gene in the DSM44228 spinosad synthesis gene cluster is knocked out by a traditional homologous recombination strategy to obtain a spinosad J and L producing strain, and then after 3 rounds of ultraviolet mutagenesis screening, the engineered strain Sas001 is obtained, which is classified and named: Saccharopolyspora spinosa, which was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on December 2, 2024, with a deposit number of CGMCC No. 32886, and a deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] The methylation restriction modification (RM) system, referred to as the RM system, is a variety of natural defense mechanisms possessed by Saccharopolyspora spinosa. The inventors speculate that the complex RM system in the genome of Saccharopolyspora spinosa may be one of the important reasons why the bacteria are extremely difficult to genetically transform. The RM system hinders the transformation of exogenous DNA, thereby limiting the introduction of exogenous genes, making genetic manipulation very difficult. Moreover, the RM system not only affects the efficiency of genetic transformation, but may also have an important impact on the physiological metabolism of cells, including the biosynthetic pathway of antibiotics, because the epigenetic modification of the genome by methylases can significantly affect the expression of certain functions or regulatory genes, thereby directly or indirectly affecting the biosynthetic efficiency of antibiotics.

[0009] Therefore, the present invention analyzed 10 endogenous RM systems of Saccharopolyspora spinosa, and knocked them out one by one, and systematically identified their effects on the genetic transformation efficiency of Saccharopolyspora spinosa. The results showed that three groups of RM systems (RM2, RM5, and RM7) had an important influence on the conjugation transfer efficiency and the fermentation yield of spinosad of the bacterium. The combined knockout of the three groups of RM systems greatly solved the problem of low DNA transformation efficiency of Saccharopolyspora spinosa, and obtained strains with significantly improved spinosad production, laying an important foundation for the subsequent construction of high-yield industrial strains that are easy to transform.

[0010] Preferably, the RM system is a free combination of any two of RM2, RM5, and RM7.

[0011] Preferably, the RM system is a combination of RM2, RM5 and RM7.

[0012] The second aspect of the present invention provides a method for constructing an engineered strain of Saccharopolyspora spinosa with high DNA conversion efficiency. The method uses Saccharopolyspora spinosa Sas001 as a starting strain and destroys the RM system in the Saccharopolyspora spinosa genome. The RM system is any one or a combination of RM2, RM5, and RM7.

[0013] Preferably, the disruption is to destroy the RM system of the Saccharopolyspora spinosa genome by means of gene knockout, interruption inactivation or inhibition.

[0014] Specifically, the RM system of the Saccharopolyspora spinosa genome is destroyed by gene knockout, comprising the following steps:

[0015] S1. Construction of gene knockout plasmid based on endogenous CRISPR-Cas;

[0016] S2. The gene knockout plasmid is introduced into the starting bacteria Saccharopolyspora spinosa, and the engineered strain of Saccharopolyspora spinosa is obtained by colony PCR combined with DNA sequencing identification.

[0017] Preferably, in step S1, the spacer sequence targeting the RM2 system used to construct the gene knockout plasmid based on endogenous CRISPR-Cas is obtained by annealing the following two primers.

[0018] RM2-gF(5′-3′):caacgctggtggatggacaaccggcacgatctga, as shown in SEQ ID NO:4.

[0019] RM2-gR(5′-3′):ggactcagatcgtgccggttgtccatccaccagc, as shown in SEQ ID NO:5.

[0020] Preferably, in step S1, the spacer sequence targeting the RM5 system used to construct the gene knockout plasmid based on endogenous CRISPR-Cas is obtained by annealing the following two primers.

[0021] RM5-gF(5′-3′):caactccttgaagcagatgcggtcgagtggcttc, as shown in SEQ ID NO:6.

[0022] RM5-gR(5′-3′): ggacgaagccactcgaccgcatctgcttcaagga, as shown in SEQ ID NO:7.

[0023] Preferably, in step S1, the spacer sequence targeting the RM7 system used to construct the gene knockout plasmid based on endogenous CRISPR-Cas is obtained by annealing the following two primers.

[0024] RM7-gF(5′-3′):caacccgaggcggtgcgccggttctgcgagaagc, as shown in SEQ ID NO:8.

[0025] RM7-gR(5′-3′): ggacgcttctcgcagaaccggcgcaccgcctcgg, as shown in SEQ ID NO:9.

