Fusion protein and application thereof in rice single-gene and multi-gene editing

Abstract

The invention discloses a fusion protein and application thereof in rice single-gene and multi-gene editing, and belongs to the technical field of biology. The technical problem to be solved by the invention is how to edit a plurality of genes. The sequence of the fusion protein disclosed by the invention is as shown in SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10 or SEQ ID No. 12. According to the fusion protein, the editing efficiency of a single gene can be improved, and the highest editing efficiency can reach 98.61%; the method can be used for editing multiple genes and has good editing efficiency, and the efficiency of simultaneous editing of three genes, four genes, five genes and six genes mediated by the method can reach 82.76%, 61.36%, 52.94% and 51.07%. The method can be used for crop gene function research and creation of new crop germplasm by polymerizing a plurality of excellent alleles in one generation.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a fusion protein and its application in rice single gene and multi-gene editing. Background Art

[0002] The CRISPR / Cas system, especially the Class II system, has the advantages of simple operation and high efficiency, and has been developed as an important tool for gene editing, including CRISPR / Cas9 (Bortesi et al. 2016, Liu et al. 2023, Shan et al. 2013), CRISPR / Cas12a (Xu et al. 2017, Zheng et al. 2023, Tang et al. 2017), CRISPR / Cas12b (Ming et al. 2020), CRISPR / Cas12i3 (Lv et al. 2024, Zhang et al. 2023), etc. The development of the above tools has greatly accelerated the progress of crop gene function research and crop breeding. The multi-gene editing technology based on the CRISPR / Cas system can simultaneously perform site-specific editing on multiple genes, and can quickly and efficiently achieve the polymerization of multiple excellent alleles in one generation. In recent years, the establishment of a CRISPR / Cas-based multi-gene editing system has provided new opportunities for the genetic improvement of crops such as rice, wheat, and corn (Li et al. 2024, Li et al. 2019, Wang et al. 2017, Lorenzo et al. 2023, Luo et al. 2021, Li et al. 2021, Pan et al. 2024).

[0003] In CRISPR / Cas12 systems, Cas proteins usually cut specific sites of the genome in a staggered manner under the guidance of crRNA, and produce sticky ends with 5'-end protrusions after cutting (Zetsche et al., 2015). Among them, Class I V type CRISPR / Cas12i3 recognizes the PAM sequence of 5'-TTN-3' and can edit non-coding regions rich in "AT". Lv et al. successfully knocked out four endogenous genes in rice using the CRISPR / Cas12i3 system, but the editing efficiency was generally low (Lv et al. 2024). Subsequently, Duan et al. developed the Cas12i3-5M (S7R / D233R / D267R / N369R / S433R) variant through rational design, which significantly improved the editing efficiency of Cas12i3 in rice, soybeans and peppers. The editing efficiency of Cas12i3-5M in three rice endogenous gene targets was about 75% (Duan et al., 2024). The development of the Cas12i3-5M variant provides important technical support for the further widespread use of CRISPR / Cas12i3 in crops. However, there are currently no reports on the use of Cas12i3-5M for simultaneous editing of multiple genes or multiple targets.

[0004] Studies have shown that fusing exonucleases with Cas proteins can improve editing efficiency and expand the length of genomic deletion fragments (Liang et al. 2023, Wu et al. 2020). Exonucleases can hydrolyze the protruding ends of double-strand breaks. Based on the cutting characteristics of Cas12i3, fusing 5'-3' exonucleases with Cas12i3 is expected to further improve editing efficiency. At present, the commonly used exonucleases for digesting single-stranded or double-stranded DNA in the 5' to 3' direction include bacteriophage T5 exonuclease (T5 Exonuclease, T5E) (Liang et al. 2023), T7 exonuclease (T7E) (Zhang et al. 2024), UL12 exonuclease (UL12) of herpes simplex virus 1 (HSV1) (Schreiber et al. 2024), UL12-type exonuclease (PapE) from Papiinealpha herpesvirus II, T7E-type exonuclease (ME15) from bacteriophage IME15 (Schreiber et al. 2024), and triple repair exonuclease 2 (Trex2) (Pan et al. 2024). However, in the study of He et al., by fusing Trex2 exonuclease with FrCas9, larger genomic deletions could be produced in stable rice plants, but the editing efficiency was not further improved (He et al. 2024). Summary of the invention

[0005] The technical problem to be solved by the present invention is how to improve the editing efficiency of the rice genome and how to edit multiple genes.

[0006] To solve the above technical problems, the present invention first provides a fusion protein, wherein the fusion protein contains a nuclease and Cas12i3-5M, and the nuclease is UL12, T5E, ME15 or PapE.

[0007] In the above fusion protein, the UL12 may be as follows: A1), A2) or A3): A1) a protein having amino acids 20 to 344 of SEQ ID No. 6; A2) a protein having the same function as SEQ ID No. 6 with one or more amino acid residues substituted and / or deleted and / or added at positions 20 to 344; A3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of A1) or A2); The T5E may be as follows: B1), B2) or B3): B1) a protein having amino acids 20 to 309 of SEQ ID No. 8; B2) a protein having the same function as SEQ ID No. 8 with one or more amino acid residues substituted and / or deleted and / or added at positions 20-309; B3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of B1) or B2); The PapE may be as follows: C1), C2) or C3): C1) a protein whose amino acids are positions 20-625 of SEQ ID No. 10; C2) a protein having the same function as SEQ ID No. 10 with one or more amino acid residues substituted and / or deleted and / or added at positions 20-625; C3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of C1) or C2); The ME15 may be as follows: D1), D2) or D3): D1) a protein whose amino acids are positions 20 to 322 of SEQ ID No. 12; D2) a protein having the same function as SEQ ID No. 12 with one or more amino acid residues substituted and / or deleted and / or added at positions 20-322; D3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of D1) or D2); The Cas12i3-5M may be as follows (E1), E2) or E3): E1) a protein whose amino acids are positions 42 to 1089 of SEQ ID No. 4; E2) a protein having the same function as SEQ ID No. 4, wherein one or more amino acid residues at positions 42 to 1089 are substituted and / or deleted and / or added; E3) is a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of E1) or E2).

