Oncolytic virus and application thereof

Abstract

The invention relates to the technical field of biological medicine, and particularly discloses an oncolytic virus and application thereof. The oncolytic virus comprises an M protein and a G protein, and compared with an amino acid sequence shown in SEQ ID NO 1, amino acids of the M protein are substituted by N32S, N49D, M51R, H54Y, V221F, V225I and S226R; compared with the amino acid sequence shown in SEQ ID NO 3, the amino acid substitution of the G protein is selected from any one of the substitution groups provided by the invention; the invention also relates to an expression vector of the oncolytic virus, a virus producing cell for producing the oncolytic virus, and a pharmaceutical composition comprising the oncolytic virus. The invention also discloses a preparation method and application of the oncolytic virus, the oncolytic virus expression vector, the virus producing cell and / or the pharmaceutical composition. The safety and the cure rate of the oncolytic virus can be effectively improved.

Description

[0001] This application is a divisional application with an application date of January 26, 2022, application number 2022100948691, and invention name “Oncolytic viruses and their applications”. Technical Field

[0002] The present application relates to the technical field of biomedicine, and more specifically, to an oncolytic virus and its application. Background Art

[0003] Oncolytic viruses are a type of tumor-killing virus with replication ability, and are now accepted by the public as an important branch of tumor immunotherapy. Oncolytic viruses can specifically target and infect tumor cells, for example, by taking advantage of the inactivation or defects of tumor suppressor genes in tumor cells to selectively infect tumor cells; after oncolytic viruses infect tumor cells, they will replicate in large quantities in tumor cells and eventually destroy tumor cells, thereby killing tumor cells. At the same time, oncolytic viruses can also provide the immune stimulation signals necessary to enhance the host's own anti-cancer response, thereby attracting more immune cells to continue to kill residual tumor cells.

[0004] Although oncolytic viruses have good application prospects in tumor immunotherapy, wild-type oncolytic viruses often cause problems such as inflammation of the body's nervous system. In the process of using wild-type viruses to infect tumor cells, there is still a great risk of pathogenicity. Therefore, in order to further promote the clinical application of oncolytic viruses, it is necessary to transform wild-type oncolytic viruses to obtain attenuated oncolytic viruses. The attenuated oncolytic viruses are used in clinical applications to reduce the pathogenic risk of oncolytic viruses and improve the safety of oncolytic viruses.

[0005] However, in the process of modifying oncolytic viruses, if only the wild-type oncolytic viruses are randomly genetically modified, although their toxicity can be reduced, the modified oncolytic viruses may have a poor cure rate, or even be unable to be packaged, which is not conducive to promoting the clinical application of oncolytic viruses. Therefore, providing a modified oncolytic virus with good safety performance and high cure rate has important scientific research value and application significance in the field of tumor immunotherapy. Summary of the invention

[0006] In order to improve the safety and cure rate of oncolytic viruses, the present application provides an oncolytic virus and its application.

[0007] In the first aspect, the present application provides an oncolytic virus, which adopts the following technical solution:

[0008] An oncolytic virus, comprising an M protein and a G protein;

[0009] Compared with the amino acid sequence shown in SEQ ID NO 1, the amino acid substitutions of the M protein are N32S, N49D, M51R, H54Y, V221F, V225I, and S226R;

[0010] Compared with the amino acid sequence shown in SEQ ID NO 3, the amino acid substitution of the G protein is selected from any one of the following groups:

[0011] 1) The amino acid of the G protein is substituted with V53I;

[0012] 2) the amino acids of the G protein are substituted with V53I and A141V;

[0013] 3) The amino acid substitutions of the G protein are V53I, A141V, and D172Y;

[0014] 4) the amino acid substitutions of the G protein are V53I, A141V, D172Y, and K217E;

[0015] 5) The amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, and D232G;

[0016] 6) the amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, and V331A;

[0017] 7) The amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, and V371E;

[0018] 8) the amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D;

[0019] 9) The amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, and T438S;

[0020] 10) The amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, and F453L;

[0021] 11) The amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, and T471I;

[0022] 12) The amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H;

[0023] 13) The amino acid substitutions of the G protein are A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H;

[0024] 14) The amino acid substitutions of the G protein are D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H;

[0025] 15) The amino acid substitutions of the G protein are K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H;

[0026] 16) The amino acid substitutions of the G protein are D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H;

[0027] 17) The amino acid substitutions of the G protein are V331A, V371E, G436D, T438S, F453L, T471I, and Y487H;

[0028] 18) The amino acid substitutions of the G protein are V371E, G436D, T438S, F453L, T471I, and Y487H;

[0029] 19) The amino acid substitutions of the G protein are G436D, T438S, F453L, T471I, and Y487H;

[0030] 20) The amino acid substitutions of the G protein are T438S, F453L, T471I, and Y487H;

[0031] 21) The amino acid substitutions of the G protein are F453L, T471I, and Y487H;

[0032] 22) The amino acid substitutions of the G protein are T471I and Y487H;

[0033] 23) The amino acid substitution of the G protein is Y487H.

[0034] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 2.

[0035] In a specific embodiment, the G protein has an amino acid substitution of V53I.

[0036] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V.

[0037] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, and D172Y.

[0038] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, and K217E.

[0039] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, and D232G.

[0040] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, and V331A.

[0041] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, and V371E.

[0042] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, and G436D.

[0043] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, and T438S.

[0044] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, and F453L.

[0045] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I.

[0046] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0047] In a specific embodiment, the G protein has amino acid substitutions of A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0048] In a specific embodiment, the G protein has amino acid substitutions of D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0049] In a specific embodiment, the G protein has amino acid substitutions of K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0050] In a specific embodiment, the G protein has amino acid substitutions of D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0051] In a specific embodiment, the G protein has amino acid substitutions of V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0052] In a specific embodiment, the G protein has amino acid substitutions of V371E, G436D, T438S, F453L, T471I, and Y487H.

[0053] In a specific embodiment, the G protein has amino acid substitutions of G436D, T438S, F453L, T471I, and Y487H.

[0054] In a specific embodiment, the G protein has amino acid substitutions of T438S, F453L, T471I, and Y487H.

[0055] In a specific embodiment, the G protein has amino acid substitutions of F453L, T471I, and Y487H.

[0056] In a specific embodiment, the G protein has amino acid substitutions of T471I and Y487H.

[0057] In a specific embodiment, the G protein has an amino acid substitution of Y487H.

[0058] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 4.

[0059] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 5.

[0060] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 6.

[0061] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 7.

[0062] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 8.

[0063] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 9.

[0064] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 10.

[0065] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 11.

[0066] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 12.

[0067] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 13.

[0068] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 14.

[0069] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 15.

[0070] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 16.

[0071] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 17.

[0072] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 18.

[0073] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 19.

[0074] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 20.

[0075] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 21.

[0076] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 22.

[0077] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 23.

[0078] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 24.

[0079] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 25.

[0080] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 26.

[0081] Optionally, the oncolytic virus further comprises N protein;

[0082] Compared with the amino acid sequence shown in SEQ ID NO 1, the amino acid substitutions of the M protein are N32S, N49D, M51R, H54Y, V221F, V225I, and S226R;

[0083] Compared with the amino acid sequence shown in SEQ ID NO 3, the amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H;

[0084] Compared with the amino acid sequence shown in SEQ ID NO 27, the amino acid substitution of the N protein is selected from any one of the following groups:

[0085] 1) The amino acid of the N protein is substituted with I14V;

[0086] 2) the amino acid substitutions of the N protein are I14V and R155K;

[0087] 3) the amino acid substitutions of the N protein are I14V, R155K, S353N;

[0088] 4) the amino acid substitutions of the N protein are R155K and S353N;

[0089] 5) The amino acid substitution of the N protein is S353N.

[0090] In a specific embodiment, the N protein has an amino acid substitution of I14V.

[0091] In a specific embodiment, the N protein has amino acid substitutions of I14V, R155K.

[0092] In a specific embodiment, the N protein has amino acid substitutions of I14V, R155K, and S353N.

[0093] In a specific embodiment, the N protein has amino acid substitutions of R155K, S353N.

[0094] In a specific embodiment, the N protein has an amino acid substitution of S353N.

[0095] In a specific embodiment, the N protein comprises the amino acid sequence shown in SEQ ID NO 28.

