Marc145 cell line, preparation method and application

Abstract

The invention relates to the technical field of biology, and particularly discloses a Marc145 cell line which is a PTBP1 gene knocked-down Marc145 cell line, and a preparation method of the Marc145 cell line comprises the following steps: step 1, preparation of lentivirus: co-transfecting HEK293T cells by adopting recombinant shRNA plasmid, psPAX2 plasmid and pMD2. G plasmid to obtain the lentivirus; step 2, the Marc145 cells are infected with lentivirus, and a Marc145 cell line with the PTBP1 gene knocked down is obtained through screening; the cell line can be used for researching functions of PTBP1 protein and a mechanism for influencing PRRSV replication, and the PTBP1 gene can be used as a novel target for development of vaccine drugs for inhibiting PRRSV replication and breeding for disease resistance; the knock-down cell line can obviously improve the replication of the PRRSV, can be used for PRRSV vaccine production cell lines, reduces the clinical production cost, and has a wide application prospect. Meanwhile, the invention also discloses application of the cell line.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a Marc145 cell line, a preparation method and an application thereof. Background Art

[0002] Polypyrimidine tract binding protein 1 (PTBP1) belongs to the heterogeneous nuclear ribonucleoprotein subfamily, including RNA binding proteins and heterogeneous nuclear RNA complexes. PTBP1 is involved in regulating nuclear pre-mRNA processing, mRNA transport and metabolism. As a member of the PTBP family, PTBP1 selectively splices exons or introns by binding to specific sequences of target gene precursor mRNA, thereby generating different mRNA isoforms. In the cytoplasm, PTBP1 is a nuclear factor responsible for alternative splicing and plays an important role in post-transcriptional regulation, RNA localization and mRNA stability. Studies have shown that miR-326 can upregulate autophagy in olfactory mucosal mesenchymal stem cells through the PI3K pathway by targeting PTBP1. In addition, PTBP1 can promote the proliferation of breast cancer cells through autophagy and the PTEN / Akt pathway. Recent studies have shown that PTBP1 can inhibit the replication of porcine epidemic diarrhea virus (PEDV) by targeting and degrading viral N protein. At the same time, PTBP1 protein effectively induced the expression of endogenous myeloid differentiation factor 88 (MyD88) in a dose-dependent manner. MyD88 regulated tumor necrosis factor receptor-associated factor 3 (TRAF3), TRAF6 and phosphorylated TANK-binding kinase 1 (TBK1), further inducing phosphorylated IRF3 to migrate to the nucleus, bind to the IFN-β promoter, activate the production of interferon-β, and inhibit the replication of porcine epidemic diarrhea (PEDV).

[0003] Porcine Respiratory Reproductive Syndrome (PRRS) is a highly contagious and lethal infectious disease caused by PRRSV, commonly known as blue ear pig disease. PRRS is mainly manifested by reproductive disorders in sows and respiratory diseases in pigs of different growth stages. Common clinical manifestations include abortion, premature birth, stillbirth, mummified fetuses, weakness in pregnant sows, weakness in the hind limbs, inability to stand, ataxia, high fever, and respiratory diseases in pigs of all ages. Pigs infected with PRRSV can lead to immunosuppression and damage immune function, causing huge economic losses to the global pig industry. At present, there is no effective drug treatment for the prevention and control of the disease, and vaccination is still the main method. However, due to the high variability, diversity, and super immunosuppression and immune escape capabilities of PRRSV strains, the immune efficacy of existing commercial vaccines has been unsatisfactory, which poses a huge challenge to the prevention and control of PRRS. Therefore, in-depth research on the interaction between host and PRRSV and the discovery of host factors that regulate PRRSV replication are of great significance for the development of safe and effective new strategies for the prevention and control of PRRS.

