Microbial cell factory for producing catechol

Abstract

The invention relates to the technical field of synthetic biology, in particular to a microbial cell factory for producing catechol. Pseudomonas putida without a pcaHG gene, a catA gene and a catA2 gene is used as a chassis bacterium, and exogenous AroY and / or kpdB genes are / is introduced into the chassis bacterium, or the expression of endogenous genes VanAB and PobA is improved. The lignin-derived monomer is efficiently converted into catechol through the strategy of cofactor regulation and key enzyme overexpression, the conversion rate reaches 98.5%, the highest yield is 14.1 mM, and compared with the previous 64% conversion rate, the conversion rate is greatly improved.

Description

Technical Field

[0001] The invention relates to the technical field of synthetic biology, in particular to a microbial cell factory for producing catechol. Background Art

[0002] Catechol, also known as catechol, is an organic compound with the chemical formula C 6 H 6 O 2 , is a white crystalline powder. Catechol contains two adjacent hydroxyl groups and has good antioxidant and antibacterial properties. Catechol is also an important intermediate in the chemical synthesis of pesticides, flavoring agents, drugs and biomaterials. It can be used as a rubber hardener, electroplating additive, skin preservative and bactericide, hair dye, photographic developer and color photography antioxidant, etc.

[0003] Currently, catechol is mainly obtained through chemical synthesis, but the chemical synthesis process is complicated, there are many by-products, and the reaction conditions are difficult to control, which makes the output of catechol always in short supply. Microbial methods are gradually gaining attention due to their rapid reaction, suitability for industrial-scale production, environmental protection and solvent-free characteristics.

[0004] Lignin is the main component of lignocellulosic biomass and the world's largest renewable source of aromatic compounds. About 150 billion tons of lignin are produced each year, however, most of it is used for combustion and power generation, resulting in resource waste and environmental pollution. Lignin can be converted into catechol by microorganisms. First, microorganisms secrete lignin-degrading enzymes, such as lignin peroxidase, manganese peroxidase, etc., to depolymerize lignin. Then, after a series of redox reactions and enzymatic reactions, the depolymerized products are further converted into catechol. Therefore, converting lignin into catechol by microbial methods is a promising method to achieve lignin value-added and catechol production.

[0005] Pseudomonas putida, which has multiple metabolic pathways for lignin derivatives, is a good base for lignin bioconversion. Through gene editing and metabolic regulation, efficient conversion of lignin to catechol can be achieved. At present, studies have shown that ferulic acid and p-coumaric acid monomers can be converted into catechol by knocking out downstream degradation pathways and introducing protocatechuate decarboxylase from Enterobacter cloacae and vanillic acid O-demethylase from Acinetobacter genus in Pseudomonas putida, but the highest efficiency is only 6% and 64%, and there is still a lot of room for improvement. Summary of the invention

[0006] In view of this, the technical problem to be solved by the present invention is to provide a microbial cell factory for producing catechol.

[0007] The present invention uses Pseudomonas putida as a chassis cell, focuses on proposing solutions to the problems of intermediate product accumulation and low heterologous expression efficiency, provides a metabolic regulation strategy for Pseudomonas putida, and provides a promising solution for the bioconversion of lignin.

[0008] The catechol-producing strain provided by the present invention is Pseudomonas putida containing at least one of the following I) to IV);

[0009] 1), a nucleic acid encoding protocatechuate decarboxylase;

[0010] II), a nucleic acid encoding a vanillate O-demethylase oxygenase;

[0011] III), a nucleic acid encoding 4-hydroxybenzoate 3-monooxygenase;

[0012] IV), a nucleic acid encoding an isopentenyl transferase.

[0013] In the present invention, the sources of protocatechuate decarboxylase are screened, for example: AroY from Enterobactercloacae, Pdc from Klebsiella pneumoniae, and TaGDC from Talaromyces atroroseus. Among the protocatechuate decarboxylases from multiple sources, the protocatechuate decarboxylase from Enterobacter cloacae can obtain a higher conversion rate; the present invention performs codon optimization on the nucleic acid encoding protocatechuate decarboxylase to make it more consistent with the original genome characteristics of Pseudomonas putida, and adds the RBS sequence TAGAAAACCTCCTTA at the 5' end. Compared with other optimization schemes, the nucleic acid encoding protocatechuate decarboxylase is better as shown in SEQ ID NO:1.