[0096] In a specific embodiment, the N protein comprises the amino acid sequence shown in SEQ ID NO 29.

[0097] In a specific embodiment, the N protein comprises the amino acid sequence shown in SEQ ID NO 30.

[0098] In a specific embodiment, the N protein comprises the amino acid sequence shown in SEQ ID NO 31.

[0099] In a specific embodiment, the N protein comprises the amino acid sequence shown in SEQ ID NO 32.

[0100] Optionally, the oncolytic virus further comprises a P protein;

[0101] Compared with the amino acid sequence shown in SEQ ID NO 1, the amino acid substitutions of the M protein are N32S, N49D, M51R, H54Y, V221F, V225I, and S226R;

[0102] Compared with the amino acid sequence shown in SEQ ID NO 3, the amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H;

[0103] Compared with the amino acid sequence shown in SEQ ID NO 27, the amino acid substitutions of the N protein are I14V, R155K, and S353N;

[0104] Compared with the amino acid sequence shown in SEQ ID NO 33, the amino acid substitution of the P protein is selected from any one of the following groups:

[0105] 1) The amino acid of the P protein is substituted with R50K;

[0106] 2) the amino acid substitutions of the P protein are R50K and V76A;

[0107] 3) the amino acid substitutions of the P protein are R50K, V76A, and D99E;

[0108] 4) The amino acid substitutions of the P protein are R50K, V76A, D99E, and L126S;

[0109] 5) The amino acid substitutions of the P protein are R50K, V76A, D99E, L126S, and L140S;

[0110] 6) The amino acid substitutions of the P protein are R50K, V76A, D99E, L126S, L140S, H151Y;

[0111] 7) The amino acid substitutions of the P protein are R50K, V76A, D99E, L126S, L140S, H151Y, and I168M;

[0112] 8) The amino acid substitutions of the P protein are R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E;

[0113] 9) The amino acid substitutions of the P protein are R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, and Y189S;

[0114] 10) The amino acid substitutions of the P protein are R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D;

[0115] 11) The amino acid substitutions of the P protein are V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D;

[0116] 12) The amino acid substitutions of the P protein are D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D;

[0117] 13) The amino acid substitutions of the P protein are L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D;

[0118] 14) The amino acid substitutions of the P protein are L140S, H151Y, I168M, K170E, Y189S, and N237D;

[0119] 15) The amino acid substitutions of the P protein are H151Y, I168M, K170E, Y189S, and N237D;

[0120] 16) The amino acid substitutions of the P protein are I168M, K170E, Y189S, and N237D;

[0121] 17) The amino acid substitutions of the P protein are K170E, Y189S, and N237D;

[0122] 18) The amino acid substitutions of the P protein are Y189S and N237D;

[0123] 19) The amino acid substitution of the P protein is N237D.

[0124] In a specific embodiment, the P protein has an amino acid substitution of R50K.

[0125] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A.

[0126] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, and D99E.

[0127] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, and L126S.

[0128] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S.

[0129] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, and H151Y.

[0130] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, H151Y, and I168M.

[0131] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, and K170E.

[0132] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, and Y189S.

[0133] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0134] In a specific embodiment, the P protein has amino acid substitutions of V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0135] In a specific embodiment, the P protein has amino acid substitutions of D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0136] In a specific embodiment, the P protein has amino acid substitutions of L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0137] In a specific embodiment, the P protein has amino acid substitutions of L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0138] In a specific embodiment, the P protein has amino acid substitutions of H151Y, I168M, K170E, Y189S, and N237D.

[0139] In a specific embodiment, the P protein has amino acid substitutions of I168M, K170E, Y189S, and N237D.

[0140] In a specific embodiment, the P protein has amino acid substitutions of K170E, Y189S, and N237D.

[0141] In a specific embodiment, the P protein has amino acid substitutions of Y189S and N237D.

[0142] In a specific embodiment, the P protein has an amino acid substitution of N237D.

[0143] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 34.

[0144] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO35.

[0145] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 36.

[0146] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 37.

[0147] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 38.

[0148] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 39.

[0149] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 40.

[0150] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 41.

[0151] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 42.

[0152] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 43.

[0153] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 44.

[0154] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 45.

[0155] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 46.

[0156] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 47.

[0157] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 48.

[0158] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 49.

[0159] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 50.

[0160] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 51.

[0161] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 52.

[0162] In some specific embodiments, the oncolytic virus is based on a rod-shaped virus and is obtained by site-directed mutagenesis.

[0163] In some specific embodiments, the oncolytic virus is obtained by site-directed mutagenesis based on Vesicular Stomatitis Virus (abbreviated as "VSV").

[0164] In some specific embodiments, the oncolytic virus is obtained by site-directed mutagenesis based on the Indiana MuddSummer subtype of VSV virus.

[0165] In some specific embodiments, the oncolytic virus contains or expresses an exogenous protein of interest.

[0166] In some specific embodiments, the nucleic acid sequence encoding the exogenous target protein is located between the nucleic acid sequence encoding the M protein with amino acid substitution, and / or the nucleic acid sequence encoding the G protein with amino acid substitution, and / or the nucleic acid sequence encoding the N protein with amino acid substitution, and / or the nucleic acid sequence encoding the P protein with amino acid substitution.

[0167] In a second aspect, the present application provides an oncolytic virus expression vector, which adopts the following technical solution:

[0168] An oncolytic virus expression vector, which is capable of producing any oncolytic virus described in the present application.

[0169] In a third aspect, the present application provides a virus production cell, which adopts the following technical solution:

[0170] A virus producing cell, wherein the virus producing cell is capable of producing any oncolytic virus described in the present application.

[0171] In a fourth aspect, the present application provides a pharmaceutical composition, which adopts the following technical solution:

[0172] A pharmaceutical composition comprising any oncolytic virus described in the present application, and optionally a pharmaceutically acceptable carrier.

[0173] In a fifth aspect, the present application provides a method for preparing the above-mentioned oncolytic virus, oncolytic virus expression vector, virus production cell and / or pharmaceutical composition.

[0174] In a sixth aspect, the present application provides the use of the above-mentioned oncolytic viruses, oncolytic virus expression vectors, virus production cells and / or pharmaceutical compositions in the preparation of drugs for preventing and / or treating diseases and / or conditions for continuous killing of abnormal cells.

[0175] In some specific embodiments, the oncolytic virus, oncolytic virus expression vector, virus production cell and / or pharmaceutical composition is used in a method for slowly and continuously killing abnormally proliferative cells.

[0176] In some specific embodiments, the disease and / or condition comprises: abnormally proliferative cells selected from tumor cells or cells related to tumor tissue; preferably, the tumor cells are cancer cells; more preferably, the cancer cells are metastatic cancer cells.

[0177] In some specific embodiments, the tumor comprises a solid tumor and / or a hematological tumor.

[0178] In summary, this application has the following beneficial effects:

[0179] The oncolytic viruses provided in this application have good infection ability and in vitro killing ability for abnormal hyperplasia (tumor) LLC cells, 4T1 cells, MC38 cells and Hela cells, and are not easy to remove in LLC cells, 4T1 cells, MC38 cells and Hela cells. In addition, the oncolytic viruses provided in this application have poor infection ability and in vitro killing ability for normal MEF cells, and the oncolytic viruses provided in this application are easy to remove in normal MEF cells. Therefore, the oncolytic viruses provided in this application can be used for infection and killing of cells such as tumors and cancers, and are not easy to remove in cells such as tumors and cancers, further improving the cure rate of oncolytic viruses for cells such as tumors and cancers; at the same time, the oncolytic viruses provided above will not damage normal cells, and are easier to remove in normal cells, further ensuring the safety of normal cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0180] Figure 1 The results of the detection of the oncolytic virus prepared in this application and the wild-type oncolytic virus's ability to infect LLC cells.

[0181] Figure 2 The results of the test oncolytic virus prepared in this application and the wild-type oncolytic virus on the infection ability of 4T1 cells.

[0182] Figure 3 The results of the test on the infection ability of the oncolytic virus prepared in this application and the wild-type oncolytic virus on MC38 cells.

[0183] Figure 4 The results of the test on the infection ability of the oncolytic virus prepared in this application and the wild-type oncolytic virus on Hela cells.

[0184] Figure 5 The results of the test oncolytic virus prepared in this application and the wild-type oncolytic virus on the infection ability of MEF cells.

