Engineering bacterium for producing L-threonine as well as preparation method and application of engineering bacterium

Abstract

The invention relates to an engineering bacterium for producing L-threonine and a preparation method and application of the engineering bacterium, the engineering bacterium deletes a phaCAB gene and an ilvA gene, the engineering bacterium heterologously expresses an aspA gene, an asd gene, an rhtC gene and a ppc gene on a genome, the engineering bacterium overexpresses a thrA gene, a thrB gene and a thrC gene on a plasmid, and a starting strain of the engineering bacterium is Rogowski eutrophy alcaligenes. The engineering bacterium is short in growth cycle, can quickly produce the L-threonine by using carbon dioxide, secretes the L-threonine to the outside of cells, lays a foundation for industrial production of the L-threonine, and has a wide industrial application prospect.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to an engineering bacterium for producing L-threonine, and a preparation method and application thereof. Background Art

[0002] L-Threonine (Thr), molecular formula C4H9NO3, relative molecular weight 119.12, white crystals or crystalline powder, is one of the essential amino acids for the human body. L-Threonine is widely used in many fields such as food, feed, medicine, cosmetics and health products. In the field of food, L-Threonine is widely used as a food enhancer. It can improve the nutritional value of food, relieve fatigue and promote growth and development. In the field of feed, L-Threonine is an important feed additive. It is the second or third largest limiting amino acid in pig feed formula and the third or fourth largest limiting amino acid in poultry feed formula. Adding L-Threonine to feed can not only balance the amino acid composition and promote poultry growth, but also improve nitrogen utilization and reduce feeding costs. In the field of medicine, L-Threonine has the effects of promoting human growth and development, reducing human fatigue and resisting fatty liver, and is also a drug intermediate for the production of highly effective antibiotics such as monobactam. L-Threonine can also promote lymphocyte proliferation, improve human immune function, protect cell membranes, promote fatty acid oxidation, etc.

[0003] CN116622597A discloses a method for constructing an engineered bacterium with high threonine production, wherein strains of aspartate aminotransferase, aspartate kinase, homoserine dehydrogenase, threonine synthase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, and malate / quinone oxidoreductase are combined for L-threonine production by coryneform bacteria (such as Corynebacterium glutamicum), and the L-threonine production of the strain with enhanced expression of the above genes is greatly improved compared with the unmodified strain.

[0004] With the rapid development of human industrialization, excessive CO2 emissions have aggravated the greenhouse effect and increased the frequency of extreme climate events around the world. Serious environmental problems have made people realize the importance of low-carbon economic development. The recycling of CO2 is an important means to establish an environmentally friendly economic development. Compared with Escherichia coli and Corynebacterium glutamicum, the biggest advantage of Alcaligenes ruthenicus rosei is the autotrophic fermentation of fixed CO2. While producing high-value fermentation products, it can reduce carbon emissions in the industrial fermentation process and promote the low-carbon development of the fermentation industry.

[0005] In summary, providing a novel L-threonine producing strain has become one of the problems to be solved urgently in the current field. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides an engineered bacterium for producing L-threonine, a preparation method and application thereof, wherein two genes are knocked out and four genes are integrated by a gene editing method, and three codon-optimized genes are overexpressed by a plasmid, thereby constructing for the first time an Alcaligenes rutheniogens that can produce L-threonine by fermentation using carbon dioxide.

[0007] To achieve this object, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides an engineered bacterium for producing L-threonine, wherein the engineered bacterium lacks the phaCAB gene and the ilvA gene, heterologously expresses the aspA gene, the asd gene, the rhtC gene and the ppc gene in the genome, overexpresses the thrA gene, the thrB gene and the thrC gene on the plasmid, and the starting strain of the engineered bacterium is Cupriavidus necator.

[0009] The present invention knocks out the PHB (poly-3-hydroxybutyrate) synthesis pathway gene (phaCAB gene) and the coding gene of threonine dehydratase (ilvA gene), integrates the coding gene of aspartate ammonia lyase (aspA gene), the coding gene of aspartate semialdehyde dehydrogenase (asd gene), the coding gene of L-threonine export protein (rhtC gene) and the coding gene of phosphoenolpyruvate carboxylase (ppc gene) into the genome, and overexpresses the coding gene of homoserine dehydrogenase (thrA gene), the coding gene of homoserine kinase (thrB gene) and the coding gene of threonine synthetase (thrC gene) on the plasmid.