[0014] In the present invention, the vanillic acid O-demethylase oxygenase is a vanillic acid O-demethylase oxygenase from Pseudomonas putida; the present invention adds an RBS sequence TAGAAAACCTCCTTA to the 5' end of the nucleic acid encoding the vanillic acid O-demethylase oxygenase. The nucleic acid encoding the vanillic acid O-demethylase oxygenase is shown in SEQ ID NO: 2.

[0015] In the present invention, the 4-hydroxybenzoate 3-monooxygenase is a 4-hydroxybenzoate 3-monooxygenase from Pseudomonas putida; the present invention adds an RBS sequence TAGAAAACCTCCTTA to the 5' end of the nucleic acid encoding the 4-hydroxybenzoate 3-monooxygenase. The nucleic acid encoding the 4-hydroxybenzoate 3-monooxygenase is shown in SEQ ID NO:3.

[0016] The present invention also screens the sources of isopentenyl transferase, for example: EcdB from Enterobactercloacae, KpdB from Klebsiella pneumoniae, UbiX from E.coli, and PADI from Yeast. Preferably, the isopentenyl transferase is an isopentenyl transferase from Burkholderia pneumoniae, which can obtain a higher conversion rate; the present invention performs codon optimization on the nucleic acid encoding the isopentenyl transferase to make it more consistent with the original genome characteristics of Pseudomonas putida, and adds the RBS sequence TAGAAAACCTCCTTA at the 5' end. Compared with other optimization schemes, the effect obtained by the nucleic acid encoding the isopentenyl transferase as shown in SEQ ID NO:4 is better.

[0017] In a specific embodiment, the strain contains nucleic acids encoding protocatechuate decarboxylase, nucleic acids encoding vanillic acid O-demethylase oxygenase, nucleic acids encoding 4-hydroxybenzoate 3-monooxygenase, and nucleic acids encoding isopentenyl transferase. More specifically, the present invention utilizes the protocatechuate decarboxylase AroY from Enterobacter cloacae and the isopentenyl transferase from Klebsiellapneumoniae to be heterologously expressed in Pseudomonas putida to improve the conversion efficiency of protocatechuate decarboxylase, and eliminates intermediates by overexpressing endogenous key enzyme genes pobA and vanAB to increase catechol production.

[0018] In some embodiments, any one of protocatechuate decarboxylase, vanillate O-demethylase oxygenase, 4-hydroxybenzoate 3-monooxygenase or isopentenyl transferase is expressed in the strain.

[0019] In some embodiments, the strain expresses:

[0020] protocatechuate decarboxylase and vanillate O -demethylase oxygenase;

[0021] or expressing protocatechuate decarboxylase and 4-hydroxybenzoate 3-monooxygenase;

[0022] or expressing protocatechuate decarboxylase and isopentenyl transferase;

[0023] or expressing vanillate O -demethylase oxygenase and 4-hydroxybenzoate 3-monooxygenase;

[0024] or expressing vanillate O -demethylase oxygenase and isopentenyltransferase;

[0025] or expressing 4-hydroxybenzoate 3-monooxygenase and isopentenyl transferase.

[0026] In some other embodiments, the strain expresses:

[0027] Protocatechuate decarboxylase, vanillate O-demethylase oxygenase, and 4-hydroxybenzoate 3-monooxygenase.

[0028] or expressing protocatechuate decarboxylase, vanillate O-demethylase oxygenase, and isopentenyl transferase.

[0029] or expressing protocatechuate decarboxylase, 4-hydroxybenzoate 3-monooxygenase and isopentenyl transferase.

[0030] or expressing vanillate O-demethylase oxygenase, 4-hydroxybenzoate 3-monooxygenase, and isopentenyltransferase.