[0185] Figure 6 The results of the in vitro killing ability of the oncolytic virus prepared in this application and the wild-type oncolytic virus on LLC cells.

[0186] Figure 7 The results of the in vitro killing ability of the oncolytic virus prepared in this application and the wild-type oncolytic virus on 4T1 cells.

[0187] Figure 8 The results of the in vitro killing ability of the oncolytic virus prepared in this application and the wild-type oncolytic virus on MC38 cells.

[0188] Fig. 9The results of the in vitro killing ability of the oncolytic virus prepared in this application and the wild-type oncolytic virus on Hela cells.

[0189] Fig.10 The results of the in vitro killing ability of the oncolytic virus prepared in this application and the wild-type oncolytic virus on MEF cells are shown.

[0190] Fig.11 The oncolytic virus prepared in this application and the wild-type oncolytic virus induce the expression of IFN-β in LLC cells.

[0191] Fig.12 The oncolytic virus prepared in this application and the wild-type oncolytic virus induce the expression of IFN-β in 4T1 cells.

[0192] Fig.13 The oncolytic virus prepared in this application and the wild-type oncolytic virus induce the expression of IFN-β in MC38 cells.

[0193] Fig.14 The oncolytic virus prepared in this application and the wild-type oncolytic virus induce the expression of IFN-β in Hela cells.

[0194] Fig.15 The oncolytic virus prepared in this application and the wild-type oncolytic virus induce the expression of IFN-β in MEF cells.

[0195] In the above figures, number 0 on the horizontal axis represents the wild-type oncolytic virus; numbers 1-47 on the horizontal axes represent the oncolytic viruses prepared in Preparation Examples 1-47, respectively.

[0196] Vertical axis Log 10 TCID50 represents the TCID50 value calculated by Karber method, Log 10 The larger the TCID50 value, the better the oncolytic virus's ability to infect the cell; Log 10 The smaller the TCID50 value, the worse the oncolytic virus's ability to infect the cell;

[0197] Vertical axis OD 570 Indicates the OD value of the cell, OD 570 The larger the value, the weaker the killing ability of oncolytic virus to the cell; 570 The smaller the value, the better the killing ability of the oncolytic virus to the cell.

[0198] The IFN-β level on the vertical axis represents the expression of the IFN-β gene. The larger the IFN-β level, the weaker the ability of the oncolytic virus to reproduce in the cell and the easier it is to clear. The smaller the IFN-β level, the stronger the ability of the oncolytic virus to reproduce in the cell and the more difficult it is to clear.

[0199] Those skilled in the art can easily perceive other aspects and advantages of the present application from the detailed description below. In the detailed description below, only exemplary embodiments of the present application are shown and described. As will be appreciated by those skilled in the art, the content of the present application enables those skilled in the art to modify the disclosed specific embodiments without departing from the spirit and scope of the invention to which the present application relates. Accordingly, the description in the drawings and specification of the present application is merely exemplary and not restrictive. DETAILED DESCRIPTION

[0200] The following is an explanation of the implementation of the present invention by means of specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0201] Definition of terms

[0202] In the present application, the term "oncolytic virus" generally refers to a virus that can replicate in tumor cells and kill tumor cells. Oncolytic viruses include, but are not limited to, vesicular stomatitis virus (Vesicular Stomatitis Virus, referred to as "VSV virus"), poxvirus, herpes simplex virus, measles virus, Semliki Forest virus, poliovirus, reovirus, Seneca Valley virus, echovirus, coxsackievirus, Newcastle disease virus and Maraba virus. In certain embodiments, the oncolytic virus is modified to improve the selectivity for tumor cells. In certain embodiments, the oncolytic virus is modified to reduce its immunogenicity. In some embodiments, the oncolytic virus described in the present application is a VSV virus. In some embodiments, the VSV virus is a mutant of the Indiana Mudd Summer subtype strain of the VSV virus. In some embodiments, the M protein of the VSV virus, and / or the G protein, and / or the N protein, and / or the P protein can be subjected to site-directed gene mutation.

[0203] In certain embodiments, the oncolytic virus described in the present application may be an oncolytic virus modified at the gene level, such as modified by modification of one or more genes, so as to improve its tumor selectivity and / or preferentially replicate in dividing cells. The modification of the gene level may be a modification of genes involved in DNA replication, nucleic acid metabolism, host tropism, surface attachment, toxicity, lysis and diffusion processes, or may be a modification of integrated exogenous genes. The exogenous genes may include exogenous immunomodulatory genes, exogenous screening genes, exogenous reporter genes, etc. The modified oncolytic virus may also be an oncolytic virus modified at the amino acid level, such as insertion, deletion, or substitution of one or more amino acids.

[0204] In the present application, the term "M protein" generally refers to VSV viral matrix protein. M protein is an important virulence factor of VSV virus and is also a protein in VSV virus known to interfere with the natural immune response of mice. The term "M protein" also includes homologues, orthologues, variants, functionally active fragments, etc. thereof. In the present application, the wild-type VSV virus Indiana MuddSummer subtype M protein may comprise an amino acid sequence as shown in SEQ ID NO 1.

[0205] In the present application, the term "G protein" generally refers to the glycoprotein of the water VSV virus, also known as the envelope protein. The term "G protein" also includes homologs, orthologs, variants, functionally active fragments, etc. thereof. In the present application, the wild-type VSV virus Indiana MuddSummer subtype G protein may include an amino acid sequence as shown in SEQ ID NO 3. In the present application, the G protein of the oncolytic virus may include an amino acid sequence as shown in SEQ ID NO 4-26.

[0206] In the present application, the term "N protein" generally refers to the nucleocapsid protein of the VSV virus. The term "N protein" also includes homologs, orthologs, variants, functionally active fragments, etc. thereof. In the present application, the wild-type VSV virus IndianaMuddSummer subtype N protein may comprise an amino acid sequence as shown in SEQ ID NO 27. In the present application, the N protein of the oncolytic virus may comprise an amino acid sequence as shown in SEQ ID NO 28-32.

[0207] In the present application, the term "P protein" generally refers to the phosphoprotein of the VSV virus. The term "P protein" also includes homologs, orthologs, variants, functionally active fragments, etc. thereof. In the present application, the wild-type VSV virus Indiana MuddSummer subtype P protein may comprise an amino acid sequence as shown in SEQ ID NO 33. In the present application, the P protein of the oncolytic virus may comprise an amino acid sequence as shown in SEQ ID NO 34-52.

[0208] In this application, the expression of protein mutation sites is usually expressed by "amino acid + amino acid position + (amino acid after mutation)". In this application, the mutation may include but is not limited to the addition, replacement, deletion and / or deletion of amino acids. For example, the term "M51R" usually refers to the mutation of methionine M at position 51 to arginine R.

[0209] In the present application, the term "amino acid substitution" generally refers to replacing an amino acid residue present in the parent sequence with another amino acid residue. The amino acid in the parent sequence can be replaced, for example, via chemical peptide synthesis or by recombinant methods known in the art. Therefore, "replacing at position xx" generally refers to replacing the amino acid present at position xx with an alternative amino acid residue. In the present application, the amino acid substitution may include amino acid mutations.

[0210] In this application, the term "mutation" generally refers to a change in the nucleotide or amino acid sequence of a wild-type molecule. Amino acid changes may include substitution, deletion, lack, insertion, addition, truncation, or protein processing or cleavage of amino acids.

[0211] In the present application, the term "expression vector" generally refers to a nucleic acid vector. Under appropriate conditions, it is generally capable of expressing a target gene and / or a target protein. In certain embodiments of the present application, the expression vector includes a nucleic acid molecule for expressing one or more components of a virus (e.g., an oncolytic virus). For example, the expression vector may include at least one viral genome element and may be packaged into a virus or packaged as a virion.

[0212] In the present application, the term "virus production cell" generally refers to a cell, cell line or cell culture that may or already contain a nucleic acid molecule or expression vector described in the present application, or can express the oncolytic virus described in the present application. The cell may include the progeny of a single host cell. The cell may be obtained by in vitro transfection using the expression vector described in the present application.