[0010] The present invention achieves the knockout of 2 genes and the integration of 4 genes by a gene editing method, and overexpresses 3 codon-optimized genes by a plasmid, thereby constructing for the first time a Rhodochia eutropha that can utilize carbon dioxide to produce L-threonine by fermentation. The engineered bacteria has a short growth cycle, can rapidly utilize carbon dioxide to produce L-threonine, and secrete L-threonine outside the cell.

[0011] The present invention selects facultative chemoautotrophic Alcaligenes rosea to carry out metabolic engineering transformation to achieve fermentation conversion of carbon dioxide into threonine using carbon dioxide as a substrate, which not only helps to promote environmental protection and cope with climate change, but also promotes economic development, technological innovation and industrial chain extension, and is an important way to achieve sustainable development.

[0012] Preferably, the aspA gene, asd gene, rhtC gene and ppc gene are derived from Escherichia coli.

[0013] Preferably, the thrA gene, thrB gene and thrC gene are codon optimized.

[0014] The nucleic acid sequences of the thrA gene, thrB gene and thrC gene used in the present invention are derived from a thrA gene point mutation of Escherichia coli, and codon optimization is performed based on the nucleic acid sequence for the expression environment of Alcaligenes eutrophus.

[0015] Preferably, the expression vector of the thrA gene, thrB gene and thrC gene is pBBRMCS2.

[0016] Preferably, the nucleic acid sequence of the aspA gene includes the sequence shown in SEQ ID NO.1.

[0017] Preferably, the nucleic acid sequence of the asd gene includes the sequence shown in SEQ ID NO.2.

[0018] Preferably, the nucleic acid sequence of the rhtC gene includes the sequence shown in SEQ ID NO.3.

[0019] Preferably, the nucleic acid sequence of the ppc gene includes the sequence shown in SEQ ID NO.4.

[0020] Preferably, the nucleic acid sequence of the thrA gene includes the sequence shown in SEQ ID NO.5.

[0021] Preferably, the nucleic acid sequence of the thrB gene includes the sequence shown in SEQ ID NO.6.

[0022] Preferably, the nucleic acid sequence of the thrC gene includes the sequence shown in SEQ ID NO.7.

[0023]

[0024]

[0025] SEQ ID NO.3:ATGTTGATGTTATTTCTCACCGTCGCCATGGTGCACATTGTGGCGCTTATGAGCCCCGGTCCCGATTTCTTTTTTGTCTCTCAGACCGCTGTCAGTCGTTCCCGTAAAGAAGCGATGATGGGCGTGCTGGGCATTACCTGCGGCGTAATGGTTTGGGCTGGGATTGCGCTGCTTGGCCTGCATTTGATTATCGAAAAAATGGCCTGGCTGCATACGCTGATTATGGTGGGCGGTGGCCTGTATCTCTGCTGGATGGGTTACCAGATGCTACGTGGTGCACTGAAAAAAGAGGCGGTTTCTGCACCTGCGCCACAGGTCGAGCTGGCGAAAAGTGGGCGCAGTTTCCTGAAAGGTTTACTGACCAATCTCGCTAATCCGAAAGCGATTATCTACTTTGGCTCGGTGTTCTCATTGTTTGTCGGTGATAACGTTGGCACTACCGCGCGCTGGGGCATTTTTGCGCTGATCATTGTCGAAACGCTGGCGTGGTTTACCGTCGTTGCCAGCCTGTTTGCCCTGCCGCAAATGCGCCGTGGTTATCAACGTCTGGCGAAGTGGATTGATGGTTTTGCCGGGGCGTTATTTGCCGGATTTGGCATTCATTTGATTATTTCGCGGTGA。

[0026]

[0027]