[0008] The protein in A2) above is a protein that has an amino acid sequence that is 75% or more identical to the protein in A2) and has the same function. The protein in B2) above is a protein that has an amino acid sequence that is 75% or more identical to the protein in B2) and has the same function. The protein in C2) above is a protein that has an amino acid sequence that is 75% or more identical to the protein in C2) and has the same function. The protein in D2) above is a protein that has an amino acid sequence that is 75% or more identical to the protein in D2) and has the same function. The protein in E2) above is a protein that has an amino acid sequence that is 75% or more identical to the protein in E2) and has the same function. Identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gapexistence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences for calculation, the value of identity (%) can be obtained. The identity of 75% or more is 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[0009] The proteins in A2), B2), C2), D2) and E2) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0010] The tag in A3), B3), C3), D3), and E3) can be a polypeptide or protein fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag and / or SUMO tag, etc.

[0011] The above fusion protein may further contain a nuclear localization signal and / or a linker peptide.

[0012] The connection between the exonuclease, the Cas12i3-5M and the nuclear localization signal can be directly connected or connected through a common connecting peptide, as long as it does not affect the function of the base editor. Wherein, the connection refers to the connection between proteins or polypeptides through a peptide bond formed by an amino acid residue at the C-terminus of one protein or polypeptide and an amino acid residue at the N-terminus of another protein or polypeptide.

[0013] In an embodiment of the present invention, the connecting peptide is the polypeptide shown at positions 345-406 of SEQ ID No.6.

[0014] The sequence of the nuclear localization signal may be positions 2-19 of SEQ ID No.6 and / or positions 1478-1521 of SEQ ID No.6.

[0015] The above-mentioned fusion protein may be UL12-Cas12i3-5M fusion protein, T5E-Cas12i3-5M fusion protein, PapE-Cas12i3-5M fusion protein or ME15-Cas12i3-5M fusion protein; The UL12-Cas12i3-5M fusion protein is a protein whose amino acid is SEQ ID No.6; The T5E-Cas12i3-5M fusion protein is a protein whose amino acid is SEQ ID No. 8; The PapE-Cas12i3-5M fusion protein is a protein whose amino acid sequence is SEQ ID No. 10; The ME15-Cas12i3-5M fusion protein is a protein whose amino acid sequence is SEQ ID No.12.

[0016] The present invention also provides a biological material related to the fusion protein, wherein the biological material is at least one of the following H1) to H4): H1) a nucleic acid molecule encoding the fusion protein; H2) an expression cassette containing the nucleic acid molecule described in H1); H3) a recombinant vector containing the nucleic acid molecule described in H1) or a recombinant vector containing the expression cassette described in H2); H4) A recombinant microorganism containing the nucleic acid molecule described in H1), a recombinant microorganism containing the expression cassette described in H2), or a recombinant microorganism containing the recombinant vector described in H3).

[0017] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0018] H1) In the nucleic acid molecule, the nucleic acid molecule encoding the UL12 may be a DNA molecule whose coding sequence is positions 58 to 1032 of SEQ ID No. 5 in the sequence list; The nucleic acid molecule encoding the T5E may be a DNA molecule whose coding sequence is positions 58-927 of SEQ ID No. 7 in the sequence list; The nucleic acid molecule encoding the PapE may be a DNA molecule whose coding sequence is positions 58-1875 of SEQ ID No. 9 in the sequence list; The nucleic acid molecule encoding the ME15 may be a DNA molecule whose coding sequence is positions 58-966 of SEQ ID No. 11 in the sequence list; The nucleic acid molecule encoding the Cas12i3-5M may be a DNA molecule whose coding sequence is the 124th to 3267th positions of SEQ ID No. 3 in the sequence list.

[0019] Specifically, the nucleic acid molecule encoding the UL12-Cas12i3-5M fusion protein may be a DNA molecule whose nucleotide sequence of the coding strand is shown in SEQ ID No.5; The nucleic acid molecule encoding the T5E-Cas12i3-5M fusion protein may be a DNA molecule whose nucleotide sequence of the coding strand is shown in SEQ ID No.7; The nucleic acid molecule encoding the PapE-Cas12i3-5M fusion protein may be a DNA molecule whose nucleotide sequence of the coding strand is shown in SEQ ID No.9; The nucleic acid molecule encoding the ME15-Cas12i3-5M may be a DNA molecule whose nucleotide sequence of the coding chain is shown in SEQ ID No.11.

[0020] In the above-mentioned biological material, the expression cassette refers to a DNA capable of expressing the fusion protein in a host cell (such as a plant cell), and the DNA may include not only a promoter for initiating transcription of the fusion protein encoding gene, but also a terminator for terminating transcription of the fusion protein encoding gene. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the Ubiquitin promoter of corn, the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP"); the chemically inducible promoter from tobacco, pathogenesis-related protein 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); the tomato proteinase inhibitor II promoter (PIN2) or the LAP promoter (both inducible by methyl jasmonate); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 2007 1 0099169.7)), seed storage protein-specific promoters (e.g., phaseolusin, napin, oleosin and soybean beta conglycin) promoters. They can be used alone or in combination with other plant promoters. All references cited herein are cited in their entirety. Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators.

[0021] In one embodiment of the present invention, the promoter in the expression cassette H2) is the ubiquitin promoter, and the terminator is the E9 terminator.

[0022] In the above biological materials, the vector may be a plasmid, a cosmid, a phage or a virus vector.

[0023] In the above biological materials, H3) the recombinant vector may further contain a crRNA expression cassette, and the crRNA expression cassette may transcribe crRNA targeting the target gene.

[0024] The crRNA expression cassette contains a DNA fragment of tRNA shown at positions 1327-1403 of SEQ ID No. 13, a DR sequence of Cas12i3 crRNA shown at positions 1404-1439 or positions 1417-1439, and a DNA fragment of HDV shown at positions 1448-1515.