[0213] In the present application, the term "pharmaceutical composition" generally refers to a preparation that exists in a form that allows the biological activity of the active ingredient to be effective, and it does not contain other ingredients that have unacceptable toxicity to the subject to be administered to the preparation. In certain embodiments, these preparations can include the active ingredient of the medicine and a pharmaceutically acceptable carrier. In certain embodiments, the drug product includes parenteral, percutaneous, intracavitary, intraarterial, intrathecal and / or intranasal administration or direct injection into the drug product in the tissue. The drug product can be administered in different ways, such as intravenous, intraperitoneal, subcutaneous, intramuscular, local or intradermal administration.

[0214] In the present application, the term "prevention" generally refers to preventing the generation and onset, recurrence, and / or spread of a disease or one or more symptoms thereof by taking certain measures in advance. In the present application, the term "treatment" generally refers to eliminating or improving a disease, or one or more symptoms associated with a disease. In certain embodiments, treatment generally refers to applying one or more drugs to a patient suffering from the disease so that the disease is eliminated or alleviated. In certain embodiments, "treatment" can be after the onset of symptoms of a particular disease, in the presence or absence of other drugs, the drug combination and / or drug product is applied. For example, drug combinations and / or drug products described in the present application are used to prevent the generation, development, recurrence and / or metastasis of a tumor.

[0215] In this application, the term "tumor" generally refers to any new pathological tissue proliferation. Tumors may be benign or malignant. In this application, the tumor may be a solid tumor and / or a hematological tumor. For research, these tissues can be isolated from readily available resources by methods well known to those skilled in the art. DETAILED DESCRIPTION OF THE INVENTION

[0217] The present application provides an oncolytic virus, which is based on a wild-type VSV virus, specifically a VSV virus Indiana strain, a VSV virus Indiana MuddSummer subtype strain, and is obtained by mutating sites on the amino acid sequences of its M protein, G protein, N protein, and P protein. The amino acid sequence of its M protein is shown in SEQ ID NO 1; the amino acid sequence of its G protein is shown in SEQ ID NO 3; the amino acid sequence of its N protein is shown in SEQ ID NO 27; and the amino acid sequence of its P protein is shown in SEQ ID NO 33. In the present application, the M protein, G protein, N protein, and P protein can all be modified.

[0218] The present application modifies the VSV virus as follows to obtain an oncolytic virus.

[0219] An oncolytic virus, comprising an M protein and a G protein;

[0220] Compared with the amino acid sequence shown in SEQ ID NO 1, the amino acid substitutions of the M protein are N32S, N49D, M51R, H54Y, V221F, V225I, and S226R;

[0221] Compared with the amino acid sequence shown in SEQ ID NO 3, the G protein comprises an amino acid substitution at one or more of the following sites:

[0222] In the present application, the G protein may comprise an amino acid mutation at position 53.

[0223] In the present application, the G protein may comprise amino acid mutations at positions 53 and 141.

[0224] In the present application, the G protein may comprise amino acid mutations at positions 53, 141 and 172.

[0225] In the present application, the G protein may comprise amino acid mutations at positions 53, 141, 172 and 217.

[0226] In the present application, the G protein may comprise amino acid mutations at positions 53, 141, 172, 217 and 232.

[0227] In the present application, the G protein may comprise amino acid mutations at positions 53, 141, 172, 217, 232 and 331.

[0228] In the present application, the G protein may comprise amino acid mutations at positions 53, 141, 172, 217, 232, 331 and 371.

[0229] In the present application, the G protein may comprise amino acid mutations at positions 53, 141, 172, 217, 232, 331, 371 and 436.

[0230] In the present application, the G protein may comprise amino acid mutations at positions 53, 141, 172, 217, 232, 331, 371, 436 and 438.

[0231] In the present application, the G protein may comprise amino acid mutations at positions 53, 141, 172, 217, 232, 331, 371, 436, 438 and 453.

[0232] In the present application, the G protein may comprise amino acid mutations at positions 53, 141, 172, 217, 232, 331, 371, 436, 438, 453 and 471.

[0233] In the present application, the G protein may comprise amino acid mutations at positions 53, 141, 172, 217, 232, 331, 371, 436, 438, 453, 471 and 487.

[0234] In the present application, the G protein may comprise amino acid mutations at positions 141, 172, 217, 232, 331, 371, 436, 438, 453, 471 and 487.

[0235] In the present application, the G protein may comprise amino acid mutations at positions 172, 217, 232, 331, 371, 436, 438, 453, 471 and 487.

[0236] In the present application, the G protein may comprise amino acid mutations at positions 217, 232, 331, 371, 436, 438, 453, 471 and 487.

[0237] In the present application, the G protein may comprise amino acid mutations at positions 232, 331, 371, 436, 438, 453, 471 and 487.

[0238] In the present application, the G protein may comprise amino acid mutations at positions 331, 371, 436, 438, 453, 471 and 487.

[0239] In the present application, the G protein may comprise amino acid mutations at positions 371, 436, 438, 453, 471 and 487.

[0240] In the present application, the G protein may comprise amino acid mutations at positions 436, 438, 453, 471 and 487.

[0241] In the present application, the G protein may comprise amino acid mutations at positions 438, 453, 471 and 487.

[0242] In the present application, the G protein may comprise amino acid mutations at positions 453, 471 and 487.

[0243] In the present application, the G protein may contain amino acid mutations at positions 471 and 487.

[0244] In the present application, the G protein may comprise an amino acid mutation at position 487.

[0245] In the present application, the G protein may also contain amino acid substitutions at other positions.

[0246] In some embodiments, the G protein comprises at least one or more amino acid substitutions in a conserved region. For example, the conserved region may comprise amino acids 437-461 of the G protein. In some embodiments, the G protein comprises at least one or more amino acid substitutions in a truncated region of the cytoplasmic domain. For example, the truncated region of the cytoplasmic domain may comprise amino acids 483-511 of the G protein.

[0247] In the present application, the G protein may contain at least amino acid substitutions at positions 438, 453, 471 and 487.

[0248] The oncolytic virus further comprises an N protein; compared with the amino acid sequence shown in SEQ ID NO 27,

[0249] In the present application, the N protein may comprise an amino acid mutation at position 14.

[0250] In the present application, the N protein may contain amino acid mutations at positions 14 and 155.

[0251] In the present application, the N protein may contain amino acid mutations at positions 14, 155 and 353.

[0252] In the present application, the N protein may contain amino acid mutations at positions 155 and 353.

[0253] In the present application, the N protein may comprise an amino acid mutation at position 353.

[0254] In the present application, the N protein may also contain amino acid substitutions at other positions.

[0255] The oncolytic virus further comprises a P protein; compared with the amino acid sequence shown in SEQ ID NO 33, it comprises an amino acid substitution at one or more of the following sites:

[0256] In the present application, the P protein may comprise an amino acid mutation at position 50.

[0257] In the present application, the P protein may contain amino acid mutations at positions 50 and 76.

[0258] In the present application, the P protein may contain amino acid mutations at positions 50, 76 and 99.

[0259] In the present application, the P protein may contain amino acid mutations at positions 50, 76, 99 and 126.

[0260] In the present application, the P protein may contain amino acid mutations at positions 50, 76, 99, 126 and 140.

[0261] In the present application, the P protein may comprise amino acid mutations at positions 50, 76, 99, 126, 140 and 151.

[0262] In the present application, the P protein may comprise amino acid mutations at positions 50, 76, 99, 126, 140, 151 and 168.

[0263] In the present application, the P protein may comprise amino acid mutations at positions 50, 76, 99, 126, 140, 151, 168 and 170.

[0264] In the present application, the P protein may comprise amino acid mutations at positions 50, 76, 99, 126, 140, 151, 168, 170 and 189.

[0265] In the present application, the P protein may contain amino acid mutations at positions 50, 76, 99, 126, 140, 151, 168, 170, 189 and 237.

[0266] In the present application, the P protein may contain amino acid mutations at positions 76, 99, 126, 140, 151, 168, 170, 189 and 237.

[0267] In the present application, the P protein may contain amino acid mutations at positions 99, 126, 140, 151, 168, 170, 189 and 237.

[0268] In the present application, the P protein may contain amino acid mutations at positions 126, 140, 151, 168, 170, 189 and 237.

[0269] In the present application, the P protein may contain amino acid mutations at positions 140, 151, 168, 170, 189 and 237.

[0270] In the present application, the P protein may contain amino acid mutations at positions 151, 168, 170, 189 and 237.