[0031] In the present invention, the pcaHG gene, catA gene and catA2 gene in the Pseudomonas putida are knocked out. Among them, the pcaHG gene is protocatechuate 3,4-dioxygenase, the catA gene is a catechol degrading enzyme, and the catA2 gene is a catechol degrading enzyme. The present invention uses Pseudomonas putida with the pcaHG gene, catA gene and catA2 gene knocked out as the base bacteria, and introduces exogenous AroY, VanAB, PobA and / or kpdB genes into it. The cofactor supply is enhanced by strengthening the expression of endogenous key enzyme genes and overexpressing isopentenyl transferase to increase the catechol production.

[0032] Furthermore, the present invention also provides a method for constructing the strain as described above, comprising:

[0033] A plasmid vector containing at least one of a nucleic acid encoding protocatechuate decarboxylase, a nucleic acid encoding vanillic acid O-demethylase oxygenase, a nucleic acid encoding 4-hydroxybenzoate 3-monooxygenase, and a nucleic acid encoding isopentenyl transferase is constructed; and the plasmid vector is transfected or transformed into Pseudomonas putida.

[0034] The construction method of the present invention also includes the step of knocking out the pcaHG gene, catA gene and catA2 gene.

[0035] In the present invention, the plasmid vector is pBBR1MCS-2, or a pUC series vector (e.g., pUC18, pUC19, pUC57), a pTZ series vector (e.g., pTZ19R), a pMD series vector (e.g., PMD18T), a pQE series vector (e.g., pQE30), a pTrc series vector (e.g., pTrcHisA), a pTrx series vector (e.g., pTrxFus), a pRSET series vector (e.g., pRSET-A, pRSET-B), a pVAX series vector (e.g., pVAX1), a pBR series vector (e.g., pBR322), a pbv series vector (e.g., pbv220), a pBluescript II series vector (e.g., pBluescript II KS(+)), L4440 series vectors (e.g., L4440), pCAMBIA series vectors (e.g., pCAMBIA-1301), pMAL series vectors (e.g., pMAL-p2X), and pGD series vectors (e.g., pGD926).

[0036] In some specific embodiments, the plasmid vector for overexpressing AroY, VanAB, PobA and / or kpdB genes in the present invention is pBBR1MCS-2, and the insertion sites of the exogenous fragments are Sac I, Spe I, BamH I, Hind III. In the present invention, the construction of the plasmid vector adopts the Gibson method.

[0037] In some specific embodiments, the strain is constructed by transformation. Specifically, the strain is constructed by rapid transformation.

[0038] Furthermore, the present invention also provides a method for preparing catechol, which comprises: using ferulic acid and / or p-coumaric acid as substrates and fermenting with the strain to obtain a product containing catechol.

[0039] In the present invention, the fermentation medium is an M9 medium containing glucose, ferulic acid and p-coumaric acid.

[0040] M9 medium contains 6.78 g / L Na 2 HPO 4 、3.00g / L KH 2 PO 4 、1.00 / L NH 4 Cl, 0.50g / L NaCl, 0.24g / L MgSO 4 and trace elements (0.060g / L FeSO 4 7H 2 O, 0.00270g / LCaCO 3, 0.002g / L ZnSO 4 ·H 2 O, 0.00116g / L MnSO 4 ·H 2 O, 0.00037g / LCoSO 4 7H 2 O, 0.00033g / L CuSO 4 ·5H 2 O, 0.00008g / LH 3 BO 3 ).

[0041] The content of glucose in the culture medium is 15-25 g / L, for example, the content of glucose is 15 g / L, 16 g / L, 17 g / L, 18 g / L, 19 g / L, 20 g / L, 21 g / L, 22 g / L, 23 g / L, 24 g / L, and 25 g / L.

[0042] The content of ferulic acid in the culture medium is 1-10 mM, for example, the content of ferulic acid is 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, or 10 mM.

[0043] The content of p-coumaric acid in the culture medium is 1-10 mM, for example, the content of p-coumaric acid is 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, or 10 mM.

[0044] In a specific embodiment, the fermentation medium includes: M9 medium containing 20 g / L glucose, 5 mM ferulic acid and 5 mM p-coumaric acid.

[0045] In the present invention, the initial inoculation concentration of the strain is OD 600 =1.0, and the fermentation conditions are 180 rpm, 30°C and fermentation for about 72 hours.