[0004] In summary, PTBP1 protein plays an important role in a variety of cellular biological processes and antiviral responses, but there are currently no relevant research reports on whether this protein affects the replication and proliferation of PRRSV. Summary of the invention

[0005] In view of the problems of the prior art, the present invention provides a Marc145 cell line with a PTBP1 gene knocked down, which is used to study the function of the protein and the mechanism of its effect on PRRSV replication, and the PTBP1 gene can be used as a new target for the development of vaccine drugs that inhibit PRRSV replication and for disease-resistant breeding;

[0006] At the same time, the present invention also provides the application of the Marc145 cell line. The knocked-down cell line can significantly promote the replication of PRRSV, can be used for the production of PRRSV vaccine cell lines, reduces clinical production costs, and has broad application prospects.

[0007] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0008] A Marc145 cell line, wherein the Marc145 cell line is a Marc145 cell line in which the PTBP1 gene is knocked down.

[0009] Preferably, the method for preparing the Marc145 cell line comprises the following steps:

[0010] Step 1: Preparation of lentivirus: co-transfect HEK293T cells with recombinant shRNA plasmid, psPAX2 plasmid, and pMD2.G plasmid to obtain lentivirus;

[0011] Step 2: Infect Marc145 cells with lentivirus, and obtain Marc145 cell lines with PTBP1 gene knockdown through screening;

[0012] The recombinant shRNA plasmid comprises a vector and the shRNA loaded on the vector; the nucleotide sequence of the shRNA is shown in any one of SEQ ID NOs. 1-3.

[0013] Preferably, step 1 specifically comprises: using Lipofectamine 3000 transfection reagent to co-transfect HEK293T cells with the recombinant shRNA plasmid, psPAX2 plasmid and pMD2.G plasmid in a weight ratio of 4:3:1, and the total amount of the recombinant shRNA plasmid, psPAX2 plasmid and pMD2.G plasmid is 20 μg.

[0014] Preferably, the step 2 is specifically:

[0015] Add the lentivirus solution harvested in step 1 and DMEM complete medium containing 1 vol% FBS to the well-growing Marc145 cells. After culturing in a 37°C incubator for 6 hours, wash with PBS three times, replace with DMEM complete medium containing 10 vol% FBS, and continue culturing for 48 hours. Add puromycin to a final concentration of 6 μg / mL for drug screening. After the resistant cells infected with the lentivirus have grown to fill the monolayer, cell passage is performed, and puromycin is added to a final concentration of 6 μg / mL for drug screening. After repeated screening for 5 generations, the resistant cell clones with a fluorescent cell ratio greater than 80% are obtained, which are the Marc145 cell lines with PTBP1 gene knockdown.

[0016] In addition, the present invention also provides the use of the Marc145 cell line described above to propagate PRRSV virus.

[0017] Finally, the present invention also discloses a method for propagating PRRSV virus, which adopts the Marc145 cell line as described above to propagate PRRSV virus.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The PTBP1 gene knocked-down Marc145 cell line provided by the present invention can be used for studying the function of the PTBP1 protein and the mechanism of its influence on PRRSV replication, and the PTBP1 gene can be used as a novel target for the development of vaccine drugs for inhibiting PRRSV replication and disease-resistant breeding; the knocked-down cell line can inhibit the transcription of IFNβ, thereby significantly improving the replication of PRRSV, can be used for PRRSV vaccine production cell lines, reduce clinical production costs, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1A for shRNA-NC cell lines;

[0021] Figure 1B This is the PTBP1-shRNA1 cell line;

[0022] Figure 1C This is the PTBP1-shRNA2 cell line;

[0023] Figure 1D This is the PTBP1-shRNA3 cell line;

[0024] Figure 2A The cell line is Marc145-shPTBP1-1;

[0025] Figure 2B The cell line is Marc145-shPTBP1-2;

[0026] Figure 2C The cell line is Marc145-shPTBP1-3;

[0027] Figure 3 This is the result of detecting the mRNA transcription level of PTBP1 gene in knockdown cell lines;