[0271] In the present application, the P protein may contain amino acid mutations at positions 168, 170, 189 and 237.

[0272] In the present application, the P protein may contain amino acid mutations at positions 170, 189 and 237.

[0273] In the present application, the P protein may contain amino acid mutations at positions 189 and 237.

[0274] In the present application, the P protein may contain an amino acid mutation at position 237.

[0275] In the present application, the P protein may also contain amino acid substitutions at other positions.

[0276] Furthermore, the nucleic acid molecule comprises a nucleic acid sequence encoding the exogenous target protein. The nucleic acid sequence encoding the exogenous target protein is located between the nucleic acid sequence encoding the M protein with amino acid substitution, and / or the nucleic acid sequence encoding the G protein with amino acid substitution, and / or the nucleic acid sequence encoding the N protein with amino acid substitution, and / or the nucleic acid sequence encoding the P protein with amino acid substitution.

[0277] In the present application, the oncolytic virus described in the present application can be obtained by a virus packaging process and a virus rescue process. The specific process may include inoculating BSR-T7 cells with a poxvirus vTF7-3 expressing T7 RNA polymerase, and performing lipofectamine transfection using expression plasmids and backbone plasmids that clone VSV N, VSV P, and VSV L genes, respectively, to obtain the target oncolytic virus.

[0278] The present application also provides an oncolytic virus expression vector, a virus production cell and a pharmaceutical composition.

[0279] The oncolytic virus expression vector may contain a nucleic acid sequence encoding the M protein and the G protein of the oncolytic virus; the oncolytic virus expression vector may also contain a nucleic acid sequence encoding the N protein and the P protein of the oncolytic virus.

[0280] The virus production cells are capable of producing the above-mentioned oncolytic virus; the virus production cells may include BSR-T7 cells, Vero cells, 293 cells, MRC-5 cells, and WI38 cells.

[0281] The pharmaceutical composition comprises the above-mentioned oncolytic virus, and optionally a pharmaceutically acceptable carrier.

[0282] In certain embodiments, the pharmaceutical composition may include one or more (pharmaceutically effective) adjuvants, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers and / or preservatives. The acceptable ingredients of the pharmaceutical composition are preferably non-toxic to the recipient at the dosage and concentration used. The pharmaceutical composition of the present application includes but is not limited to liquid, frozen and lyophilized compositions.

[0283] In certain embodiments, the pharmaceutically acceptable carrier may include any and all solvents, dispersion media, coatings, isotonic agents and absorption delaying agents that are compatible with pharmaceutical administration and are generally safe and non-toxic.

[0284] The pharmaceutical composition comprises the above-mentioned oncolytic virus, and optionally other pharmaceutically acceptable drugs.

[0285] The above-mentioned pharmaceutical composition can be used for combined treatment of diseases, including but not limited to the treatment of tumors.

[0286] In certain embodiments, the pharmaceutical composition may include parenteral, subcutaneous, intracavitary, intra-arterial, intravenous, intrathecal and / or intranasal administration or direct injection into tissue. For example, the pharmaceutical composition may be administered to a patient or subject by infusion or injection. In certain embodiments, the administration of the pharmaceutical composition may be performed in different ways, such as intravenous, intraperitoneal, subcutaneous, intramuscular, topical or intradermal administration. In certain embodiments, the pharmaceutical composition may be administered uninterruptedly. The uninterrupted (or continuous) administration may be achieved by a small pump system worn by the patient to measure the therapeutic agent flowing into the patient, as described in WO2015 / 036583.

[0287] In addition, the present application also provides a method for preparing the above-mentioned oncolytic virus, which may include an oncolytic virus expression vector, a virus production cell and / or a pharmaceutical composition. Any method suitable for producing an oncolytic virus can be used to produce the oncolytic virus of the present application. For example, a poxvirus expressing T7 RNA polymerase can be added to the cell for transfection, a plasmid expressing the oncolytic virus N protein and P protein and a backbone plasmid can be added for transfection, and the oncolytic virus of the present application is obtained by a virus rescue process.

[0288] The present application also provides the use of the above-mentioned oncolytic virus, oncolytic virus expression vector, virus production cell and / or pharmaceutical composition in the preparation of a drug for preventing and / or treating a disease and / or condition.

[0289] The oncolytic virus provided in this application respectively performs site-directed mutations on the amino acids on the M protein, G protein, N protein, and P protein of the oncolytic virus, thereby further improving the oncolytic virus's ability to infect abnormally proliferative (tumor) LLC cells, 4T1 cells, MC38 cells, and Hela cells. At the same time, the oncolytic virus prepared above has poor infectivity to normal cells and normal MEF cells, indicating that the oncolytic virus prepared in this application can be well used for the infection of tumors, cancer cells, etc., without damaging normal cells, and has a wide range of application prospects.

[0290] The oncolytic virus provided in the present application performs site-directed mutations on the amino acids on the M protein, G protein, N protein, and P protein of the oncolytic virus, respectively, thereby further improving the oncolytic virus's ability to infect abnormally proliferative (tumor) LLC cells, 4T1 cells, MC38 cells, and Hela cells. Thereby further improving the in vitro killing ability of oncolytic viruses to LLC cells, 4T1 cells, MC38 cells, and Hela cells. At the same time, the oncolytic virus prepared above has almost no effect on normal MEF cells, indicating that the oncolytic virus prepared in the present application can be used for the damage and killing of abnormal cells such as tumors and cancers, without damaging normal cells.

[0291] The oncolytic virus provided in this application is not easy to remove in abnormally proliferative (tumor) LLC cells, 4T1 cells, MC38 cells and Hela cells. Relatively speaking, wild-type oncolytic viruses are easier to remove in LLC cells, MC38 cells and Hela cells. The oncolytic virus provided in this application is respectively subjected to site-directed mutation of the amino acids on the M protein, G protein, N protein and P protein of the oncolytic virus, so that the oncolytic virus is more difficult to remove in LLC cells, 4T1 cells, MC38 cells and Hela cells, further ensuring that the oncolytic virus can better play the infection and killing ability in LLC cells, 4T1 cells, MC38 cells and Hela cells; at the same time, the oncolytic virus provided in this application is easier to remove in normal MEF cells, further ensuring the safety of normal MEF cells, thereby improving the safety of oncolytic viruses.

[0292] The following is combined with Preparation Examples 1-48, Examples 1-3 and Attached Figure 1-15 This application is described in further detail.

[0293] Preparation Example

[0294] Preparation Example 1-23

[0295] Preparation Examples 1-23 respectively provide an oncolytic virus, the main difference between which is: the site of site-directed mutation of amino acids on the wild-type oncolytic virus M protein and G protein. Among them, the sequence of the mutated M protein is the amino acid sequence shown in SEQ ID NO 2, and the mutation site of the G protein is shown in Table 1. The construction method of the oncolytic virus corresponding to each preparation example is as follows:

[0296] (1) Construction of plasmid

[0297] Using pRV-core plasmid (BioVector NTCC Plasmid Vector Bacteria Cell Gene Collection Center) as a template, PCR technology was used to introduce mutation sites as shown in Table 1. PCR was performed on pRV-core plasmids with primers carrying each mutation site; then the PCR products were subjected to 1% agarose gel electrophoresis; and then the gel was cut and recovered using a gel recovery kit, thereby obtaining plasmids with different mutation sites of M protein and G protein, and obtaining the constructed plasmid pRV-core Mut.

[0298] Table 1 Mutation of oncolytic virus G protein in preparation examples 1-23

[0299]

[0300]

[0301] (2) Virus rescue

[0302] The constructed plasmid pRV-core Mut was transfected into BSR-T7 cells (purchased from ATCC, American Type Culture Collection, also known as the American Type Culture Collection) by cell transfection technology using a calcium phosphate transfection kit (Thermo Fisher Scientific).