[0025] In the crRNA expression cassette, the promoter may be the 35S composite promoter shown at positions 1-1326 of SEQ ID No.13. And / or, the terminator may be the tH4 terminator shown at positions 1516-1765 of SEQ ID No.13.

[0026] The crRNA expression cassette may be shown as SEQ ID No.13.

[0027] H3) The recombinant vector further contains an Hpt gene expression cassette.

[0028] In the above biological material, the microorganism can be yeast, bacteria, algae or fungi. Among them, the bacteria can be Agrobacterium.

[0029] The application of the fusion protein in rice gene editing also falls within the protection scope of the present invention.

[0030] The application of the biological material in rice gene editing also falls within the protection scope of the present invention.

[0031] In the above application, the gene may be a single gene or multiple genes.

[0032] The plurality of genes may be 2, 3, 4, 5, 6, 7, 8, 9 or more genes.

[0033] When performing multiple gene editing, the target sequences can be spaced using the DNA sequence of the tRNA and / or the DNA sequence of the nuclease HDV.

[0034] The fusion proteins of the present invention can improve the editing efficiency, among which the single gene knockout efficiency of the UL12-Cas12i3-5M strategy is the highest. Compared with Cas12i3 and Cas12i3-5M, the editing efficiency is increased by up to 12.46 times and 1.25 times, respectively, and the average editing efficiency can reach up to 98.61%±2.41%; further, Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M are used to edit multiple genes in rice. The results show that the fusion proteins of the present invention can improve the multi-gene editing efficiency, among which UL12-Cas12i3-5M maintains the highest editing efficiency in the combination of each gene series, and the efficiencies of simultaneous editing of three genes, four genes, five genes, and six genes mediated by it are 82.76%, 61.36%, 52.94%, and 51.07%, respectively. The establishment of the above-mentioned rice efficient multi-gene editing system provides important tools and technical support for using CRISPR / Cas12i3 to study crop gene functions and to aggregate multiple excellent alleles in one generation to create new crop germplasm.

[0035] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 . Target gene structure diagram.

[0037] Figure 2 . Editing vector structure diagram. crRNA1, crRNA2, crRNA3, crRNA4, crRNA5, and crRNA6 represent DNA fragments containing different single gene target sequences, and 3×(HSC) represents the DNA fragments used for editing. OxY , OsB and OsCKX2 Three genes, 4× (HSCA) indicated for editing OxY , OsB , OsCKX2 and OsARF4 Four genes, 5×(HSCAA) indicated for editing OxY , OsB , OsCKX2 , OsARF4 and OsARE1 Five genes, 6×(HSCAAB) indicated for editing OxY , OsB , OsCKX2 , OsARF4 , OsARE1 and OsBADH2 Six genes.

[0038] Figure 3 . Efficiency of single gene editing in rice mediated by different strategies. Data marked with different letters have significant differences, and data marked with the same letter have no significant differences.

[0039] Figure 4 . Types of deletion fragment lengths generated by the Cas12i3, Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M strategies at six genomic loci.

[0040] Figure 5 . Efficiency of simultaneous editing of three, four, five, and six genes mediated by different strategies. DETAILED DESCRIPTION

[0041] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. The quantitative tests in the following examples are all set up for at least three repeated experiments. SPSS11.5 statistical software is used to process the data, and One-way ANOVA test is used. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0042] Table 1. Target gene information

[0043] Note: The first three letters of the “target sequence” represent the PAM sequence.

[0044] Table 2. Primer summary

[0045]

[0046]

[0047]

[0048]

[0049] Embodiment 1, 1. Materials and methods 1.1 Experimental Materials Rice variety used for transformation: Zhonghua 11.

[0050] The Agrobacterium transformation expression vector used was pHUE411 vector.

[0051] 1.2 Experimental methods 1.2.1 Target gene selection and target site design The EnsemblPlants database (http: / / plants.ensembl.org / Oryza_sativa / Info / Index) was used to retrieve rice endogenous genes. OsHRC、OsSBEIIb , OsCKX2, OsARE1, OsBADH2, OsDEP1 and OsARF4 The nucleotide sequence of Cas12i3 was obtained and the candidate genes were cloned in the recipient material. The target gene information is shown in Table 1. The target was designed with the PAM sequence "TTN" of Cas12i3. The target information is shown in Figure 1 .

[0052] 1.2.2 Construction of single gene editing vector In the pHUE411 vector, the Cas protein is derived from maize ( Zea mays L.) The ubiquitin gene promoter initiates transcription, the E9 terminator terminates transcription, and contains a 35S-Hpt-Nos expression cassette for tissue culture screening. The pHUE411-Cas12i3 and pHUE411-Cas12i3-5M basic vectors were obtained by replacing Cas9 on the vector. Further, pHUE411-Cas12i3-5M was fused with exonuclease to construct the pHUE411-Exo-Cas12i3-5M basic vector. The primers used are shown in Table 2.

[0053] (1) Construction of basic vector: Using artificially synthesized DNA fragments containing Cas12i3 gene and Cas12i3-5M gene as templates, primers Ubi-Cas12i3-F / E9t-Cas12i3-R and FastPfu high-fidelity enzyme (Quanshijin, Beijing, China) were used to amplify Cas12i3 and Cas12i3-5M fragments; the amplified products were purified and recovered to obtain homologous recombinant fragments; restriction endonucleases were used to amplify the fragments. Avr II (NEB, Beijing, China) and ScaI (NEB, Beijing, China) The plasmid pHUE411 was double-digested, and the linearized pHUE411 vector was purified and recovered after digestion; the Cas12i3 and Cas12i3-5M fragments were connected to the linearized pHUE411 vector using the pEASY-Uni seamless cloning assembly kit (Quanshijin, Beijing, China) to obtain the pHUE411-Cas12i3 and pHUE411-Cas12i3-5M basic vectors.