[0028] Figure 4 This is the result of detecting the expression level of PTBP1 protein in knockdown cell lines;

[0029] Figure 5 The results of the test on the effect of PTBP1 knockdown on PRRSV replication;

[0030] Figure 6 The results of the test on the effect of PTBP1 knockdown on the IFNβ signaling pathway;

[0031] Figure 7 This is the map of the pLKO.1-CMV-copGFP-PURO vector;

[0032] Figure 8 is the plasmid map of psPAX2;

[0033] Fig. 9 This is the plasmid map of pMD2.G. DETAILED DESCRIPTION

[0034] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] Product information:

[0036] (1) Cells and viruses

[0037] Marc145 cells, HEK293T cells and PRRSV JXA1R virus strain were preserved by Zhaoqing Dahuanong Biopharmaceutical Co., Ltd.

[0038] (2) Plasmid

[0039] The pLKO.1-CMV-copGFP-PURO vector and the lentiviral packaging auxiliary plasmids psPAX2 and pMD2.G were purchased from Beijing Qingke Biotechnology Co., Ltd.

[0040] (3) Antibodies and Reagents

[0041] Rabbit PTBP1 monoclonal antibody was purchased from ABclonal;

[0042] Mouse anti-β-actin monoclonal antibody was purchased from Beijing Quanshijin Biotechnology Co., Ltd.;

[0043] HRP-labeled goat anti-mouse and goat anti-rabbit IgG were purchased from Abcam;

[0044] RIPA lysis buffer and PMSF inhibitor were purchased from Bio-Time;

[0045] Lipofectamine TM 3000 transfection reagent, Lipofectamine TM RNAiMAX transfection reagent, Opti-MEM TM IReduced Serum Medium was purchased from Thermo Fisher Scientific;

[0046] Puromycin was purchased from Shenzhen Dakowei Company;

[0047] poly(I:C) was purchased from Invivogen;

[0048] PrimeScript, a reverse transcription reagent specifically for quantitative PCR TM RT reagent Kit with gDNA Eraser, high specificity qPCR reagent TB Premix Ex Taq TM II was purchased from TaKaRa.

[0049] Part I

[0050] 1.1 Design of PTBP1 shRNA and construction of recombinant plasmid

[0051] Search the monkey PTBP1 (XM_007994539.1) gene sequence (SEQ ID NO. 4) published in GenBank;

[0052] According to the shRNA design principle, three PTBP1 target sequences were selected as interference sites (PTBP1-target1: CGGCATTGTCCCAGATATA; PTBP1-target2: GCACAGTGTTGAAGATCAT; PTBP1-target3: GCGTGAAGATCCTGTTCAA), shRNA sequences were synthesized, and constructed into the restriction enzyme sites AgeⅠ and EcoRⅠ of the pLKO.1-CMV-copGFP-PURO vector (completed by Beijing Qingke Biotechnology Co., Ltd., and its nucleotide sequence is shown in SEQ ID NO.5, and the map is shown in Figure 7 After sequencing, the shRNA recombinant plasmid pLKO.1-CMV-copGFP-PURO-PTBP1-shRNA was determined to have the following sequence:

[0053] PTBP1-shRNA1 (SEQ ID NO.1):

[0054] CCGGCGGCATTGTCCCAGATATACTCGAGTATATCTGGGACAATGCCGTTTTTT

[0055] PTBP1-shRNA2 (SEQ ID NO.2):

[0056] CCGGGCACAGTGTTGAAGATCATCTCGAGATGATCTTCAACACTGTGCTTTTTT

[0057] PTBP1-shRNA3 (SEQ ID NO.3):