[0303] According to the mass ratio of pRV-core Mut, pP, pN, and pL of 10:5:4:1, the four plasmids were mixed, and the total amount of plasmids was 5 μg; the plasmids were diluted with 200 μl of opti-MEM medium (Thermo Fisher Scientific), and 7.5 μl of transfection reagent Plus Reagent (Life Technologies) were added to obtain a transfection plasmid premix; among them, pP (a plasmid carrying a baculovirus phosphoprotein gene), pN (a plasmid carrying a baculovirus nucleoprotein gene), and pL (a plasmid carrying a baculovirus polymerase protein gene); the parent vectors corresponding to the three plasmids pN, pP, and pL were all pCAGGS (purchased from ATCC);

[0304] Dilute Lipofectamine LTX 10 μl (Thermo Fisher Scientific) with 200 μl opti-MEM medium to obtain LTX mixed solution;

[0305] Plasmid transfection was performed according to the method described in the instruction manual of Lipofectamine LTX, and BSR-T7 cells were washed twice with PBS 6 h later and further inoculated in DMEM medium containing 10% fetal bovine serum (Thermo Fisher Scientific) and cultured for 3 days;

[0306] The cell supernatant obtained from culturing BSR-T7 cells was transferred to Vero cells (Thermo Fisher Scientific), and the Vero cells were cultured at 37°C for 3 days. The green fluorescence in the cells was observed under a fluorescence microscope to determine the virus rescue. The rescued mutant rod-shaped virus library was further passaged through Vero cells, and monoclonal virus strains were picked out in the established plaque screening system.

[0307] (3) G protein gene sequencing. The viral genomic RNA was extracted using the Trizol kit, and reverse transcription was performed using random primers. The reverse transcribed cDNA was subjected to PCR using primers designed for the G protein gene sequence.

[0308] The primer sequences are:

[0309] PF:ATGAAGTGCCTTTTGTACTTAG;

[0310] PR:TTACTTTCCAAGTCGGTTCATCT.

[0311] The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 1.

[0312] Preparation Examples 24-28

[0313] Preparation Examples 24-28 respectively provide an oncolytic virus, the main difference between which is: the sites of site-directed mutation of amino acids on the wild-type oncolytic virus M protein, G protein and N protein. Among them, the sequence of the M protein after mutation is the amino acid sequence shown in SEQ ID NO 2, the sequence of the G protein after mutation is the amino acid sequence shown in SEQ ID NO 15, and the mutation site of the N protein is shown in Table 2.

[0314] The method for constructing the oncolytic virus provided in the above preparation example is the same as the method for constructing the preparation example 12, except that:

[0315] The mutation sites shown in Table 2 were introduced into the constructed plasmid in step (1) using PCR technology;

[0316] Step (3) is N protein gene sequencing. Virus genomic RNA is extracted using a Trizol kit, reverse transcription is performed using random primers, and PCR is performed on the reverse transcribed cDNA using primers designed for the N protein gene sequence;

[0317] The primer sequences are:

[0318] PF:ATGTCTGTTACAGTCAAGAG;

[0319] PR:TCATTTGTCAAATTCTGACTT.

[0320] The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 2.

[0321] Table 2 Mutation of oncolytic virus N protein in preparation examples 24-28

[0322] Preparation Example Mutation site and mutated amino acid Number of mutation sites Amino acid sequence 24 I14V 1 SEQ ID NO 28 25 I14V, R155K 2 SEQ ID NO 29 26 I14V, R155K, S353N 3 SEQ ID NO 30 27 R155K、S353N 2 SEQ ID NO 31 28 S353N 1 SEQ ID NO 32

[0323] Preparation Example 29-47

[0324] Preparation Examples 29-47 respectively provide an oncolytic virus, the main difference between which is: the sites of site-directed mutation of amino acids on the wild-type oncolytic virus M protein, G protein, N protein, and P protein. Among them, the sequence of the M protein after mutation is the amino acid sequence shown in SEQ ID NO 2, the sequence of the G protein after mutation is the amino acid sequence shown in SEQ ID NO 15, the sequence of the N protein after mutation is the amino acid sequence shown in SEQ ID NO 30, and the mutation site of the P protein is shown in Table 3.

[0325] The construction method of the oncolytic virus provided in the above preparation example is the same as the construction method of preparation example 26, except that:

[0326] The mutation sites shown in Table 3 were introduced into the constructed plasmid in step (1) using PCR technology;

[0327] Step (3) is P protein gene sequencing. Virus genomic RNA is extracted using a Trizol kit, reverse transcription is performed using random primers, and PCR is performed on the reverse transcribed cDNA using primers designed for the P protein gene sequence;

[0328] The primer sequences are:

[0329] PF:ATGGATAATCTCACAAAAGTTCG;

[0330] PR:CTACAGAGAATATTTGACTCTCG.

[0331] The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 3.

[0332] Table 3 Mutation of oncolytic virus P protein in preparation examples 29-47

[0333]

[0334]

[0335] Preparation Example 48

[0336] This preparation example provides a packaging process of an oncolytic virus prepared by using any one of the preparation examples 1-47 above, which specifically includes the following steps:

[0337] 1) Inoculate BSR-T7 cells (purchased from ATCC) with poxvirus vTF7-3 expressing T7 RNA polymerase (BioVector NTCC Plasmid Vector Bacteria Cell Gene Collection Center)

[0338] The specific steps are as follows: BSR-T7 cells were plated on a 6-well plate and the number of cells per well was controlled to reach 3×10 5 14-16 hours after plating, poxvirus vTF7-3 expressing T7 RNA polymerase was added to infect BSR-T7 cells with poxvirus vTF7-3; 6 hours after infection, BSR-T7 cells were rinsed once with DPBS buffer (Thermo Fisher Scientific) and transfected.

[0339] 2) Transfection process

[0340] Specifically, the following steps are included: according to the mass ratio of pRV-core Mut, pP, pN, and pL being 10:5:4:1, four plasmids are mixed, and the total amount of plasmids is 5 μg; 200 μl of opti-MEM medium (Thermo Fisher Scientific) is used to dilute the plasmid, and 7.5 μl of transfection reagent Plus Reagent (Life Technologies) is added to obtain a transfection plasmid premix; wherein, pP (a plasmid carrying a baculovirus phosphoprotein gene), pN (a plasmid carrying a baculovirus nucleoprotein gene), and pL (a plasmid carrying a baculovirus polymerase protein gene); the parent vectors corresponding to the three plasmids pN, pP, and pL are all pCAGGS (purchased from ATCC);

[0341] Dilute Lipofectamine LTX 10 μl (Thermo Fisher Scientific) with 200 μl opti-MEM medium to obtain LTX mixed solution;

[0342] Mix 200 μl of LTX mixture with 200 μl of transfection plasmid premix and incubate at room temperature for 15 min to obtain LTX-DNA mixture;

[0343] The DPBS buffer in the 6-well plate of step 1) was replaced with Opti-MEM medium, and the LTX-DNA mixture was added dropwise to the 6-well plate in which BSR-T7 cells were cultured, and the 6-well plate was gently shaken to make the LTX-DNA mixture evenly distributed in the 6-well plate; 6-8 hours after transfection, the transfection reagent was removed and 3 ml of fresh complete medium (Thermo Fisher Scientific) was added; 72 hours later, the cell supernatant of BSR-T7 cells was harvested and filtered using a 0.22 μm filter to obtain the oncolytic virus corresponding to each of Preparation Examples 1-47.

[0344] Example

[0345] Example 1

[0346] In this example, the oncolytic viruses prepared in Preparation Examples 1-47 and the wild-type oncolytic viruses were used to test their ability to infect different cells.

[0347] The detection method is the TCID50 detection method, that is, 200 pfu of Preparation Example 1-47 and wild-type oncolytic virus are added to the culture medium of different cells, and the half tissue culture infective dose (TCID50) produced by each oncolytic virus is detected.

[0348] The cells tested include: LLC cells (mouse lung cancer cell line), 4T1 cells (mouse breast cancer cell line), MC38 cells (mouse colon cancer cell line), Hela cells (human cervical cancer cell line), and MEF cells (human fibroblast cell line).

[0349] The specific detection method is:

[0350] (1) Add 3 mL of Vero (LLC / 4T1 / MC38 / Hela / MEF) cell suspension to each well of a 6-well culture plate to increase the cell volume to 4 × 10 5 6 wells / well, 2 of which were MEF cells; the 6-well culture plate was placed in an environment of 37°C and 5% CO2 for 16 h;

[0351] (2) Add 200 pfu of the oncolytic virus prepared in the preparation example to each well of a 6-well culture plate; harvest 100 μl of the supernatant of MEF cells and each Vero cell at 24 h; add the harvested supernatant to each well of a 96-well culture plate to make the cell mass of each cell reach 1×10 4 / ml, and the 96-well culture plate was placed in an environment of 37°C and 5% CO2 for 16 h;

[0352] (3) Dilute the supernatant obtained in step (2) in 1.5 ml EP tubes 10 times in succession. -1 ~10 -11 , a total of 11 titers; the diluted supernatant was inoculated into a 96-well culture plate, one column of each dilution for a total of 8 wells, and 100 μl was inoculated into each well;

[0353] (4) After 48 hours, observe the fluorescence of cells in each well. If there is fluorescence, the well is considered infected. Calculate TCID50 according to the Karber method.