[0046] The present invention uses Pseudomonas putida with pcaHG gene, catA gene and catA2 gene knocked out as the base bacteria, introduces exogenous AroY and / or kpdB genes into it, or increases the expression of endogenous genes VanAB and PobA. Through the strategy of cofactor regulation and key enzyme overexpression, lignin-derived monomers are efficiently converted into catechol, with a conversion rate of 98.5% and a maximum yield of 14.1mM, which is greatly improved compared with the previous conversion rate of 64%. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 The synthesis of catechol from ferulic acid and p-coumaric acid is shown;

[0048] Figure 2 The catechol production of each strain using FA and p-CA as substrates is shown. DETAILED DESCRIPTION

[0049] The present invention provides a microbial cell factory for producing catechol. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0050] Unless otherwise defined herein, scientific and technical terms related to the present invention shall have the meanings understood by those of ordinary skill in the art.

[0051] In this application, "include", "comprising" and "having" are used interchangeably, and are intended to indicate the inclusiveness of the solution, meaning that the solution may have other elements besides the listed elements. At the same time, it should be understood that the use of "include", "comprising" and "having" descriptions in this article also provides a "consisting of..." solution.

[0052] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B may represent: A exists alone, A and B exist at the same time, and B exists alone. A and B may be singular or plural.

[0053] In this application, "at least one" means one or more, "more than one" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single or plural items.

[0054] The plasmid used in this article is pBBR1MCS-2

[0055] The chassis fungus P. putida KTCA01 used in this article comes from the laboratory (Tianjin University), which is obtained by knocking out the pcaHG gene, catA gene, and catA2 gene of the wild-type Pseudomonas putida.

[0056] The primer sequences used in this article include:

[0057] yz-pBBR1-for:ttacaatttccattcgccattcagg

[0058] yz-pBBR1-rev:ttaatgcagctggcacgaca

[0059] vanAB-BM-F:ggcggccgctctagaactagataaggaggttttctaatgtaccccaaaaacacctgg

[0060] vanAB-BM-R:gcgacaagaagtaaggatccactagtcagatgtccagcaccagc

[0061] yz-cx-R:caactggacccaagccaatc

[0062] PobA-BM-F: tgctggtgctggacatctgactagtaaggaggttttctaatgaaaactcaggttgcaattatPobA-BM-R: caagaagtaaggatccactagtcaggcaacttcctcgaacg

[0063] cx-PobA-F:agagaatggtatcgagatcg

[0064] KpdB-T7-F:tcactatagggcgaattggagctctaaggaggttttctaatgaagc

[0065] KpdB-T7-R:agagcggccgccaccgcggtcctatagtgagtcgtattaggagctcttactcgatctcttg

[0066] yz-KpdB-R:actcgatctcttgagcgaact

[0067] The gene sequences used in this article include:

[0068] >AroY gene sequence (as shown in SEQ ID NO: 1)

[0069]

[0070] >vanAB fragment sequence (as shown in SEQ ID NO:2)

[0071]

[0072] >pobA gene fragment (as shown in SEQ ID NO:3)

[0073]

[0074] >kpdB gene (as shown in SEQ ID NO:4)

[0075] TAAGGAGGTTTTCTAatgaagctgatcatcggcatgaccggtgccaccggtgctccactgggtgtggccttgctgcaggccttgcgtgacatgccggaagtggagactcacctggtgatgagcaagtgggccaagaccaccatcgagctgga aacgccatggaccgcacgtgaagtggccgcactggccgacttcagccattcgccagccgatcaagccgccaccatcagcagcggtagcttccgtaccgatggcatgatcgtgattccgtgcagcatgaagaccttggccggtatccgtgcag gttacgccgaaggcttggtgggtcatgcagccgatgtggtgctgaaagaaggccgtaagctggtgctggtgccacgtgaaatgccgctgagcaccatccacctggagaacatgctggcactgagccgtatgggcgtggccatggtgccgcca atgagcgcctactacaaccatccggaaaccgtggacgacatcaccaaccacatcgtgacgcgtgtgctggaccagttcggtctggactaccacaaggcacgtcgttggaacggtctgcgtaccgccgaacagttcgctcaagagatcgagtaa