[0028] SEQ ID NO.6:ATGGTGAAGGTGTACGCCCCGGCCAGCAGCGCCAACATGTCGGTGGGCTTCGACGTGCTGGGCGCCGCCGTGACCCCGGTGGACGGCGCCCTGCTGGGCGACGTGGTGACCGTGGAGGCCGCCGAAACCTTCTCGCTGAACAACCTGGGCCGCTTCGCCGACAAGCTGCCGTCGGAGCCGCGCGAAAACATCGTGTACCAGTGCTGGGAGCGCTTCTGCCAGGAGCTGGGCAAGCAGATCCCGGTGGCCATGACCCTGGAGAAGAACATGCCGATCGGCAGCGGCCTGGGCTCGTCGGCCTGCTCGGTGGTGGCCGCCCTGATGGCCATGAACGAGCACTGCGGCAAGCCGCTGAACGACACCCGCCTGCTGGCCCTGATGGGCGAGCTGGAGGGCCGCATCAGCGGCTCGATCCACTACGACAACGTGGCCCCGTGCTTCCTGGGCGGCATGCAGCTGATGATCGAGGAGAACGACATCATCTCGCAGCAGGTGCCGGGCTTCGACGAGTGGCTGTGGGTGCTGGCCTACCCGGGCATCAAGGTGTCGACCGCCGAGGCCCGCGCCATCCTGCCGGCCCAGTATCGCCGCCAGGACTGCATCGCCCACGGCCGCCATCTGGCCGGCTTCATCCACGCCTGCTACAGCCGCCAGCCGGAGCTGGCCGCCAAGCTGATGAAGGACGTGATCGCCGAGCCGTACCGCGAGCGCCTGCTGCCGGGCTTCCGCCAGGCCCGCCAGGCCGTGGCCGAGATCGGCGCCGTGGCCTCGGGCATCTCGGGCTCGGGCCCGACCCTGTTCGCCCTGTGCGACAAGCCGGAGACCGCCCAGCGCGTGGCCGACTGGCTGGGCAAGAACTACCTGCAGAACCAGGAGGGCTTCGTGCACATCTGCCGCCTGGACACCGCCGGCGCCCGCGTGCTGGAGAACTGA。

[0029]

[0030] In a second aspect, the present invention provides a method for preparing an engineered bacterium for producing L-threonine as described in the first aspect, the preparation method comprising: knocking out the phaCAB gene and the ilvA gene of the starting strain, inserting the aspA gene, the asd gene, the rhtC gene and the ppc gene into the genome of the starting strain, and transferring a plasmid overexpressing the thrA gene, the thrB gene and the thrC gene into the starting strain, wherein the starting strain is Alcaligenes eutrophus.

[0031] Preferably, the aspA gene, asd gene, rhtC gene and ppc gene are derived from Escherichia coli.

[0032] Preferably, the preparation method specifically comprises: knocking out the phaCAB gene of the starting strain and inserting the aspA gene, asd gene and rhtC gene, knocking out the ilvA gene of the starting strain and inserting the ppc gene, and transferring the plasmid overexpressing the thrA gene, thrB gene and thrC gene into the starting strain.

[0033] Preferably, the phaCAB gene and the ilvA gene are knocked out by homologous recombination.

[0034] In a third aspect, the present invention provides the use of the engineering bacteria for producing L-threonine as described in the first aspect and / or the preparation method of the engineering bacteria for producing L-threonine as described in the second aspect in fermentation production of L-threonine.

[0035] In a fourth aspect, the present invention provides a method for producing L-threonine by fermentation, the method comprising: using the engineered bacteria for producing L-threonine according to the first aspect to produce L-threonine by fermentation.

[0036] Preferably, the method for producing L-threonine by fermentation specifically comprises: inoculating the engineered bacteria into a salt culture medium containing fructose to perform a first fermentation culture;

[0037] Alternatively, the engineered bacteria are inoculated into a salt culture medium, and composite gas is introduced to perform a second fermentation culture.

[0038] Preferably, the salt culture medium contains 2-3 g / L potassium dihydrogen phosphate, 2.5-3.5 g / L sodium dihydrogen phosphate, 1.5-2.5 g / L ammonium chloride, 0.3-0.7 g / L magnesium sulfate, 0.05-0.15 g / L calcium chloride, 0.03-0.07 g / L ammonium ferric citrate, 0.3-0.7 g / L isoleucine, 0.5-1.5 mL / L trace element solution and optionally 15-25 g / L fructose.

[0039] The specific point values ​​of 2 to 3 g / L mentioned above can be selected from 2g / L, 2.2g / L, 2.4g / L, 2.5g / L, 2.6g / L, 2.8g / L or 3g / L, etc.

[0040] The specific point values ​​of 2.5 to 3.5 g / L mentioned above can be selected from 2.5 g / L, 2.7 g / L, 2.9 g / L, 3 g / L, 3.1 g / L, 3.3 g / L or 3.5 g / L, etc.

[0041] The specific point values ​​of 1.5 to 2.5 g / L mentioned above can be selected from 1.5 g / L, 1.7 g / L, 1.9 g / L, 2 g / L, 2.1 g / L, 2.3 g / L or 2.5 g / L, etc.

[0042] The specific point values ​​of 0.3 to 0.7 g / L mentioned above can be selected from 0.3 g / L, 0.4 g / L, 0.45 g / L, 0.5 g / L, 0.55 g / L, 0.6 g / L or 0.7 g / L, etc.