[0058] CCGGGCGTGAAGATCCTGTTCAACTCGAGTTGAACAGGATCTTCACGCTTTTTT

[0059] 1.2 Lentiviral packaging

[0060] HEK293T cells were plated in 10 cm cell culture dishes in advance and transfected after they grew to a suitable density. Lipofectamine 3000 transfection reagent was used to transfect the recombinant shRNA plasmid: psPAX2 plasmid (see the map) Figure 8 ): pMD2.G plasmid (map see Fig. 9 )=4:3:1 ratio to co-transfect 20μg plasmid, and set up a control group at the same time, the transfection steps are as follows: Liquid A is Lipofectamine diluted in Opti-MEM medium TM 3000 reagent mixture, solution B is to dilute the plasmid DNA with Opti-MEM medium to prepare the DNA premix, and then add P3000 TM Mix the reagents, mix equal volumes of solution A and solution B, incubate for 15 minutes, add to 293T cells, and gently shake to mix them evenly with the culture medium. Wash with PBS 3 times 6 hours after transfection, change to 1vol% FBSDMEM culture medium and continue to culture for 48 hours, harvest the supernatant (lentivirus solution), that is, the packaged lentivirus, and store it in a -80℃ refrigerator for later use.

[0061] 1.3 Establishment and identification of PTBP1 knockdown cell lines

[0062] (1) Lentivirus infection and knockdown cell line screening: Marc145 cells were plated in 6-well plates. When the cell density was about 70%, 1 mL of the harvested lentivirus solution and 1 mL of DMEM medium containing 1 vol% fetal bovine serum (FBS) were added to each well. After culturing in a 37°C incubator for 6 h, the cells were washed three times with PBS and replaced with DMEM complete medium containing 10 vol% fetal bovine serum (FBS). The cells were cultured for about 48 h, and puromycin was added to a final concentration of 6 μg / mL for drug screening. After 3 to 4 days of screening, all normal cells not infected with the lentivirus died, and the resistant cells infected with the lentivirus grew to fill the monolayer, the cells were passaged, and puromycin was added to a final concentration of 6 μg / mL for drug screening. After 5 generations of repeated screening, three resistant cell clones with a fluorescent cell ratio greater than 80% were obtained. Figures 1B to 1D As shown, they were named PTBP1-shRNA1 cell line, PTBP1-shRNA2 cell line and PTBP1-shRNA3 cell line respectively.

[0063] in, Figure 1A for shRNA-NC cell lines;

[0064] Figure 1B This is the PTBP1-shRNA1 cell line;

[0065] Figure 1C This is the PTBP1-shRNA2 cell line;

[0066] Figure 1D This is the PTBP1-shRNA3 cell line.

[0067] The obtained cell clones were diluted by limiting dilution method, and 1 to 2 cells were inoculated into each well of a 96-well plate. The growth status of the cells in each well was observed, and the wells with single cloned cell clusters were selected for expansion culture. The obtained cell lines were named Marc145-shPTBP1-1 cell line, Marc145-shPTBP1-2 cell line, and Marc145-shPTBP1-3 cell line. FIG. 2A to FIG. 2C As shown; during the process, some control group cells and knockdown cells were taken to collect total RNA and total protein, and RT-qPCR and Western blot methods were used to detect the mRNA transcription and protein expression levels of the PTBP1 gene in the knockdown cell line.

[0068] in, Figure 2A The cell line is Marc145-shPTBP1-1;

[0069] Figure 2B The cell line is Marc145-shPTBP1-2;

[0070] Figure 2C The cell line is Marc145-shPTBP1-3.

[0071] (2) RT-qPCR detection

[0072] Total RNA was extracted using Trizol reagent and quantified according to PrimeScript TM RT reagent Kit with gDNA Eraser kit reverse transcribes RNA into cDNA. The reverse transcription steps are shown in Table 1 and Table 2:

[0073] Table 1 Genome DNA removal reaction system

[0074] Reagents Usage 5×gDNA Eraser Buffer 2.0μL gDNA Eraser 1.0μL Total RNA 1 μg <![CDATA[RNase Free dH2O]]> up to 10μL

[0075] The reaction system was set to 42°C in the PCR instrument, incubated for 2 min, and then proceeded to the next step.