[0076] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0077] The present invention will be further described below in conjunction with embodiments:

[0078] Example 1: Construction of P. putida KTCA01 (taking pcaHG knockout as an example)

[0079] Escherichia coli containing the pSEVA-gRic6T plasmid was cultured overnight in LB medium containing gentamicin to extract the plasmid. The appropriate gRNA was selected on the gene pcaHG, and the obtained pSEVA-gRic6T plasmid was cut into linear fragments with BsaI single enzyme. The linear fragment and gRNA were connected using T4 DNA ligase, followed by E. coli transformation, which was spread on LB agar plates containing gentamicin and cultured overnight at 37°C. White clones were selected, and the selected single colonies were continued to be cultured overnight in LB medium containing gentamicin. The plasmid connected with gRNA was extracted and double-enzymed with BamHⅠ and SpeⅠ to obtain linear fragments. At the same time, Q5 high-fidelity DNA polymerase was used to perform PCR with the wild-type P. putida KT2440 genome as a template to obtain the upper and lower homologous arms of the target gene. The linearized plasmid and the upper and lower homologous arms were assembled through BM seamless cloning, followed by E. coli transformation, and the correct plasmid was extracted and verified.

[0080] The plasmid pCAS-RK2T was electroporated into wild-type Pseudomonas putida, spread on tetracycline agar plates, and the correct strain was inoculated into LB liquid medium supplemented with tetracycline and cultured at 30°C for 12 hours. Subsequently, the strain was transferred to a new LB (tetracycline added) liquid medium supplemented with 6.0 g / L arabinose to induce the expression of λ-Red protein. After 3 hours, the above pSEVA-gRic6T-pcaHG plasmid was electroporated into competent cells and spread on double-resistance (tetracycline + gentamicin) agar plates and cultured overnight at 30°C. Through colony PCR, the correctly edited transformants were screened and inoculated into LB liquid culture medium supplemented with tetracycline and 500mM rhamnose, thereby targeted elimination of pSEVA-gRNAT-pcaHG related plasmids. Then, the strain that lost the pSEVA-gRNAT-pcaHG plasmid was inoculated into LB culture medium containing 10g / L sucrose and 5g / L glucose and cultured for 24h to eliminate the pCAS-RK2T plasmid. The bacterial liquid was then spread on LB agar plates and cultured overnight at 30°C to finally obtain a plasmid-free strain.

[0081] The method for knocking out genes catA and catA2 is as described above, and finally the chassis bacteria P. putida KTCA01 with knockout of pcaHG, catA, and catA2 is obtained.

[0082] Example 2 Addition of the gene for protocatechuate decarboxylase AroY from Enterobacter cloacae

[0083] A plasmid containing the gene of exogenous protocatechuate decarboxylase (AroY) was introduced into P. putida KTCA01 (ΔpcaHG, ΔcatA, ΔcatA2) to obtain strain KTCA02.

[0084] Experimental method: The plasmids pUC57-AroY and pBBR1MCS-2 were digested with restriction endonucleases Hind III and Bam HI, and the linearized plasmid pBBR1MCS-2 and the gene fragment aroY were assembled by Gibson, transformed into competent cells for amplification of the plasmid, and spread on LB plates containing 50 mg / L kanamycin. After overnight culture in a 37°C incubator, the transformants were verified with primers yz-pBBR1-for and yz-pBBR1-rev. The verified strains were inoculated into LB liquid culture medium, cultured at 37°C overnight, and the plasmids were extracted and sequenced for verification. The correct plasmid was named pCA02. The plasmid was transferred into P. putida KTCA01 by electroporation, spread on a solid culture medium containing kanamycin resistance, and cultured in a 30°C incubator overnight. The obtained transformants were verified using the above primers yz-pBBR1-for and yz-pBBR1-rev to obtain the correct strain P. putida KTCA02.