[0043] The specific point values ​​of 0.05 to 0.15 g / L mentioned above can be selected from 0.05 g / L, 0.07 g / L, 0.09 g / L, 0.1 g / L, 0.11 g / L, 0.13 g / L or 0.15 g / L, etc.

[0044] The specific point values ​​of 0.03 to 0.07 g / L mentioned above can be selected from 0.03 g / L, 0.04 g / L, 0.045 g / L, 0.05 g / L, 0.055 g / L, 0.06 g / L or 0.07 g / L, etc.

[0045] The specific point values ​​of 0.5 to 1.5 mL / L mentioned above can be selected from 0.5 mL / L, 0.7 mL / L, 0.9 mL / L, 1 mL / L, 1.1 mL / L, 1.3 mL / L or 1.5 mL / L, etc.

[0046] The specific point values ​​of 15 to 25 g / L can be selected from 15 g / L, 17 g / L, 19 g / L, 20 g / L, 21 g / L, 23 g / L or 25 g / L, etc.

[0047] Preferably, the trace element solution contains 0.05-0.15 g / L zinc sulfate heptahydrate, 0.2-0.4 g / L boric acid, 0.02-0.04 g / L manganese chloride tetrahydrate, 0.1-0.3 g / L cobalt chloride hexahydrate, 0.005-0.015 g / L cupric chloride dihydrate, 0.01-0.03 g / L nickel chloride hexahydrate and 0.02-0.04 g / L sodium molybdate.

[0048] The specific point values ​​of 0.05 to 0.15 g / L mentioned above can be selected from 0.05 g / L, 0.07 g / L, 0.09 g / L, 0.1 g / L, 0.11 g / L, 0.13 g / L or 0.15 g / L, etc.

[0049] The specific point values ​​of 0.2 to 0.4 g / L mentioned above can be selected from 0.2 g / L, 0.25 g / L, 0.28 g / L, 0.3 g / L, 0.32 g / L, 0.35 g / L or 0.4 g / L, etc.

[0050] The specific point values ​​of 0.02 to 0.04 g / L mentioned above can be selected from 0.02 g / L, 0.025 g / L, 0.028 g / L, 0.03 g / L, 0.032 g / L, 0.035 g / L or 0.04 g / L, etc.

[0051] The specific point values ​​of 0.1 to 0.3 g / L mentioned above can be selected from 0.1 g / L, 0.15 g / L, 0.18 g / L, 0.2 g / L, 0.22 g / L, 0.25 g / L or 0.3 g / L, etc.

[0052] The specific point values ​​of 0.005 to 0.015 g / L mentioned above can be selected from 0.005 g / L, 0.007 g / L, 0.009 g / L, 0.01 g / L, 0.011 g / L, 0.013 g / L or 0.015 g / L, etc.

[0053] The specific point values ​​of 0.01 to 0.03 g / L mentioned above can be selected from 0.01 g / L, 0.015 g / L, 0.018 g / L, 0.02 g / L, 0.022 g / L, 0.025 g / L or 0.03 g / L, etc.

[0054] Preferably, the pH of the salt culture medium is 6 to 8 (eg, 6, 6.5, 6.8, 7, 7.2, 7.5 or 8, etc.).

[0055] Preferably, the inoculation amount of the engineered bacteria is 1% to 2% (for example, it may be 1%, 1.2%, 1.4%, 1.5%, 1.6%, 1.8% or 2%, etc.).

[0056] Preferably, the volume ratio of CO2, H2 and O2 in the composite gas is 1:(5-10):(1-3).

[0057] The specific point values ​​of the above (5-10) can be selected from 5, 6, 7, 7.5, 8, 9 or 10, etc.

[0058] The specific point values ​​of the above (1-3) can be selected as 1, 1.5, 1.8, 2, 2.2, 2.5 or 3, etc.

[0059] Preferably, the temperature of the first fermentation culture is 28-32°C (for example, it can be 28°C, 29°C, 30°C, 31°C or 32°C, etc.), the rotation speed is 150-250rpm (for example, it can be 150rpm, 170rpm, 190rpm, 200rpm, 210rpm, 230rpm or 250rpm, etc.), and the time is 50-80h (for example, it can be 50h, 55h, 60h, 65h, 70h, 72h, 74h, 76h, 78h or 80h, etc.).