[0054] Among them, the pHUE411-Cas12i3 vector is a recombinant vector obtained by replacing the Cas9 gene in the pHUE411 vector with the Cas12i3 fusion gene, and the vector can express the Cas12i3 fusion protein shown in SEQ ID No.2; the pHUE411-Cas12i3-5M vector is a recombinant vector obtained by replacing the Cas9 gene in the pHUE411 vector with the Cas12i3-5M fusion gene, and the vector can express the Cas12i3-5M fusion protein shown in SEQ ID No.4.

[0055] The Cas12i3 fusion gene is shown in SEQ ID No. 1, encoding the Cas12i3 fusion protein shown in SEQ ID No. 2; in SEQ ID No. 2, positions 2-19 are nuclear localization signal peptides (NLS), positions 20-41 are 3xFlag tags, positions 42-1089 are Cas12i3 proteins, and positions 1090-1133 are nuclear localization signal peptides (NLS); The Cas12i3-5M fusion gene is shown in SEQ ID No.3, encoding the Cas12i3-5M fusion protein shown in SEQ ID No.4; in SEQ ID No.4, positions 2-19 represent a nuclear localization signal peptide (NLS), positions 20-41 represent a 3xFlag tag, positions 42-1089 represent a Cas12i3-5M protein, and positions 1090-1133 represent a nuclear localization signal peptide (NLS).

[0056] (2) Construction of intermediate vector: In order to release crRNA efficiently and accurately, the composite strong promoter 35S-CmYLCV-U6 (35S composite promoter) was used to initiate the transcription of crRNA, the tH4 terminator terminated the transcription, and the crRNA was spaced with tRNA and nuclease HDV. A 35S composite-tRNA-DR-PmeI-HDV-tH4 tandem homologous recombination fragment was prepared, and its sequence was shown in SEQ ID No. 13. In SEQ ID No. 13, positions 1-1326 show the 35S composite promoter, positions 1327-1403 show the DNA sequence of tRNA, positions 1404-1439 show the DR sequence of Cas12i3 crRNA, positions 1440-1447 show the recognition sequence of PmeI, positions 1448-1515 show the DNA sequence of HDV, and positions 1516-1765 show the sequence of the tH4 terminator. The 35S composite-tRNA-DR-PmeI-HDV-tH4 concatenated homologous recombination fragments were respectively Pme The backbone vectors obtained by enzyme digestion of pHUE411-Cas12i3 and pHUE411-Cas12i3-5M were subjected to homologous recombination to obtain the intermediate vectors pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4 and pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4.

[0057] (3) Construction of knockout vector: The primers DR-HRC-F / HDV-HRC-R, DR-SBEIIb-F / HDV-SBEIIb-R, DR-CKX2-F / HDV-CKX2-R, DR-ARE1-F / HDV-ARE1-R, DR-BADH2-F / HDV-BADH2-R, and DR-DEP1-F / HDV-BADH2-R were annealed to obtain DR-HRC-HDV, DR-SBEIIb-HDV, DR-CKX2-HDV, DR- DR-ARE1-HDV, DR-BADH2-HDV, and DR-DEP1-HDV fragments, respectively. The DR-HRC-HDV, DR-SBEIIb-HDV, DR-CKX2-HDV, DR-ARE1-HDV, DR-BADH2-HDV, and DR-DEP1-HDV fragments were further ligated to PmeⅠ The intermediate vectors pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4 and pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4 after enzyme digestion were connected to obtain the knockout vector ( Figure 2 ).

[0058] The vectors for editing each gene obtained from pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4 were respectively designated as pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4-OsHRC, pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4-OsSBEIIb, pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4-OsCKX2, pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4-OsARE1, and pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4-OsSBEIIb. composite-tRNA-DR-PmeI-HDV-tH4-OsBADH2, pHUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4-OsDEP1, each vector can express Cas12i3 fusion protein and be used for editing OxY , OsB , OsCKX2 , OsARE1 , OsBADH2 and OsDEP1 Gene.

[0059] The vectors for editing each gene obtained from pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4 were respectively designated as pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsHRC, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsSBEIIb, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsCKX2, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsARE1, and pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsSBEIIb. composite-tRNA-DR-PmeI-HDV-tH4-OsBADH2, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsDEP1, each vector can express Cas12i3-5M fusion protein and be used for editing OxY , OsB , OsCKX2 , OsARE1 , OsBADH2 and OsDEP1 Gene.

[0060] According to the method of step (1), pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsHRC, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsSBEIIb, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsCKX2, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsARE1, pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4-OsBADH2, and pHUE411-Cas12i3-5M-35S composite The Cas12i3-5M fusion gene in each vector of composite-tRNA-DR-PmeI-HDV-tH4-OsDEP1 was replaced with UL12-Cas12i3-5M fusion gene, T5E-Cas12i3-5M fusion gene, PapE-Cas12i3-5M fusion gene, and ME15-Cas12i3-5M fusion gene, respectively, to obtain UL12-Cas12i3-5M fusion protein, T5E-Cas12i3-5M fusion protein, PapE-Cas12i3-5M fusion protein, and ME15-Cas12i3-5M fusion protein, respectively, and used for editing OxY , OsB , OsCKX2 , OsARF4 , OsARE1 , OsBADH2 and OsDEP1 24 knockout vectors of genes ( Figure 2 ).

[0061] Among them, the UL12-Cas12i3-5M fusion gene is shown in SEQ ID No.5, encoding the UL12-Cas12i3-5M fusion protein shown in SEQ ID No.6; in SEQ ID No.6, positions 2-19 represent a nuclear localization signal peptide (NLS), positions 20-344 represent a UL12 protein, positions 345-406 represent a connecting peptide, positions 408-429 represent a 3xFlag tag, positions 430-1477 represent a Cas12i3-5M protein, and positions 1478-1521 represent a nuclear localization signal peptide (NLS).

[0062] The T5E-Cas12i3-5M fusion gene is shown in SEQ ID No.7, encoding the T5E-Cas12i3-5M fusion protein shown in SEQ ID No.8; in SEQ ID No.8, positions 2-19 represent a nuclear localization signal peptide (NLS), positions 20-309 represent a T5E protein, positions 310-371 represent a connecting peptide, positions 373-394 represent a 3xFlag tag, positions 395-1442 represent a Cas12i3-5M protein, and positions 1443-1486 represent a nuclear localization signal peptide (NLS).