[0354] Test results such as Figure 1-Figure 5 As shown. Wherein, the horizontal axis 0 represents the wild-type oncolytic virus; the horizontal axes 1-47 represent the oncolytic viruses prepared in Preparation Examples 1-47 respectively; the vertical axis Log 10 TCID50 represents the TCID50 value calculated by Karber method, Log 10 The larger the TCID50 value, the better the oncolytic virus's ability to infect the cell; Log 10 The smaller the TCID50 value, the worse the oncolytic virus's ability to infect the cells.

[0355] Figure 1 The results of the detection of the oncolytic virus prepared in this application and the wild-type oncolytic virus's ability to infect LLC cells.

[0356] Figure 2 The results of the test oncolytic virus prepared in this application and the wild-type oncolytic virus on the infection ability of 4T1 cells.

[0357] Figure 3 The results of the test on the infection ability of the oncolytic virus prepared in this application and the wild-type oncolytic virus on MC38 cells.

[0358] Figure 4 The results of the test on the infection ability of the oncolytic virus prepared in this application and the wild-type oncolytic virus on Hela cells.

[0359] Figure 5 The results of the test oncolytic virus prepared in this application and the wild-type oncolytic virus on the infection ability of MEF cells.

[0360] It can be seen from the above figures that the oncolytic viruses prepared in Preparation Examples 1-47 of this application have good infection ability on LLC cells, 4T1 cells, MC38 cells and Hela cells. At the same time, the oncolytic viruses prepared above have poor infection ability on MEF cells, indicating that the oncolytic viruses prepared in this application can be well used for infection of tumor, cancer and other cells, and will not damage normal cells, and have broad application prospects.

[0361] Example 2

[0362] In this example, the oncolytic viruses prepared in Preparation Examples 1-47 and the wild-type oncolytic viruses were used to perform in vitro killing tests on different cells.

[0363] The detection method is the MTT detection method, that is, 200 pfu of Preparation Example 1-47 and wild-type oncolytic virus were added to the culture medium of different cells, and the cell activity was detected by MTT detection method after 24 hours.

[0364] The cells tested include: LLC cells, 4T1 cells, MC38 cells, Hela cells, and MEF cells.

[0365] The specific detection method is:

[0366] (1) Add 100 μl of Vero (LLC / 4T1 / MC38 / Hela / MEF) cell suspension to each 96-well culture plate to make the cell volume reach 1×10 4 The 96-well culture plate was placed in an environment of 37°C and 5% CO2 for 16 h.

[0367] (2) The oncolytic virus prepared in the preparation example was diluted to an MOI (multiplicity of infection) of 0.001, 0.01, 0.1, and 1.0, respectively, and the oncolytic virus of each dilution gradient was inoculated into the 96-well culture plate of step (1), 4 wells were inoculated for each dilution gradient, 100 μl per well, and the 96-well culture plate was placed at 37° C. and 5% CO2 for 40 h;

[0368] (3) removing the cell supernatant from the 96-well culture plate in step (2), adding fresh culture medium and MTT solution to the 96-well culture plate at a rate of 20 μL / well, and placing the 96-well culture plate in an environment of 37° C. and 5% CO 2 for 4 h;

[0369] (4) Centrifuge the 96-well culture plate at room temperature for 5 minutes, set the speed to 2500 rpm / min, and gently remove the supernatant with a 1 mL disposable sterile syringe; then add DMSO to each well of the 96-well culture plate at a volume of 100 ul / well and place it at 37°C for 10 minutes. Use a multifunctional microplate reader, shake for 2 minutes, and measure the OD value of each well on the 96-well culture plate at a wavelength of 570 nm or 490 nm.

[0370] Test results such as Figure 6-Figure 10 As shown. Wherein, the horizontal axis 0 represents the wild-type oncolytic virus; the horizontal axes 1-47 represent the oncolytic viruses prepared in Preparation Examples 1-47 respectively; the vertical axis OD 570 Indicates the OD value of the cell, OD 570 The larger the value, the weaker the killing ability of oncolytic virus to the cell; 570 The smaller the value, the better the killing ability of the oncolytic virus to the cell.

[0371] Figure 6 The results of the in vitro killing ability of the oncolytic virus prepared in this application and the wild-type oncolytic virus on LLC cells.

[0372] Figure 7 The results of the in vitro killing ability of the oncolytic virus prepared in this application and the wild-type oncolytic virus on 4T1 cells.

[0373] Figure 8 The results of the in vitro killing ability of the oncolytic virus prepared in this application and the wild-type oncolytic virus on MC38 cells.

[0374] Fig. 9 The results of the in vitro killing ability of the oncolytic virus prepared in this application and the wild-type oncolytic virus on Hela cells.

[0375] Fig.10 The results of the in vitro killing ability of the oncolytic virus prepared in this application and the wild-type oncolytic virus on MEF cells are shown.

[0376] It can be seen from the above figures that the oncolytic viruses prepared in Preparation Examples 1-47 of this application all have good in vitro killing ability against LLC cells, 4T1 cells, MC38 cells and Hela cells. At the same time, the oncolytic viruses prepared above have almost no killing effect on MEF cells, indicating that the oncolytic viruses prepared in this application can be well used for the damage and killing of abnormal cells such as tumors and cancers, while not damaging normal cells.

[0377] Although wild-type oncolytic viruses have good in vitro killing ability against LLC cells, MC38 cells, and 4T1 cells, while damaging and killing the above cells, they also damage and kill MEF cells to a great extent, limiting the clinical application of wild-type oncolytic viruses. Therefore, the modification of wild-type oncolytic viruses in this application not only ensures the safety of oncolytic viruses for normal cells, but also ensures the killing ability of oncolytic viruses for tumors and cancer cells, and has broad clinical application prospects.

[0378] Example 3

[0379] In this example, the oncolytic viruses prepared in Preparation Examples 1-47 and the wild-type oncolytic viruses were tested for the expression of IFN-β induced in different cells.

[0380] The detection index is the expression of the IFN-β gene in different cells. The IFN-β gene is a soluble glycoprotein gene produced by cells with a wide range of antiviral, anti-tumor and immunomodulatory effects. The expression of the IFN-β gene can be used to determine the cell's ability to clear oncolytic viruses: when the expression of the IFN-β gene is high, it indicates that the oncolytic virus is easily cleared in the cell; when the expression of the IFN-β gene is low, it indicates that the oncolytic virus is not easily cleared in the cell.

[0381] The cells tested include: LLC cells, 4T1 cells, MC38 cells, Hela cells, and MEF cells.

[0382] The specific detection method is:

[0383] (1) Add 100 μl of Vero (LLC / 4T1 / MC38 / Hela / MEF) cell suspension to each 96-well culture plate to make the cell volume reach 1×10 4 The 96-well culture plate was placed in an environment of 37°C and 5% CO2 for 16 h.

[0384] (2) The oncolytic virus prepared in the preparation example was diluted to an MOI (multiplicity of infection) of 0.001, 0.01, 0.1, and 1.0, respectively, and the oncolytic virus of each dilution gradient was inoculated into the 96-well culture plate of step (1), 4 wells were inoculated for each dilution gradient, 100 μl per well, and the 96-well culture plate was placed at 37° C. and 5% CO2 for 40 h;

[0385] (3) Each group of cells obtained by culture in step (2) was broken, and total RNA was extracted from each cell using TRIzol (Invitrogen), reverse transcribed into cDNA using PrimeScript RT Reagent Kit with DNA Eraser (Takara) reverse transcription kit, and stained with LightCycler 480SYBR Green I Master (Roche) dye, and the Ct value of each gene was detected on a LightCycler 480 quantitative PCR instrument. The relative expression level of the target gene IFN-β was calculated using the ΔΔCt method.