[0060] Preferably, the temperature of the second fermentation culture is 28-32°C (for example, it can be 28°C, 29°C, 30°C, 31°C or 32°C, etc.), the rotation speed is 100-200rpm (for example, it can be 100rpm, 120rpm, 140rpm, 150rpm, 160rpm, 180rpm or 200rpm, etc.), and the time is 50-80h (for example, it can be 50h, 55h, 60h, 65h, 70h, 72h, 74h, 76h, 78h or 80h, etc.).

[0061] Other specific point values ​​within the above numerical ranges can be selected and will not be described in detail here.

[0062] Compared with the prior art, the present invention has the following beneficial effects:

[0063] The present invention constructs a strain that produces L-threonine using carbon dioxide or organic matter (sugar, acid, glycerol, etc.) as a substrate by knocking out PHB synthesis pathway genes, knocking out genes encoding threonine dehydratase, strengthening the supply of precursor substances, strengthening the transport system, removing the feedback inhibition of key enzymes in the L-threonine synthesis pathway, and enhancing the expression of key genes, and provides a method for microbial autotrophic fermentation to synthesize amino acids. The engineered bacteria has a short growth cycle, can quickly utilize carbon dioxide to produce L-threonine, and secrete L-threonine to the extracellular space. The shake flask fermentation yield under heterotrophic conditions reaches 1.3g / L, and the shake flask fermentation yield under autotrophic conditions reaches 524mg / L, which lays a foundation for the industrial production of L-threonine and has a wide range of industrial application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 Diagram of the genetic modification process for the de novo synthesis pathway of L-threonine production strains.

[0065] Figure 2 This is the HPLC spectrum of L-threonine in Example 3. DETAILED DESCRIPTION

[0066] To further illustrate the technical means and effects of the present invention, the present invention is further described below in conjunction with the embodiments and drawings. It should be understood that the specific implementation methods described herein are only used to explain the present invention, rather than to limit the present invention.

[0067] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0068] The Cupriavidus necator used in the present invention is the Cupriavidus necator H16 strain, which was purchased from the German Collection of Microorganisms and Cell Cultures.

[0069] Example 1

[0070] This embodiment constructs a recombinant strain, comprising the following steps:

[0071] (1) Using the genome of wild-type Alcaligenes rutheniogens as a template, the upper and lower homologous arm fragments of the phaCAB and ilvA genes were amplified, respectively, and the primer nucleic acid sequences were shown in SEQ ID NO.8 to SEQ ID NO.15; using the genome of Escherichia coli E.coliMG1655 as a template, the aspA, asd, rhtC, and ppc genes were amplified, and the primer nucleic acid sequences were shown in SEQ ID NO.16 to SEQ ID NO.23. Each target fragment was Gibson assembled with the linearized suicide plasmid pK18mobSacB to obtain a recombinant suicide plasmid, and pK18-ΔphaCAB::aspA-asd-rhtC and pK18-ΔilvA::ppc were obtained.

[0072] SEQ ID NO. 8: TTGCATGCCTGCAGGTCGACAAGTACCTTGCCGACATCTATG.

[0073] SEQ ID NO.9: ACATCAACATATGTATATCTCCTTCGATTTGATTGTCTCTCTGCC.

[0074] SEQ ID NO. 10: CGAACAGTAACCTGCCGGCCTGGTTCAACC.

[0075] SEQ ID NO.11:TACCCGGGGATCCTCTAGAGCCTGCATGTTCATGAACTGCGACCA。

[0076] SEQ ID NO.12:TTGCATGCCTGCAGGTCGACATTTCATGAATGCGGCAATGGCGTC。

[0077] SEQ ID NO.13:TATATCCGCTGGTCTCGGGGCGGGCCGTGG。

[0078] SEQ ID NO.14:TACCGGCTAACACCTGCTGAGCGCCCCATG。

[0079] SEQ ID NO.15:TACCCGGGGATCCTCTAGAGATTGCCGCGCGTTGCGCTTGTTATC。

[0080] SEQ ID NO.16:ACTGGCGTAAGAAGGAGATATACATATGTCAAACAACATTCGTAT。

[0081] SEQ ID NO.17:GGCCGGCAGGTTACTGTTCGCTTTCATCAG。

[0082] SEQ ID NO.18:TTCGCGGTGAGAAGGAGATATACATATGAAAAATGTTGGTTTTAT。

[0083] SEQ ID NO.19:TGTTTGACATATGTATATCTCCTTCTTACGCCAGTTGACGAAGCA。

[0084] SEQ ID NO.20:CAATCAAATCGAAGGAGATATACATATGTTGATGTTATTTCTCAC。

[0085] SEQ ID NO.21:CATTTTTCATATGTATATCTCCTTCTCACCGCGAAATAATCAAAT。

[0086] SEQ ID NO.22:GATCGACCTTGAAGGAGATATACATATGAACGAACAATATTCCGC。

[0087] SEQ ID NO. 23: TCAGCAGGTGTTAGCCGGTATTACGCATAC.