[0063] The PapE-Cas12i3-5M fusion gene is shown in SEQ ID No.9, encoding the PapE-Cas12i3-5M fusion protein shown in SEQ ID No.10; in SEQ ID No.10, positions 2-19 represent a nuclear localization signal peptide (NLS), positions 20-625 represent a PapE protein, positions 626-687 represent a connecting peptide, positions 689-710 represent a 3xFlag tag, positions 711-1758 represent a Cas12i3-5M protein, and positions 1759-1802 represent a nuclear localization signal peptide (NLS).

[0064] The ME15-Cas12i3-5M fusion gene is shown in SEQ ID No.11, encoding the ME15-Cas12i3-5M fusion protein shown in SEQ ID No.12; in SEQ ID No.12, positions 2-19 represent a nuclear localization signal peptide (NLS), positions 20-322 represent ME15 protein, positions 323-384 represent a connecting peptide, positions 386-407 represent a 3xFlag tag, positions 408-1455 represent Cas12i3-5M protein, and positions 1456-1499 represent a nuclear localization signal peptide (NLS).

[0065] 1.2.3 Construction of multi-gene editing vectors In this experiment, three genes were designed ( OxY - OsB - OsCKX2 ), four genes ( OxY - OsB - OsCKX2-OsARF4 ), five genes ( OxY - OsB - OsCKX2-OsARF4-OsARE1 ) and six genes ( OxY - OsB - OsCKX2-OsARF4-OsARE1-OsBADH2) tandem strategy, using the composite strong promoter 35S-CmYLCV-U6 (35S composite) to initiate crRNA transcription, multiple crRNAs are tandemly connected with tRNA and nuclease HDV, and the tH4 terminator terminates the transcription.

[0066] HRC-HDV-F / SBEIIb-DR-R, SBEIIb-HDV-F / CKX2-DR-R, CKX2-HDV-F / ARF4-DR-R, ARF4-HDV-F / ARE1-DR-R, and ARE1-HDV-F / BADH2-DR-R were used respectively with the synthetic HDV-tRNA sequence as template to amplify the two-gene tandem fragments 1, 2, 3, 4, and 5, which were then purified and recovered respectively. Then, fragment 1 + fragment 2, fragment 1 + fragment 2 + fragment 3, fragment 1 + fragment 2 + fragment 3 + fragment 4, fragment 1 + fragment 2 + fragment 3 + fragment 4 + fragment 5 were used as templates, and primers DR-HRC-F / HDV-CKX2-R, DR-HRC-F / HDV-ARF4-R, DR-HRC-F / HDV-ARE1-R, and DR-HRC-F / HDV-BADH2-R were used for amplification respectively to obtain fragments of three genes, four genes, five genes, and six genes in series.

[0067] The synthetic HDV-tRNA sequence is: GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA, wherein positions 1-68 are the DNA fragment of HDV, and positions 69-145 are the DNA fragment of tRNA.

[0068] The above three-gene, four-gene, five-gene, and six-gene tandem fragments were connected to Pme Ⅰ After enzyme digestion, four multi-gene tandem knockout vectors were obtained on the intermediate vector pHUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4, each of which can express Cas12i3-5M fusion protein and be used to simultaneously edit three genes, four genes, five genes, and six genes.

[0069] Three genes: OxY , OsB and OsCKX2 Gene; Four genes: OxY , OsB , OsCKX2 and OsARF4 Gene; Five genes: OxY , OsB , OsCKX2 , OsARF4 and OsARE1 Gene; Six genes: OxY , OsB , OsCKX2 , OsARF4 , OsARE1 and OsBADH2 Gene.

[0070] According to the method of step (1), the Cas12i3-5M fusion gene in each of the above-mentioned multi-gene tandem knockout vectors is replaced with the UL12-Cas12i3-5M fusion gene, the T5E-Cas12i3-5M fusion gene, the PapE-Cas12i3-5M fusion gene, and the ME15-Cas12i3-5M fusion gene, respectively, to obtain 16 knockout vectors that can express UL12-Cas12i3-5M fusion protein, T5E-Cas12i3-5M fusion protein, PapE-Cas12i3-5M fusion protein, and ME15-Cas12i3-5M fusion protein, respectively, and are used to edit the above-mentioned two genes, three genes, four genes, five genes, and six genes.

[0071] Each carrier structure is as follows Figure 2 shown.

[0072] 1.2.4 Agrobacterium-mediated rice genetic transformation and tissue culture process The genetic transformation of rice was carried out by Agrobacterium transformation. The knockout vectors constructed in 1.2.2 and 1.2.3 were transformed into EHA105 Agrobacterium, and then the Agrobacterium containing the knockout vector was used to transform Zhonghua 11 rice callus. The specific steps are as follows: Take an appropriate amount of good Zhonghua 11 rice seeds in a sterile bottle, disinfect them with 70% ethanol aqueous solution for 15 minutes, then disinfect them with 20% sodium hypochlorite solution for 20 minutes, wash the seeds with sterile water 4-5 times in a sterilized clean bench, and soak them in sterile water for 3 hours. Place the disinfected rice seeds on the induction medium and culture them in the dark at 28°C for about 30 days until callus particles grow on the surface of the seeds. Pick fresh rice callus particles and move them to the subculture medium. Culture them in the dark at 28°C for about 10 days to form callus particles of moderate size, golden color, and round shape. Then transfer the subcultured callus with good growth to OD 600The cells were infecting with EHA105 bacterial solution containing knockout vector at 0.6-1.0 for 20 minutes. After infection, the surface bacterial solution was dried with filter paper and transferred to the co-culture medium, and cultured in the dark at 28°C for three days. The rice callus after co-culture was transferred to the first round of screening medium (50 mg / L hygromycin) and cultured in the dark at 28°C for 15 days; the callus was transferred to the second round of screening medium (75 mg / L hygromycin) and cultured in the dark at 28°C for 15 days; the callus with good growth after screening was regenerated in the medium (50 mg / L hygromycin) and cultured in the light at 28°C for about 14 days; the regenerated seedlings were moved to the rooting medium and cultured in the light for about 10 days, and then moved into the soil and placed in a greenhouse at 28-30°C with a light of 16 hours light / 8 hours dark to obtain T 0 Replace rice.