[0026] The third aspect of the present invention provides the use of the above-mentioned engineered strain of Saccharopolyspora spinosa with high transformation efficiency, which is used to improve the genetic transformation efficiency of Saccharopolyspora spinosa or for fermentation production of spinosad.

[0027] By implementing the above technical solution, compared with the prior art, the present invention has the following beneficial effects:

[0028] The present invention knocks out the three RM systems RM2, RM5 and RM7 of Saccharopolyspora spinosa one by one or in combination, thereby solving the difficult problem of DNA transformation of Saccharopolyspora spinosa, and obtaining a strain with significantly improved spinosad production, laying an important foundation for the subsequent construction of a high-yield industrial strain that is easy to transform. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is an analysis of the RM system in Saccharopolyspora spinosa and the electrophoresis verification and sequencing verification of the PCR products of the corresponding deletion mutant colonies. Among them, A is based on the Rebase website and Blast analysis, it was found that the Saccharopolyspora spinosa genome contains 10 possible RM systems and their possible identifiable nucleotide sequences. B is based on the gene knockout technology of the endogenous CRISPR-Cas system to knock out each RM system separately, and the knocked-out colonies are PCR verified. If the knockout is successful, the length of the amplified target band is smaller than that of the control strain Sas001. C is the bands amplified by PCR for each deletion mutant strain, which are verified by Sanger sequencing.

[0030] Figure 2 The effect of RM system deletion on the conjugation transfer efficiency and fermentation yield of Saccharopolyspora spinosa. A is the comparison of the conjugation transfer efficiency of different RM deletion mutants and the control starting strain Sas001. B is the spinosad fermentation yield of the combined deletion strain Sas301, which is significantly higher than that of the starting strain.

[0031] Figure 3Flowchart for editing plasmid construction. In which, ori represents the replicon, oriT is the element for conjugative transfer, aprR is the apramycin resistance gene, crRNA gene It represents the spacer sequence for different genes, HU and HD represent the upstream and downstream homology arms, GOI (gene of interest) represents the target gene, and IF and IR represent the identification primers used for colony PCR. DETAILED DESCRIPTION

[0032] The following is a description of the implementation of the present invention by specific embodiments. People familiar with the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0033] Example 1

[0034] Construction of single deletion mutants targeting 10 different RM systems

[0035] This study first conducted statistical analysis based on the Rebase website (http: / / rebase.neb.com / rebase / rebase.html) and bioinformatics methods such as Blast, and found that the genome of Saccharopolyspora spinosa contains 10 possible RM systems, including 3 type I (A8926_0983 / 84, A8926_1903 / 04 / 05, A8926_1948 / 49), 5 type II (A8926_1701 / 04, A8926_1725 / 26, A8926_1892, A8926_2652 / 53, A8926_6786 / 87 / 88 / 89), and 2 type IV RM systems (A8926_1894, A8926_2462). And named RM1, RM2, RM3, RM4, RM5, RM6, RM7, RM8, RM9, RM10 ( Figure 1 A in Figure 1). The complex RM system in the genome of Saccharopolyspora spinosa may be one of the important reasons why this bacterium is extremely difficult to genetically transform.

[0036] Using the genome editing technology based on the endogenous type I CRISPR-Cas system established in Saccharopolyspora spinosa in the early stage, we knocked out 10 RM systems respectively, where the A8926_1903 gene sequence in the RM2 system used in this embodiment is shown in SEQ ID NO: 1, the A8926_1726 gene sequence in the RM5 system is shown in SEQ ID NO: 2, and the A8926_2652 gene sequence in the RM7 system is shown in SEQ ID NO: 3. The construction of the knockout plasmid can refer to the previously applied patent (Construction and application of editing vector based on the endogenous CRISPR-Cas system of Saccharopolyspora spinosa, application number 202310015439.0).

[0037] Specifically, first, the miniCRISPR module, J23119-Repeat-2×BbsI-Repeat, was prepared by chemical synthesis and used as a template for PCR amplification using primers SP-mini-F / R. The PCR product was cloned into the BamHI and EcoRI sites on the pSP01 vector using the ExnaseII one-step cloning kit to generate the pSP-miniCRISPR plasmid ( Figure 3 ).