[0088] (2) The recombinant plasmid successfully constructed in step (1) was transformed into the wild type of Alcaligenes eutrophus by conjugation. According to the principle of homologous recombination, the aspA-asd-rhtC gene was integrated into the phaCAB site, and the engineered strain was successfully obtained by single-double exchange screening. On this basis, the ppc gene was also integrated into the ilvA site by homologous recombination, and the engineered strain was successfully obtained by single-double exchange screening.

[0089] Example 2

[0090] This example constructs an expression plasmid and an engineered bacterium for producing L-threonine, comprising the following steps:

[0091] (1) Using the YH.thrA plasmid as a template, the codon-optimized thrA fragment ① was amplified, and the primer nucleic acid sequences were shown in SEQ ID NO.24 to SEQ ID NO.25; using the YH.thrB plasmid as a template, the codon-optimized thrA fragment ② was amplified, and the primer nucleic acid sequences were shown in SEQ ID NO.26 to SEQ ID NO.27; using the YH.thrC plasmid as a template, the codon-optimized thrC fragment ③ was amplified, and the primer nucleic acid sequences were shown in SEQ ID NO.28 to SEQ ID NO.29; using ①② as templates, the YH1+2 fragment ④ was amplified, and the primer nucleic acid sequences were shown in SEQ ID NO.24 and SEQ ID NO.27; using ③④ as templates, the full-length fragment YH.thrABC was amplified, and the primer nucleic acid sequences were shown in SEQ ID NO.24 and SEQ ID NO.29, and the fragments were ligated with the pBBRMCS2 vector to obtain the pBBRMCS2-YH.thrABC plasmid.

[0092] SEQ ID NO. 24: TTAAGAAGGAGATATACATAAGCTTATGCGCGTGCTGAAGTTCGG.

[0093] SEQ ID NO. 25: CCTTCACCATATGTATATCTCCTTCTCACACGCCCAGCTTCCACG.

[0094] SEQ ID NO. 26: GGGCGTGTGAGAAGGAGATATACATATGGTGAAGGTGTACGCCCC.

[0095] SEQ ID NO. 27: ACAGCTTCATATGTATATCTCCTTCTCAGTTCTCCAGCACGCGGG.

[0096] SEQ ID NO. 28: GGAGAACTGAGAAGGAGATATACATATGAAGCTGTACAACCTGAA.

[0097] SEQ ID NO. 29: TGAGCCTTTCGTTTTATTTGATGCATCACTGGTGGTTCATCATCA.

[0098] pBBRMCS2 was digested with HindIII, assembled into a new recombinant plasmid by Gibson, and transformed into Escherichia coli S17-1 competent cells for amplification and screening, and finally pBBRMCS2-YH.thrABC plasmid was obtained.

[0099] (2) The competent cells S17-1 were heat-shocked at 42°C to transfer the plasmid YH-thrABC into the cells, and LB solid medium (LB medium + 2% agar) was applied and cultured at 37°C until single colonies were visible. The above single colonies were verified by colony PCR (positive fragments were about 0.5 kb), the primer nucleic acid sequences were shown in SEQ ID NO.30 to SEQ ID NO.31, and the correct strain was verified by colony PCR, and further sequenced.

[0100] SEQ ID NO. 30: CTCGCTAACCAAACCGGTAAC.

[0101] SEQ ID NO. 31: CAGCTTGGCACGACAGGTTTC.

[0102] (3) Take out E.coli S17-1 containing the recombinant plasmid from the -80℃ refrigerator, take 100μL and inoculate it in 50mL LB liquid medium, and shake and culture it in a shaker at 37℃ and 200rpm for about 12h. Similarly, take out the recombinant strain prepared in Example 1 from the -80℃ refrigerator, first streak the LB solid plate, then take a single colony and transfer it to 50mL LB liquid medium, and shake and culture it in a shaker at 30℃ and 200rpm for about 36 to 48h. Take E.coli S17-1 and the recombinant strain bacterial liquid respectively, mix them in a ratio of 1:1, centrifuge at 4000rpm for 10min, collect the bacteria, and remove the supernatant. Wash twice with 5mL LB liquid medium, resuspend the bacteria with 100μL LB liquid medium, drop it on the LB solid plate containing sterile filter paper, and culture it in a 30℃ incubator for 24h. Scrape the bacterial moss into 1 mL of sterile ultrapure water, and evenly spread the bacterial solution on the LB solid plate containing the corresponding antibiotics with or without dilution, and incubate it upside down in a 30°C incubator for about 48 hours. Transfer the single colony grown on the above plate to 5 mL of liquid salt culture medium containing the corresponding resistance and fructose, and culture it in a shaker at 30°C and 200 rpm for about 48 hours. After the bacteria become concentrated, extract the recombinant plasmid for PCR and sequencing verification.