[0076] Table 2 RNA reverse transcription reaction

[0077]

[0078] The parameters of the reaction system in the PCR instrument were set to 37°C for 15 min and 85°C for 5 sec, and the reverse transcription product was obtained.

[0079] According to TB Premix Ex TaqTM II kit was used to prepare the reaction system for qPCR experiment, and the system is shown in Table 3.

[0080] Table 3 Fluorescence quantitative PCR reaction system

[0081]

[0082]

[0083] The PCR reaction was performed using the QuantStudio 3 fluorescence quantitative PCR instrument. The reaction procedure was: 95°C pre-denaturation for 3 min, 1 cycle; 95°C denaturation for 3 sec, 60°C annealing and extension for 30 sec, 40 cycles; 72°C for 30 sec, and fluorescence collection at 72°C. The results were displayed in the form of cycle threshold (CT) values. -△△CT Methods: GAPDH was used as the internal reference gene to calculate the data and analyze the gene expression level. The qPCR primers used are shown in Table 4.

[0084] Table 4 qPCR primers for PTBP1 knockdown detection

[0085] Gene Sequence (5'-3') SEQ ID NO mGAPDH-F ACGATGACATCAAGAAGGTGGTGAAG 6 mGAPDH-R GTGTCGCTGTTGAAGTCAGAGGAG 7 mPTBP1-F GAAGCTCCCCATCGACGTCACA 8 mPTBP1-R AGCCTCCTCCGTGTTCATCTCG 9

[0086] The results showed that the mRNA transcription levels of PTBP1 gene in the three Marc145 knockdown cell lines were significantly lower than those in the control group. Figure 3 .

[0087] (3) Western blot detection

[0088] Control cells and knockdown cells were collected, lysed by adding RIPA lysis buffer containing 1mM PMSF, centrifuged at 14000g for 5 minutes, and the supernatant was collected. The protein concentration of the sample was determined using a BCA kit, and 5× protein loading buffer was added. The cells were boiled at 100℃ for 10min. After SDS-PAGE electrophoresis, they were transferred to NC membranes and blocked with TBST containing 5vol% skim milk at room temperature for 2h. Incubated with the corresponding primary antibody overnight at 4℃. Washed with TBST three times for 10min each time, and then incubated with goat anti-mouse or goat anti-rabbit IgG-HRP secondary antibodies at room temperature for 1h. Washed with TBST three times for 10min each time, and the membrane was scanned and colored according to the instructions of the ECL chemiluminescent solution. Western blot results showed that the expression level of PTBP1 protein in the three selected monoclonal cell lines was significantly reduced, as can be seen in the results. Figure 4 .

[0089] In summary, the results of the present invention have constructed three PTBP1 knockdown Marc145 cell lines, which can be used for subsequent research.

[0090] Part 2

[0091] Effect of PTBP1 knockdown on PRRSV replication

[0092] To study the effect of PTBP1 gene knockdown on PRRSV proliferation, control cells and PTBP1 knockdown cell lines were infected with PRRSV at 0.1 MOI, and cell samples were collected 12h and 24h after infection. 50 The results showed that knocking down the PTBP1 gene significantly promoted the replication of PRRSV in Marc145 cells. Compared with the control group cells, the virus titer of PRRSV increased by 1-1.5 titers after knocking down the PTBP1 gene, which is equivalent to a 10-30-fold increase in the virus content. This indicates that the cell line has the potential to be used for the industrial production of PRRSV vaccines, which can significantly reduce production costs, improve quality and increase efficiency. Figure 5 .