[0038] Subsequently, the obtained pSP-miniCRISPR plasmid was digested by type II restriction endonuclease BbsI.

[0039] Next, crRNAs targeting each RM system were designed and synthesized using CCG as PAM, i.e., two single-stranded oligonucleotide primers containing 34 nucleotides ( Table 1 ), the primer sequences including the sticky ends of 4 bases paired with the vector after BbsI digestion and the 30-nucleotide spacer sequence targeting the specific gene, annealed to form double-stranded DNA, and inserted between the two Repeat sequences of pSP-miniCRISPR, thereby obtaining the targeting plasmid pSP-crRNA RMn (n=1-10), i.e. 10 targeting plasmids pSP-crRNA RM1 , pSP-crRNA RM2 , pSP-crRNA RM3 , pSP-crRNA RM4 , pSP-crRNA RM5 , pSP-crRNA RM6 , pSP-crRNA RM7 , pSP-crRNA RM8 , pSP-crRNA RM9 , pSP-crRNA RM10 The 10 targeting plasmids were linearized by EcoRV digestion for later use.

[0040] Table 1 Primer sequences used in this example

[0041]

[0042]

[0043]

[0044] Then, the upstream and downstream regions of each RM gene to be knocked out were selected as homology arms. Primers RM n Up-F / R、RM n Down-F / R (Table 1), the upstream and downstream homology arms were obtained by PCR amplification (n=1-10, representing the homology arm amplification primers for 10 different RM systems such as RM1-10, respectively). The forward primer of the upstream homology arm and the reverse primer of the downstream homology arm were connected using the overlapping PCR method.

[0045] Finally, the linearized targeting plasmid was recombined with the corresponding upstream and downstream homology arms to obtain 10 knockout plasmids pSP-crRNA RM1 -HA1, pSP-crRNA RM2 -HA2, pSP-crRNA RM3 -HA3, pSP-crRNA RM4 -HA4, pSP-crRNA RM5 -HA5, pSP-crRNA RM6 -HA6, pSP-crRNA RM7 -HA7, pSP-crRNA RM8 -HA8, pSP-crRNA RM9 -HA9, pSP-crRNA RM10 -HA 10 ( Figure 3 ).

[0046] The above 10 knockout plasmids were introduced into Saccharopolyspora spinosa Sas001 by conjugation transfer between Escherichia coli and Saccharopolyspora spinosa, cultured at 30°C for 8-10 days, and the conjugates were picked and streaked on 2cmc plates containing apramycin and nalidixic acid for verification. Saccharopolyspora spinosa that could grow on double-resistant plates were selected for colony PCR, and the obtained PCR products were analyzed by agarose gel electrophoresis, and Sanger sequencing was used to verify whether the target gene was successfully knocked out.

[0047] Compared with the starting strain, the length of the PCR amplification band of the successfully knocked-out colony will be shorter. The results showed that the knock-out efficiency of the 10 RM systems can reach 100% ( Figure 1 B).

[0048] The PCR amplification bands of the successfully knocked-out colonies were sequenced and verified to confirm that the target gene was deleted ( Figure 1 C).

[0049] In order to eliminate the plasmid, the successfully knocked-out Saccharopolyspora spinosa colonies were selected and streaked on 2cmc agar plates without apramycin. After three passages, due to the random distribution of plasmids during cell division, the plasmids were gradually lost due to the additional metabolic burden caused by the plasmids when antibiotic screening pressure was not added. The colonies that could grow on the non-resistant plates but could not grow on the apramycin-resistant plates were selected for expansion culture, and finally 10 deletion mutants ΔRM1, ΔRM2, ΔRM3, ΔRM4, ΔRM5, ΔRM6, ΔRM7, ΔRM8, ΔRM9, and ΔRM10 were obtained.

[0050] Example 2

[0051] Effect of RM single deletion mutant on conjugative transfer efficiency

[0052] The above 10 mutants were used as starting strains, and the free plasmid pSP01 was transformed into Escherichia coli S17-1 as the donor bacteria for the conjugation transfer efficiency test, and then the test plasmid was transformed into the recipient bacteria (Saccharopolyspora spinosa starting strain Sas001 and mutant strains lacking different RM systems) by conjugation transfer. The conjugation transfer efficiency of each mutant strain was measured respectively.