[0073] 1.2.5 vs. T 0 Genotyping of regenerated plants Cluster cutting T 0 The leaves of the transgenic rice seedlings were used to extract genomic DNA as a template using a DNA extraction kit (Tiangen, Beijing, China). The genomic DNA samples were tested with primers (MU6B-UP-F / Trans-RHRC-R, MU6B-UP-F / Trans-RSBE-R, MU6B-UP-F / Trans-CKX-R, MU6B-UP-F / Trans-ARE1-R, MU6B-UP-F / Trans-RBADH-R, MU6B-UP-F / Trans-DEP1-R, Cas12i-Test-F / Cas12i-Test-R) using the genomic DNA as a template to identify the number of transgenic plants. On this basis, the genomic DNA of the transgenic plants was used as a template, and the above transgenic plants were PCR amplified with genome-specific detection primers (HRC-F / HRC-R, SBE-F1 / SBE-R1, CKX2-F / CKX2-R, ARF4-F / ARF4-R, OsARE1-F1 / OsARE1-R1, rBADH-F / rBADH-R, DEP1-F / DEP1-R) and then Sanger sequenced. The sequencing results were analyzed for genotypes using the website http: / / dsdecode.scgene.com / . For samples with complex editing types, DNA was extracted from individual plants, and the PCR products were connected to the B-zero vector (Quanshijin, Beijing, China) after PCR amplification, and single clones were picked to determine the specific editing type.

[0074] 1.2.6 Off-target analysis Using the Offtarget (http: / / skl.scau.edu.cn / offtarget / ) website, we predicted rice OsHRC、OsSBEIIb , OsCKX2, OsARF4, OsARE1, OsBADH2 and OsDEP1 The potential off-target sites of the selected target genes were identified, and specific primers were designed (OsHRC-OFF1-F / OsHRC-OFF1-R, OsSBEIIb-OFF1-F / OsSBEIIb-OFF1-R, OsSBEIIb-OFF2-F / OsSBEIIb-OFF2-R, OFF-CKX2-1-F / OFF-CKX2-1-R, OFF-CKX2-2-F / OFF-CKX2-2-R, ARF4-OFF1-F / ARF4-OFF1-R, ARF4-OFF2-F / ARF4-OFF2-R, ARF4-OFF3-F / ARF4-OFF3-R, RARE1-OFF1-F / RARE1-OFF1-R3, RARE1-OFF2-F / RARE1-OFF2-R, RARE1-OFF3-F / RARE1-OFF3-R, DEP-OFF1-F / The amplification and sequencing of DEP-OFF1-R, DEP-OFF2-F / DEP-OFF2-R were performed, and the sequence alignment of the sequencing results was used to determine whether the selected target site had any off-target effects.

[0075] 2. Experimental results 2.1 Efficiency of single gene editing in rice mediated by different exonuclease strategies In order to determine the editing efficiency of single rice genes by strategies such as Cas12i3, Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M, we targeted endogenous rice genes. OsHRC、OsSBEIIb , OsCKX2, OsARE1, OsBADH2 and OsDEP1 Target ( Figure 1 ), and constructed a series of editing vectors ( Figure 2 ) for Agrobacterium-mediated stable transformation of rice, and each vector was repeated three times.

[0076] exist OxYFor target sites, for the Cas12i3 strategy, 84, 46, and 36 transgenic lines were obtained, respectively, and 4, 4, and 3 edited lines were identified, with editing efficiencies of 4.76%, 8.70%, and 8.33%, respectively, and an average editing efficiency of 7.26±2.18%; for the Cas12i3-5M strategy, 45, 27, and 34 transgenic lines were obtained, respectively, and 38, 22, and 27 edited lines were identified, with editing efficiencies of 84.44%, 81.48%, and 79.41%, respectively, and an average editing efficiency of 81.78±2.53%; for the T5E-Cas12i3-5M strategy, 32, 36, and 28 transgenic lines were obtained, respectively, and 29, 31, and 25 edited lines were identified, with editing efficiencies of 90.63%, 86.11%, and 89.29%, respectively, and an average editing efficiency of 88.68±2.32%; for UL1 For the 2-Cas12i3-5M strategy, 12, 11, and 9 transgenic lines were obtained, respectively, and 11, 10, and 8 edited lines were identified, with editing efficiencies of 91.67%, 90.91%, and 88.89%, respectively, and an average editing efficiency of 90.49±1.44%; for the PapE-Cas12i3-5M strategy, 19, 17, and 22 transgenic lines were obtained, respectively, and 16, 14, and 18 edited lines were identified, with editing efficiencies of 84.21%, 82.35%, and 81.82%, respectively, and an average editing efficiency of 82.79±1.26%; for the ME15-Cas12i3-5M strategy, 8, 6, and 5 transgenic lines were obtained, respectively, and 7, 5, and 4 edited lines were identified, with editing efficiencies of 87.50%, 83.33%, and 80.00%, respectively, and an average editing efficiency of 83.61±3.76%. Among the above strategies, the UL12-Cas12i3-5M strategy has the highest average editing efficiency ( Figure 3 ), which is 12.46 times higher than Cas12i3 (90.49% / 7.26%), and 1.11 times higher than Cas12i3-5M (90.49% / 81.78%). The editing efficiency of the UL12-Cas12i3-5M strategy is significantly improved compared with Cas12i3, Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M strategies. Compared with the T5E-Cas12i3-5M strategy, the average editing efficiency has increased, but it has not reached a significant level ( Figure 3 ).