[0386] Test results such as Figure 11-Figure 15 As shown. Wherein, the horizontal axis 0 represents the wild-type oncolytic virus; the horizontal axes 1-47 represent the oncolytic viruses prepared in Preparation Examples 1-47 respectively; the vertical axis IFN-β level represents the expression of the IFN-β gene. The larger the value of the IFN-β level, the weaker the ability of the oncolytic virus to reproduce in the cell and the easier it is to clear; the smaller the value of the IFN-β level, the stronger the ability of the oncolytic virus to reproduce in the cell and the more difficult it is to clear.

[0387] Fig.11 The oncolytic virus prepared in this application and the wild-type oncolytic virus induce the expression of IFN-β in LLC cells.

[0388] Fig.12 The oncolytic virus prepared in this application and the wild-type oncolytic virus induce the expression of IFN-β in 4T1 cells.

[0389] Fig.13 The oncolytic virus prepared in this application and the wild-type oncolytic virus induce the expression of IFN-β in MC38 cells.

[0390] Fig.14 The oncolytic virus prepared in this application and the wild-type oncolytic virus induce the expression of IFN-β in Hela cells.

[0391] Fig.15 The oncolytic virus prepared in this application and the wild-type oncolytic virus induce the expression of IFN-β in MEF cells.

[0392] It can be seen from the above figures that the oncolytic virus provided in Preparation Examples 1-47 of the present application is less likely to be removed in LLC cells, 4T1 cells, MC38 cells and Hela cells. At the same time, the oncolytic virus provided in the present application is easier to remove in MEF cells, further ensuring the safety of MEF cells, thereby improving the safety of oncolytic viruses.

[0393] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

Claims

1. An oncolytic virus, characterized in that The oncolytic virus includes M protein and G protein; Compared with the amino acid sequence shown in SEQ ID NO 1, the amino acid substitutions of the M protein are N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; Compared with the amino acid sequence shown in SEQ ID NO 3, the amino acid substitution of the G protein is selected from any one of the following groups: 1) The amino acid of the G protein is substituted with V53I; 2) The amino acid substitutions of the G protein are V53I and A141V; 3) The amino acid substitutions of the G protein are V53I, A141V, and D172Y; 4) The amino acid substitutions of the G protein are V53I, A141V, D172Y, and K217E; 5) The amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, and D232G; 6) The amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, and V331A; 7) The amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, and V371E; 8) The amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, V371E, and G436D; 9) The amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, and T438S; 10) The amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, and F453L; 11) The amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, and T471I; 12) The amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; 13) The amino acid substitutions of the G protein are A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; 14) The amino acid substitutions of the G protein are D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; 15) The amino acid substitutions of the G protein are K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; 16) The amino acid substitutions of the G protein are D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; 17) The amino acid substitutions of the G protein are V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; 18) The amino acid substitutions of the G protein are V371E, G436D, T438S, F453L, T471I, and Y487H; 19) The amino acid substitutions of the G protein are G436D, T438S, F453L, T471I, and Y487H; 20) The amino acid substitutions of the G protein are T438S, F453L, T471I, and Y487H; 21) The amino acid substitutions of the G protein are F453L, T471I, and Y487H; 22) The amino acid substitutions of the G protein are T471I and Y487H; 23) The amino acid substitution of the G protein is Y487H.

2. The oncolytic virus according to claim 1, characterized in that The oncolytic virus further comprises an N protein; Compared with the amino acid sequence shown in SEQ ID NO 1, the amino acid substitutions of the M protein are N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; Compared with the amino acid sequence shown in SEQ ID NO 3, the amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; Compared with the amino acid sequence shown in SEQ ID NO 27, the amino acid substitution of the N protein is selected from any one of the following groups: 1) The amino acid substitution of the N protein is I14V; 2) The amino acid substitutions of the N protein are I14V and R155K; 3) The amino acid substitutions of the N protein are I14V, R155K, and S353N; 4) The amino acid substitutions of the N protein are R155K and S353N; 5) The amino acid substitution of the N protein is S353N.

3. The oncolytic virus according to claim 1, characterized in that The oncolytic virus also includes a P protein; Compared with the amino acid sequence shown in SEQ ID NO 1, the amino acid substitutions of the M protein are N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; Compared with the amino acid sequence shown in SEQ ID NO 3, the amino acid substitutions of the G protein are V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; Compared with the amino acid sequence shown in SEQ ID NO 27, the amino acid substitutions of the N protein are I14V, R155K, and S353N; Compared with the amino acid sequence shown in SEQ ID NO 33, the amino acid substitution of the P protein is selected from any one of the following groups: 1) The amino acid of the P protein is substituted with R50K; 2) The amino acid substitutions of the P protein are R50K and V76A; 3) The amino acid substitutions of the P protein are R50K, V76A, and D99E; 4) The amino acid substitutions of the P protein are R50K, V76A, D99E, and L126S; 5) The amino acid substitutions of the P protein are R50K, V76A, D99E, L126S, and L140S; 6) The amino acid substitutions of the P protein are R50K, V76A, D99E, L126S, L140S, H151Y; 7) The amino acid substitutions of the P protein are R50K, V76A, D99E, L126S, L140S, H151Y, and I168M; 8) The amino acid substitutions of the P protein are R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E; 9) The amino acid substitutions of the P protein are R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, and Y189S; 10) The amino acid substitutions of the P protein are R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D; 11) The amino acid substitutions of the P protein are V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D; 12) The amino acid substitutions of the P protein are D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D; 13) The amino acid substitutions of the P protein are L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D; 14) The amino acid substitutions of the P protein are L140S, H151Y, I168M, K170E, Y189S, and N237D; 15) The amino acid substitutions of the P protein are H151Y, I168M, K170E, Y189S, and N237D; 16) The amino acid substitutions of the P protein are I168M, K170E, Y189S, and N237D; 17) The amino acid substitutions of the P protein are K170E, Y189S, and N237D; 18) The amino acid substitutions of the P protein are Y189S and N237D; 19) The amino acid substitution of the P protein is N237D.

4. The oncolytic virus according to any one of claims 1 to 3, characterized in that The oncolytic virus comprises a rhabdovirus.

5. The oncolytic virus according to any one of claims 1 to 4, characterized in that: The oncolytic virus comprises vesicular stomatitis virus.

6. The oncolytic virus according to any one of claims 1 to 5, characterized in that: The oncolytic virus comprises VSV virus Indiana MuddSummer Subtype.

7. The oncolytic virus according to any one of claims 1 to 6, characterized in that: The oncolytic virus contains or expresses an exogenous target protein.

8. The oncolytic virus according to claim 7, characterized in that: The nucleic acid sequence encoding the exogenous target protein is located between the nucleic acid sequence encoding the M protein with amino acid substitution, and / or the nucleic acid sequence encoding the G protein with amino acid substitution, and / or the nucleic acid sequence encoding the N protein with amino acid substitution, and / or the nucleic acid sequence encoding the P protein with amino acid substitution.

9. An oncolytic virus expression vector, characterized in that: The oncolytic virus expression vector is capable of expressing the oncolytic virus according to any one of claims 1 to 8.

10. A virus producing cell, characterized in that: The virus producing cell is capable of producing the oncolytic virus according to any one of claims 1 to 8.

11. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises the oncolytic virus according to any one of claims 1 to 8, and optionally a pharmaceutically acceptable carrier.

12. A method for preparing the oncolytic virus according to any one of claims 1 to 8, the oncolytic virus expression vector according to claim 9, the virus production cell according to claim 10 and / or the pharmaceutical composition according to claim 11.

13. Use of the oncolytic virus according to any one of claims 1 to 8, the oncolytic virus expression vector according to claim 9, the virus production cell according to claim 10 and / or the pharmaceutical composition according to claim 11 for continuously killing abnormal cells in the preparation of a medicament for preventing and / or treating a disease and / or condition.

14. The use according to claim 13, characterized in that: The oncolytic virus, the oncolytic virus expression vector, the virus production cell and / or the pharmaceutical composition are used in a method for continuously killing abnormally proliferative cells.

15. The use according to claim 14, characterized in that: The abnormally proliferative cells are selected from tumor cells or cells related to tumor tissue.

16. The use according to claim 15, characterized in that: The tumor includes a solid tumor or a hematological tumor.

Images