[0085] Fermentation method: The recombinant Pseudomonas putida in glycerol medium was inoculated into a test tube containing 5 mL of Luria-Bertani medium and 50 mg / mL of kanamycin antibiotic was added, and incubated on a shaker at 220 rpm and 30°C for about 20 hours. The bacterial broth that reached the logarithmic phase was transferred to a 250 mL shake flask containing 50 mL of M9 mineral medium and 20 g / L glucose, and 50 mg / mL of kanamycin antibiotic was added. The culture was incubated at 30°C and 180 rpm for about 22 hours. The cells were then collected by centrifugation at 4,200 rpm for 10 minutes and inoculated into a new 250 mL conical flask containing 50 mL of M9 medium and 20 g / L glucose, and 50 mg / mL of kanamycin antibiotic was added. The medium was also supplemented with 5 mM ferulic acid and 5 mM p-coumaric acid. The initial inoculation concentration was OD 600 =1.0.

[0086] Experimental results: Using ferulic acid as the substrate, 0.54 mM catechol was obtained after 72 hours of fermentation; using p-coumaric acid as the substrate, 4.2 mM catechol was obtained after 72 hours of fermentation; using ferulic acid and p-coumaric acid as substrates, the catechol yield was 3.3 mM.

[0087] Example 3 Overexpression of VanAB from Pseudomonas putida

[0088] In the biotransformation pathway of ferulic acid in Pseudomonas putida KT2440, the vanAB gene encodes vanillic acid O-demethylase oxygenase, which catalyzes the conversion of vanillic acid to protocatechuic acid. The endogenous vanAB gene was integrated into plasmid pCA02 and then transferred into P. putida KTCA01 to obtain strain KTCA05.

[0089] Experimental process: Use primers vanAB-BM-F and vanAB-BM-R to obtain the vanAB gene fragment from the genome, cut the plasmid pCA02 with Spe I enzyme, and connect the vanAB fragment with the linearized plasmid by Gibson assembly. Heat shock transformation and overnight culture. Use primers yz-pBBR1-for and yz-cx-R to preliminarily verify the transformants. Extract the correctly verified plasmid for sequencing, and name the correctly sequenced plasmid pCA05. pCA05 was electroporated into P. putida KTCA01, and the correct strain was named P. putida KTCA05.

[0090] Experimental results: Using ferulic acid as substrate, 4.1 mM catechol was obtained after 72 h of fermentation.

[0091] Example 4 Overexpression of PobA from Pseudomonas putida

[0092] The pobA gene encodes 4-hydroxybenzoate 3-monooxygenase, which plays a key role in the conversion of p-hydroxybenzoate to protocatechuic acid. The endogenous pobA gene was integrated into plasmid pCA05 and then transferred into P. putida KTCA01 to obtain strain KTCA07.

[0093] Experimental process: Referring to the method in Example 2, the pobA gene fragment was obtained on the genome by primers pobA-BM-F and pobA-BM-R, and Gibson was performed on the linearized plasmid pCA05 cut with Spe I. After heat shock transformation, the transformants were preliminarily verified by primers cx-PobA-F and yz-cx-R. The correctly verified plasmid was extracted and sequenced, and the plasmid with the correct sequencing was named pCA07. pCA07 was electroporated into P. putida KTCA01, and the correct strain was named P. putida KTCA07.

[0094] Experimental results: Using ferulic acid and p-coumaric acid as substrates, 8.8 mM catechol was obtained after 72 hours of fermentation.

[0095] Example 5 Addition of the gene for the isopentenyl transferase kpdB from Burkholderia pneumoniae

[0096] The reactivity of protocatechuate decarboxylase is dependent on isopentenyl riboflavin. Therefore, the activity of protocatechuate decarboxylase is regulated by expressing flavin prenyltransferase.

[0097] Experimental process: Referring to the method in Example 2, the gene kpdB (synthesized by Qingke) was amplified by primers KpdB-T7-F and KpdB-T7-R, and Gibson was performed on the linearized plasmid pCA07 cut with Sac I. After heat shock transformation, the transformants were preliminarily verified with primers cx-pBBR1-for and yz-KpdB-R. The correctly verified plasmid was extracted and sequenced, and the plasmid with the correct sequencing was named pCA09. pCA09 was electroporated into P. putida KTCA01, and the correct strain was named P. putida KTCA09.