[0093] 2.2 Effect of PTBP1 knockdown on IFNβ signaling pathway

[0094] Previous studies have shown that PTBP1 plays an important role in the type I IFN pathway. The present invention further studies the effect of PTBP1 on the IFNβ signaling pathway. The PTBP1 knockdown cell line was inoculated in a 6-well plate and infected with PRRSV when its density grew to about 70%. After a certain period of infection, poly(I:C) (1μg / mL) was transfected and incubated in a 37°C incubator for 6 hours. The cells were harvested and total cell RNA was extracted to detect the effect of PTBP1 knockdown on the IFNβ signaling pathway (primers are shown in Table 5). The results show that Figure 6 , the results showed that knockdown of PTBP1 inhibited the transcription of IFNβ, which may also be one of the mechanisms by which its knockdown can promote PRRSV replication.

[0095] Table 5 Primers for IFNβ qPCR detection in PTBP1 knockdown cell lines

[0096] Gene Sequence (5'-3') SEQ ID NO mIFNβ-F TGCTCTCCTGTTGTGCTTCTC 10 mIFNβ-R CTGCGGCTGCTTAATTTCCTC 11

[0097] In summary, the present invention provides a method for knocking down the PTBP1 gene. By designing a shRNA sequence targeting the PTBP1 gene, Marc145 cells were infected by lentivirus packaging, and three stable cell lines with PTBP1 knockdown were screened, namely, Marc145-shPTBP1-1 cell line, Marc145-shPTBP1-2 cell line and Marc145-shPTBP1-3 cell line. These cell lines include but are not limited to the following applications:

[0098] (1) The knockdown cell line significantly promoted the proliferation titer of PRRSV and had the potential to be used for large-scale industrial production of PRRSV, which could significantly reduce production costs;

[0099] (2) The knockdown cell lines provide biological materials for studying the role and function of PTBP1 in the type I IFN pathway and have broad application prospects;

[0100] (3) The results of the present invention indicate that the PTBP1 gene can be used as a new target for the development of vaccine drugs to inhibit PRRSV replication and for disease-resistant breeding.

[0101] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

Claims

1. A Marc145 cell line, characterized in that: The Marc145 cell line is a Marc145 cell line in which the PTBP1 gene is knocked down.

2. The method for preparing the Marc145 cell line according to claim 1, characterized in that: The steps include: Step 1: Preparation of lentivirus: co-transfect HEK293T cells with recombinant shRNA plasmid, psPAX2 plasmid, and pMD2.G plasmid to obtain lentivirus; Step 2: Infect Marc145 cells with lentivirus, and obtain Marc145 cell lines with PTBP1 gene knockdown through screening; The recombinant shRNA plasmid comprises a vector and the shRNA loaded on the vector; the nucleotide sequence of the shRNA is shown in any one of SEQ ID NOs. 1-3.

3. The preparation method according to claim 2, characterized in that: The step 1 specifically includes: using Lipofectamine 3000 transfection reagent to co-transfect HEK293T cells with the recombinant shRNA plasmid, psPAX2 plasmid, and pMD2.G plasmid at a weight ratio of 4:3:1, and the total weight of the recombinant shRNA plasmid, psPAX2 plasmid, and pMD2.G plasmid is 20 μg.

4. The preparation method according to claim 2, characterized in that: The step 2 is specifically as follows: Add the lentivirus solution harvested in step 1 and DMEM complete medium containing 1 vol% FBS to the well-growing Marc145 cells. After culturing in a 37°C incubator for 6 hours, wash with PBS three times, replace with DMEM complete medium containing 10 vol% FBS, and continue culturing for 48 hours. Add puromycin to a final concentration of 6 μg / mL for drug screening. After the resistant cells infected with the lentivirus have grown to fill the monolayer, cell passage is performed, and puromycin is added to a final concentration of 6 μg / mL for drug screening. After repeated screening for 5 generations, the resistant cell clones with a fluorescent cell ratio greater than 80% are obtained, which are the Marc145 cell lines with PTBP1 gene knockdown.

5. Use of the Marc145 cell line as claimed in claim 1 to propagate PRRSV virus.

6. A method for propagating PRRSV virus, characterized in that: The Marc145 cell line as described in claim 1 is used to propagate PRRSV virus.

Images