[0053] E. coli-Saccharopolyspora conjugation transfer process: Pick a single colony of transformed E. coli S17-1 and inoculate it into liquid LB medium containing apramycin, and culture it on a shaker at 37°C for 3-6 hours until the bacterial solution concentration reaches OD 6000.4-0.5. Centrifuge at 4500rpm for 5min, discard the supernatant after centrifugation, collect Escherichia coli cells, and wash with fresh LB medium to remove antibiotics. Centrifuge at 4500rpm for 5min and repeat the washing twice. At the same time, use 2×YT to wet a sterile cotton swab and collect spores (3-4d) of different strains of freshly grown Saccharopolyspora spinosa on 2cmc plates (2cmc culture medium formula (g / L): soluble starch 10, tryptone 2, sodium chloride 1, (NH4)2SO4 2, dipotassium hydrogen phosphate 1, MgSO4·7H2O 2, Casamino acid 2, trace element solution 1ml, CaCO32, agar 20, adjust pH to 7.2) (Note: trace element solution (g / L): 7-hydrated ferrous sulfate 1, 4-hydrated manganese chloride 1.55, 7-hydrated zinc sulfate 1.75). Then, the spores of Saccharopolyspora spinosa and Escherichia coli were thoroughly mixed, centrifuged at 4500rpm for 5min, the supernatant was discarded, and then mixed again with an appropriate amount of 2×YT solution and evenly spread on a 2cmc solid plate, placed in a 30°C constant temperature incubator for 18-20h, 25μL of nalidixic acid (25mg / mL) and 25μL of apramycin (50mg / mL) were taken in 1mL of sterile water, evenly spread on the conjugation transfer plate, and returned to the 30°C incubator for continued culture for 8-10 days until the conjugants grew.

[0054] The amount of Saccharopolyspora spores during the conjugation transfer process is determined by the dilution plating method. First, take 100 μL of the collected Saccharopolyspora spore suspension, dilute and mix with 900 μL of sterile water, then take 100 μL and dissolve it in 900 μL of sterile water and mix it. Repeat this step six times and perform gradient dilutions in sequence. Take 100 μL of the final diluted spore solution and spread it evenly on a 2 cmc plate. After culturing in a 30°C constant temperature incubator for 3-4 days, count the colonies on the plate and multiply it by the dilution multiple to obtain the number of spores in the original suspension. Conjugation transfer efficiency = number of conjugates appearing on the conjugation transfer plate / total number of spores in the original suspension.

[0055] The results showed that after knocking out RM2, RM5, and RM7, the pSP01 (replicative vector) conjugative transfer efficiency of the deletion strain increased by 1.6, 1.9, and 2.0 times, respectively ( Figure 2 A), indicating that these RM systems play an important role in the defense of Saccharopolyspora spinosa against exogenous DNA.

[0056] Example 3

[0057] Construction of key RM system knockout mutants and their conjugative transfer efficiency and fermentation yield

[0058] In order to further improve the genetic transformation efficiency of Saccharopolyspora spinosa, the three RM systems RM2, RM5, and RM7 that were identified as significantly affecting the conjugation transfer efficiency of the bacteria were knocked out in combination. That is, RM5 was knocked out on the basis of △RM2 to obtain the ΔRM2+5 double knockout strain (named Sas201), and RM7 was further knocked out on the basis of ΔRM2+5, and finally the triple knockout strain ΔRM2+5+7 strain (named Sas301) was obtained. Similarly, the conjugation transfer efficiency of Sas301 was measured, and it was found that its conjugation transfer efficiency was further improved, about 4 times that of the starting strain Sas001 ( Figure 2 A).

[0059] In addition, this example also fermented the starting strain Sas001 and the engineered strain Sas301 with the three RM systems RM2+5+7 knocked out to test the fermentation performance of Sas301.