[0077] exist OsBFor the target site, for the Cas12i3 strategy, 44, 43, and 40 transgenic lines were obtained, respectively, and 8, 9, and 5 edited lines were identified, with editing efficiencies of 18.18%, 20.93%, and 12.50%, respectively, and an average editing efficiency of 17.20±4.30%; for the Cas12i3-5M strategy, 25, 24, and 21 transgenic lines were obtained, respectively, and 21, 19, and 17 edited lines were identified, with editing efficiencies of 84.00%, 79.17%, and 80.95%, respectively, and an average editing efficiency of 81.37±2.44%; for the T5E-Cas12i3-5M strategy, 16, 25, and 15 transgenic lines were obtained, respectively, and 14, 21, and 13 edited lines were identified, with editing efficiencies of 87.50%, 84.00%, and 86.67%, respectively, and an average editing efficiency of 86.06±1.83%; for UL For the 12-Cas12i3-5M strategy, 23, 21, and 19 transgenic lines were obtained, respectively, and 21, 19, and 17 edited lines were identified, with editing efficiencies of 91.30%, 90.48%, and 89.47%, respectively, and an average editing efficiency of 90.42±0.92%; for the PapE-Cas12i3-5M strategy, 14, 20, and 13 transgenic lines were obtained, respectively, and 12, 17, and 11 edited lines were identified, with editing efficiencies of 85.71%, 85.00%, and 84.62%, respectively, and an average editing efficiency of 85.11±0.56%; for the ME15-Cas12i3-5M strategy, 10, 9, and 6 transgenic lines were obtained, respectively, and 8, 8, and 5 edited lines were identified, with editing efficiencies of 80.00%, 88.89%, and 83.33%, respectively, and an average editing efficiency of 84.07±4.49%. Among the above strategies, the UL12-Cas12i3-5M strategy has the highest average editing efficiency ( Figure 3 ), 5.26 times higher than Cas12i3 (90.42% / 17.20%), and 1.11 times higher than Cas12i3-5M (90.42% / 81.37%). The editing efficiency of the UL12-Cas12i3-5M strategy was significantly improved compared with Cas12i3, Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M strategies. Compared with the T5E-Cas12i3-5M strategy, the average editing efficiency was improved, but not to a significant level ( Figure 3 ).

[0078] exist OsCKX2For the target site, for the Cas12i3 strategy, 20, 19, and 24 transgenic lines were obtained, and 3, 1, and 2 edited lines were identified, with editing efficiencies of 15.00%, 5.26%, and 8.33%, respectively, and an average editing efficiency of 9.53±4.98%; for the Cas12i3-5M strategy, 35, 27, and 21 transgenic lines were obtained, and 32, 25, and 19 edited lines were identified, with editing efficiencies of 91.43%, 92.59%, and 90.48%, respectively, and an average editing efficiency of 91.50±1.06%; for the T5E-Cas12i3-5M strategy, 22, 19, and 21 transgenic lines were obtained, and 21, 17, and 20 edited lines were identified, with editing efficiencies of 95.45%, 89.47%, and 95.24%, respectively, and an average editing efficiency of 93.39±3.39%; for the UL12-Cas12i3-5M strategy, 35, 27, and 21 transgenic lines were obtained, and 32, 25, and 19 edited lines were identified, with editing efficiencies of 91.43%, 92.59%, and 90.48%, respectively, and an average editing efficiency of 91.50±1.06% For the s12i3-5M strategy, 24, 15, and 21 transgenic lines were obtained, and 23, 15, and 21 edited lines were identified, with editing efficiencies of 95.83%, 100.00%, and 100.00%, respectively, and an average editing efficiency of 98.61±2.41%. For the PapE-Cas12i3-5M strategy, 22, 19, and 25 transgenic lines were obtained, and 19, 17, and 23 edited lines were identified, respectively. For the ME15-Cas12i3-5M strategy, 30, 14, and 13 transgenic lines were obtained, and 29, 13, and 12 edited lines were identified, with editing efficiencies of 96.67%, 92.86%, and 92.31%, respectively, and an average editing efficiency of 93.95±2.37%. Among the above strategies, the UL12-Cas12i3-5M strategy had the highest average editing efficiency ( Figure 3 ), which is 10.35 times higher than Cas12i3 (98.61% / 9.53%), and 1.08 times higher than Cas12i3-5M (98.61% / 91.50%). The editing efficiency of the UL12-Cas12i3-5M strategy is significantly improved compared with Cas12i3, Cas12i3-5M, PapE-Cas12i3-5M and other strategies. Compared with the T5E-Cas12i3-5M and ME15-Cas12i3-5M strategies, the average editing efficiency has increased, but it has not reached a significant level ( Figure 3 ).

[0079] exist OsARE1For the target site, for the Cas12i3 strategy, 21, 28, and 12 transgenic lines were obtained, and no edited lines were identified, and the editing efficiency was 0.00%; for the Cas12i3-5M strategy, 17, 21, and 14 transgenic lines were obtained, and 13, 15, and 11 edited lines were identified, with editing efficiencies of 76.47%, 71.43%, and 78.57%, respectively, and an average editing efficiency of 75.49±3.67%; for the T5E-Cas12i3-5M strategy, 13, 14, and 9 transgenic lines were obtained, and 10, 12, and 8 edited lines were identified, with editing efficiencies of 76.92%, 85.71%, and 88.89%, respectively, and an average editing efficiency of 83.84±6.20%; for the UL12-Cas12i3-5M strategy, 27, 16, and 14 transgenic lines were obtained, and 13, 15, and 11 edited lines were identified, with editing efficiencies of 76.47%, 71.43%, and 78.57%, respectively, and an average editing efficiency of 75.49±3.67%. For the PapE-Cas12i3-5M strategy, 15, 11, and 13 transgenic lines were obtained, and 13, 10, and 12 edited lines were identified, with editing efficiencies of 86.67%, 90.91%, and 92.31%, respectively, and the average editing efficiency was 89.96±2.94%. For the ME15-Cas12i3-5M strategy, 22, 29, and 15 transgenic lines were obtained, and 20, 26, and 12 edited lines were identified, with editing efficiencies of 90.91%, 89.66%, and 80.00%, respectively, and the average editing efficiency was 86.85±5.97%. Cas12i3 did not achieve gene editing at this site. In addition, among the above strategies, the UL12-Cas12i3-5M strategy had the highest average editing efficiency ( Figure 3 ), which is 1.25 times higher than Cas12i3-5M (94.17% / 75.49%). The editing efficiency of the UL12-Cas12i3-5M strategy is significantly improved compared with Cas12i3, Cas12i3-5M, T5E-Cas12i3-5M, ME15-Cas12i3-5M and other strategies. Compared with the PapE-Cas12i3-5M strategy, the average editing efficiency has increased, but it has not reached a significant level ( Figure 3 ).