[0103] The de novo synthesis pathway gene modification process of the L-threonine production strain of the present invention is as follows Figure 1 As shown, by knocking out the PHB synthesis pathway, sufficient carbon flux can be transferred to product synthesis. Secondly, knocking out the gene of threonine dehydratase can reduce L-threonine loss. Finally, heterologous expression of L-threonine export protein gene from Escherichia coli at the genome level strengthened the transport system; heterologous phosphoenolpyruvate carboxylase, aspartate ammonia lyase, and aspartate semialdehyde dehydrogenase genes were expressed to increase the production of precursor substances oxaloacetate and aspartate. Codon-optimized homoserine kinase, threonine synthetase, and homoserine dehydrogenase genes were overexpressed on plasmids to introduce carbon flow into threonine synthesis, thereby increasing the production of L-threonine.

[0104] Example 3

[0105] In this example, the engineered bacteria for producing L-threonine prepared in Example 2 were subjected to shake flask fermentation verification, including the following steps:

[0106] (1) Preparation of salt culture medium: The salt culture medium formula is 2.3 g / L potassium dihydrogen phosphate, 2.9 g / L sodium dihydrogen phosphate, 2 g / L ammonium chloride, 0.5 g / L magnesium sulfate, 0.1 g / L calcium chloride, 0.05 g / L ammonium ferric citrate and 0.5 g / L isoleucine, pH 6.8, and autoclave sterilization at 121°C for 20 min. Before use, add 1 mL / L of trace element solution (0.10 g / L zinc sulfate heptahydrate, 0.30 g / L boric acid, 0.03 g / L manganese chloride tetrahydrate, 0.20 g / L cobalt chloride hexahydrate, 0.01 g / L cupric chloride dihydrate, 0.02 g / L nickel chloride hexahydrate and 0.03 g / L sodium molybdate) that has been sterilized by filtration with a membrane.

[0107] (2) Shake flask fermentation and yield determination: The L-threonine producing strain was taken out from the cryopreservation tube, streaked on an LB plate for activation, and cultured at 30°C for 36 to 48 h.

[0108] Under heterotrophic conditions, 1 mL of seed solution was transferred to a 50 mL salt medium shake flask, 20 g / L fructose was added as a carbon source, and the reciprocating shaker was 30 ° C, 200 rpm, and cultured for 72 h. After the fermentation, the sample OD was measured. 600 The L-threonine content was determined using HPLC.

[0109] Under autotrophic conditions, 1 mL of seed solution was transferred to a shake flask with 25 mL of salt culture medium, where CO2:H2:O2=1:7:2, and the reciprocating shaker was 30°C, with a speed of 150 rpm, and cultured for 72 h. After the fermentation, the sample OD was measured. 600 The L-threonine content was determined using HPLC.

[0110] like Figure 2 As shown, the blue line is the 700 mg / L standard product, the pink line is the heterotrophic fermentation result, the peak time is 6.6 min, and the L-threonine production is 1.3 g / L; the brown line is the autotrophic fermentation result, the peak time is 6.6 min, and the L-threonine production is 524 mg / L.

[0111] In summary, the present invention achieves the knockout of 2 genes and the integration of 4 genes through a gene editing method, and overexpresses 3 codon-optimized genes through a plasmid, thereby constructing for the first time an Alcaligenes rutheniogens that can utilize carbon dioxide to produce L-threonine by fermentation. The engineered bacteria has a short growth cycle, can quickly utilize carbon dioxide to produce L-threonine, and secrete L-threonine outside the cell.

[0112] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. An engineered bacterium for producing L-threonine, characterized in that: The engineered bacteria lacks phaCAB gene and ilvA gene, heterologously expresses aspA gene, asd gene, rhtC gene and ppc gene on the genome, overexpresses thrA gene, thrB gene and thrC gene on the plasmid, and the starting strain of the engineered bacteria is Alcaligenes eutrophus.