[0098] Experimental results: With ferulic acid and p-coumaric acid as substrates, 14.1 mM catechol was obtained after 72 h of fermentation, and the conversion rate reached 98.5%.

[0099] Conversion Effect

[0100] The metabolic pathway for the synthesis of catechol from ferulic acid and p-coumaric acid is as follows Figure 1 , using ferulic acid and / or coumaric acid as substrates, the yield and conversion rate of the strains involved in Example 1 and Comparative Examples 1 to 3 were statistically analyzed ( Figure 2 ).

[0101] Table 1: Catechol production and conversion rate of strains under different substrate conditions

[0102]

[0103] Note: FA, ferulic acid; p-CA, p-coumaric acid

[0104] The results showed that the strategy of cofactor regulation and overexpression of key enzymes enabled the efficient conversion of lignin-derived monomers into catechol, with a conversion rate of 98.5% and a maximum yield of 14.1 mM. Under the same substrate concentration conditions, the yields of strains KTCA07 and KTCA09 were higher, and there was a very significant difference in yield compared with other strains, p < 0.01.

[0105] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A catechol-producing strain, which is a Pseudomonas putida strain containing at least one of the following I) to IV); 1), a nucleic acid encoding protocatechuate decarboxylase; II), a nucleic acid encoding a vanillate O-demethylase oxygenase; III), a nucleic acid encoding 4-hydroxybenzoate 3-monooxygenase; IV), a nucleic acid encoding an isopentenyl transferase.

2. The strain according to claim 1, characterized in that The protocatechuate decarboxylase is a protocatechuate decarboxylase from Enterobacter cloacae; The vanillic acid O-demethylase oxygenase is a vanillic acid O-demethylase oxygenase from Pseudomonas putida; The 4-hydroxybenzoate 3-monooxygenase is 4-hydroxybenzoate 3-monooxygenase from Pseudomonas putida; The isopentenyl transferase is an isopentenyl transferase from Burkholderia pneumoniae.

3. The strain according to claim 1, characterized in that The nucleic acid encoding protocatechuate decarboxylase is shown in SEQ ID NO: 1; The nucleic acid encoding vanillic acid O-demethylase oxygenase is shown in SEQ ID NO: 2; The nucleic acid encoding 4-hydroxybenzoate 3-monooxygenase is shown in SEQ ID NO: 3; The nucleic acid encoding the isopentenyl transferase is shown in SEQ ID NO:

4.

4. The strain according to any one of claims 1 to 3, characterized in that It contains nucleic acid encoding protocatechuate decarboxylase, nucleic acid encoding vanillate O-demethylase oxygenase, nucleic acid encoding 4-hydroxybenzoate 3-monooxygenase and nucleic acid encoding isopentenyl transferase.

5. The strain according to any one of claims 1 to 3, characterized in that Among them, the pcaHG gene, catA gene and catA2 gene were knocked out.

6. A method for constructing the strain according to any one of claims 1 to 5, comprising: A plasmid vector containing at least one of a nucleic acid encoding protocatechuate decarboxylase, a nucleic acid encoding vanillate O-demethylase oxygenase, a nucleic acid encoding 4-hydroxybenzoate 3-monooxygenase and a nucleic acid encoding isopentenyl transferase is constructed; and the plasmid vector is transfected or transformed into Pseudomonas putida.

7. The construction method according to claim 6, characterized in that: The method also includes the step of knocking out the pcaHG gene, catA gene and catA2 gene.

8. A method for preparing catechol, comprising: The product containing catechol is obtained by fermenting ferulic acid and / or p-coumaric acid as substrates with the strain described in any one of claims 1 to 5.

9. The preparation method according to claim 8, characterized in that: The fermentation medium includes: M9 medium containing 20 g / L glucose, 5 mM ferulic acid and 5 mM p-coumaric acid.

10. The preparation method according to claim 8 or 9, characterized in that: The initial inoculum concentration of the strain was OD 600 =1.0, and the fermentation conditions are 180 rpm, 30°C and fermentation for about 72 hours.

Images