[0060] First, inoculate the Sas301 colony on a 2 cmc plate and culture it at 28°C for 3 to 4 days. Use an inoculation spatula to pick up about 1 cm 2 The bacteria were inoculated into a 250 ml shake flask containing 25 ml seed culture medium, and cultured in a constant temperature shaker at 220 rpm and 28°C for 3 days; then the seed culture medium was inoculated with 10% of the inoculum amount and transferred to a shake flask containing 30 ml fermentation medium (fermentation medium ingredients, g / L): glucose 9, soluble starch 1, (NH4)2SO4 2, soybean cake powder 4, soybean oil 3, CaCO3 7.2), and cultured in a constant temperature shaker at 220 rpm and 28°C for 10 days. After the fermentation, 200 μL of fermentation liquid was put into an EP tube, 800 μL of anhydrous ethanol was added, and ultrasonic extraction was performed for 30 min. Then, the mixture was centrifuged at 12000 rpm for 10 min. The supernatant was taken and the content of spinosad was determined by high performance liquid chromatography. The chromatographic column was a Hypersil-C18 column, the mobile phase was methanol / acetonitrile / 2% ammonium acetate (45:45:10), the flow rate was 1 mL / min, the column temperature was 40 ° C, and the UV detection wavelength was 246 nm, so as to determine the effect of the lack of the RM system on the fermentation yield of spinosad.

[0061] The experimental results showed that compared with the starting strain Sas001, the fermentation yield of spinosyn (spinosyn J and spinosyn L) of the engineered strain Sas301 increased by about 1.5 times to 905 mg / L ( Figure 2 B).

Claims

1. An engineered strain of Saccharopolyspora spinosa with high DNA conversion efficiency, characterized in that: Sas001 is used as the starting bacterium to destroy the endogenous methylation restriction modification system of Saccharopolyspora spinosa. The RM system is any one or a combination of RM2, RM5, and RM7. The preservation date of Sas001 is December 2, 2024, and the preservation number is CGMCC No.32886.

2. The engineered strain of Saccharopolyspora spinosa according to claim 1, characterized in that The methylation restriction modification system is a free combination of any two of RM2, RM5, and RM7.

3. The engineered strain of Saccharopolyspora spinosa according to claim 1, characterized in that The methylation restriction modification system is a combination of RM2, RM5 and RM7.

4. A method for constructing an engineered strain of Saccharopolyspora spinosa with high DNA conversion efficiency, characterized in that: The method uses Saccharopolyspora spinosa Sas001 as a starting strain to destroy a methylation restriction modification system in the genome of Saccharopolyspora spinosa, wherein the methylation restriction modification system is any one or a combination of RM2, RM5 and RM7.

5. The construction method according to claim 4, characterized in that: The disruption is to destroy the methylation restriction modification system of the Saccharopolyspora spinosa genome by means of gene knockout, interruption inactivation or inhibition.

6. The construction method according to claim 5, characterized in that: Destroying the methylation restriction modification system of Saccharopolyspora spinosa by gene knockout includes the following steps: S1. Construction of gene knockout plasmid based on endogenous CRISPR-Cas; S2. The gene knockout plasmid is introduced into the starting bacteria Saccharopolyspora spinosa, and the engineered strain of Saccharopolyspora spinosa is obtained by colony PCR combined with DNA sequencing identification.

7. The construction method according to claim 6, characterized in that: In step S1, the spacer sequence targeting the RM2 system used to construct the gene knockout plasmid based on endogenous CRISPR-Cas is obtained by annealing the following two primers. RM2-gF(5′-3′): caacgctggtggatggacaaccggcacgatctga, RM2-gR(5′-3′): ggactcagatcgtgccggttgtccatccaccagc.

8. The construction method according to claim 6, characterized in that: In step S1, the spacer sequence targeting the RM5 system used to construct the gene knockout plasmid based on endogenous CRISPR-Cas is obtained by annealing the following two primers. RM5-gF(5′-3′):caactccttgaagcagatgcggtcgagtggcttc, RM5-gR(5′-3′): ggacgaagccactcgaccgcatctgcttcaagga.

9. The construction method according to claim 6, characterized in that: In step S1, the spacer sequence targeting the RM7 system used to construct the gene knockout plasmid based on endogenous CRISPR-Cas is obtained by annealing the following two primers. RM7-gF (5′-3′): caacccgaggcggtgcgccggttctgcgagaagc, RM7-gR (5′-3′): ggacgcttctcgcagaaccggcgcaccgcctcgg.

10. The use of the engineered strain of Saccharopolyspora spinosa according to any one of claims 1 to 4, characterized in that: It is used to improve the DNA transformation efficiency of Saccharopolyspora spinosa or to produce spinosad by fermentation.

Images