2. The engineered bacteria according to claim 1, characterized in that The aspA gene, asd gene, rhtC gene and ppc gene are derived from Escherichia coli; Preferably, the thrA gene, thrB gene and thrC gene are codon optimized.

3. The engineered bacteria according to claim 1 or 2, characterized in that: The nucleic acid sequence of the aspA gene includes the sequence shown in SEQ ID NO.1; Preferably, the nucleic acid sequence of the asd gene includes the sequence shown in SEQ ID NO.2; Preferably, the nucleic acid sequence of the rhtC gene includes the sequence shown in SEQ ID NO.3; Preferably, the nucleic acid sequence of the ppc gene includes the sequence shown in SEQ ID NO.4; Preferably, the nucleic acid sequence of the thrA gene includes the sequence shown in SEQ ID NO.5; Preferably, the nucleic acid sequence of the thrB gene includes the sequence shown in SEQ ID NO.6; Preferably, the nucleic acid sequence of the thrC gene includes the sequence shown in SEQ ID NO.

7.

4. A method for preparing an engineered bacterium for producing L-threonine according to any one of claims 1 to 3, characterized in that: The preparation method comprises: knocking out the phaCAB gene and the ilvA gene of the starting strain, inserting the aspA gene, the asd gene, the rhtC gene and the ppc gene into the genome of the starting strain, and transferring the plasmid over-expressing the thrA gene, the thrB gene and the thrC gene into the starting strain, wherein the starting strain is Alcaligenes eutrophus.

5. The preparation method according to claim 4, characterized in that: The aspA gene, asd gene, rhtC gene and ppc gene are derived from Escherichia coli.

6. The preparation method according to claim 4 or 5, characterized in that: The preparation method specifically comprises: knocking out the phaCAB gene of the starting strain and inserting the aspA gene, the asd gene and the rhtC gene, knocking out the ilvA gene of the starting strain and inserting the ppc gene, and transferring the plasmid over-expressing the thrA gene, the thrB gene and the thrC gene into the starting strain; Preferably, the phaCAB gene and the ilvA gene are knocked out by homologous recombination.

7. Use of the engineering bacteria for producing L-threonine according to any one of claims 1 to 3 and / or the preparation method of the engineering bacteria for producing L-threonine according to any one of claims 4 to 6 in the fermentation production of L-threonine.

8. A method for producing L-threonine by fermentation, characterized in that: The method for producing L-threonine by fermentation comprises: using the engineered bacteria for producing L-threonine according to any one of claims 1 to 3 to produce L-threonine by fermentation.

9. The method for producing L-threonine by fermentation according to claim 8, characterized in that: The method for producing L-threonine by fermentation specifically comprises: inoculating the engineered bacteria into a salt culture medium containing fructose to perform a first fermentation culture; Alternatively, the engineered bacteria are inoculated into a salt culture medium, and composite gas is introduced to perform a second fermentation culture.

10. The method for producing L-threonine by fermentation according to claim 9, characterized in that: The salt culture medium contains 2-3 g / L potassium dihydrogen phosphate, 2.5-3.5 g / L disodium hydrogen phosphate, 1.5-2.5 g / L ammonium chloride, 0.3-0.7 g / L magnesium sulfate, 0.05-0.15 g / L calcium chloride, 0.03-0.07 g / L ammonium ferric citrate, 0.3-0.7 g / L isoleucine, 0.5-1.5 mL / L trace element solution and optionally 15-25 g / L fructose; Preferably, the trace element solution contains 0.05-0.15 g / L zinc sulfate heptahydrate, 0.2-0.4 g / L boric acid, 0.02-0.04 g / L manganese chloride tetrahydrate, 0.1-0.3 g / L cobalt chloride hexahydrate, 0.005-0.015 g / L cupric chloride dihydrate, 0.01-0.03 g / L nickel chloride hexahydrate and 0.02-0.04 g / L sodium molybdate; Preferably, the pH of the salt medium is 6 to 8; Preferably, the inoculation amount of the engineered bacteria is 1% to 2%; Preferably, the volume ratio of CO2, H2 and O2 in the composite gas is 1:(5-10):(1-3); Preferably, the temperature of the first fermentation culture is 28-32°C, the rotation speed is 150-250rpm, and the time is 50-80h; Preferably, the temperature of the second fermentation culture is 28-32° C., the rotation speed is 100-200 rpm, and the time is 50-80 h.

Images