[0080] exist OsBADH2For the target site, for the Cas12i3 strategy, 105, 47, and 54 transgenic lines were obtained, with 7, 4, and 6 edited lines, respectively, with editing efficiencies of 6.67%, 8.51%, and 11.11%, respectively, and an average editing efficiency of 8.76±2.23%; for the Cas12i3-5M strategy, 56, 29, and 50 transgenic lines were obtained, with 50, 22, and 41 edited lines identified, with editing efficiencies of 89.29%, 75.86%, and 82.00%, respectively, and an average editing efficiency of 82.38±6.72%; for the T5E-Cas12i3-5M strategy, 55, 33, and 32 transgenic lines were obtained, with 53, 28, and 29 edited lines identified, with editing efficiencies of 96.36%, 84.85%, and 90.63%, respectively, and an average editing efficiency of 90.61±5.76%; for UL12 -Cas12i3-5M strategy, 24, 19, and 40 transgenic lines were obtained, respectively, of which 23, 18, and 39 edited lines were identified, with editing efficiencies of 95.83%, 94.74%, and 97.50%, respectively, and an average editing efficiency of 96.02±1.39%; for PapE-Cas12i3-5M strategy, 14, 11, and 8 transgenic lines were obtained, respectively, of which 12, 10, and 6 edited lines were identified, with editing efficiencies of 85.71%, 90.91%, and 75.00%, respectively, and an average editing efficiency of 83.87±8.11%; for ME15-Cas12i3-5M strategy, 12, 9, and 9 transgenic lines were obtained, respectively, of which 10, 8, and 7 edited lines were identified, with editing efficiencies of 83.33%, 88.89%, and 77.78%, respectively, and an average editing efficiency of 83.33±5.56%. Among the above strategies, the UL12-Cas12i3-5M strategy has the highest average editing efficiency ( Figure 3 ), which is 10.96 times higher than Cas12i3 (96.02% / 8.76%), and 1.17 times higher than Cas12i3-5M (96.02% / 82.38%). The editing efficiency of the UL12-Cas12i3-5M strategy is significantly improved compared with Cas12i3, Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M strategies. Compared with the T5E-Cas12i3-5M strategy, the average editing efficiency has increased, but it has not reached a significant level ( Figure 3 ).

[0081] exist OsDEP1For the target site, for the Cas12i3 strategy, 43, 31, and 48 transgenic lines were obtained, with 5, 3, and 6 edited lines, respectively, with editing efficiencies of 11.63%, 9.68%, and 12.50%, respectively, and an average editing efficiency of 11.27±1.45%; for the Cas12i3-5M strategy, 19, 21, and 11 transgenic lines were obtained, with 16, 18, and 9 edited lines identified, with editing efficiencies of 88.89%, 85.71%, and 81.82%, respectively, and an average editing efficiency of 85.47±3.54%; for the T5E-Cas12i3-5M strategy, 10, 9, and 7 transgenic lines were obtained, with 9, 8, and 6 edited lines identified, with editing efficiencies of 90.00%, 88.89%, and 85.71%, respectively, and an average editing efficiency of 88.20±2.22%; for the UL12-Cas12 For the i3-5M strategy, 31, 19, and 32 transgenic lines were obtained, respectively, of which 29, 18, and 30 edited lines were identified, with editing efficiencies of 93.55%, 94.74%, and 93.75%, respectively, and an average editing efficiency of 94.01±0.64%; for the PapE-Cas12i3-5M strategy, 27, 36, and 21 transgenic lines were obtained, respectively, of which 24, 32, and 18 edited lines were identified, with editing efficiencies of 88.89%, 88.89%, and 85.71%, respectively, and an average editing efficiency of 87.83±1.83%; for the ME15-Cas12i3-5M strategy, 20, 30, and 13 transgenic lines were obtained, respectively, of which 17, 27, and 11 edited lines were identified, with editing efficiencies of 85.00%, 90.00%, and 84.62%, respectively, and an average editing efficiency of 86.54±3.00%. Among the above strategies, the UL12-Cas12i3-5M strategy has the highest average editing efficiency ( Figure 3 ), 8.34 times higher than Cas12i3 (94.01% / 11.27%), and 1.10 times higher than Cas12i3-5M (94.01% / 85.47%). The editing efficiency of the UL12-Cas12i3-5M strategy is significantly improved compared with Cas12i3, Cas12i3-5M, T5E-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M strategies ( Figure 3 ).

[0082] In summary, at the six rice endogenous gene target sites, the fusion of different exonucleases can improve the editing efficiency, and the strategy of Cas12i3-5M fused with UL12 exonuclease achieved the highest average editing efficiency ( Figure 3 ).

[0083] 2.2 Statistical analysis of the length of deletion fragments generated by different exonucleases at the target site In order to study the effect of different exonucleases on the size of deleted fragments produced in the rice genome, the deletion fragments produced by single gene editing plants using strategies such as Cas12i3, Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M were statistically analyzed. The results are shown in Table 1. Figure 4 .

[0084] exist OxYIn the editing strains of the target, the Cas12i3 strategy was all deletions within 1-40 bp, of which 1-20 bp deletions accounted for 83.33%, and 21-40 bp deletions accounted for 16.67%; the Cas12i3-5M strategy was mainly 1-20 bp deletions, accounting for 74.09%, 21-40 bp deletions accounted for 17.74%, 41-60 bp deletions accounted for 2.92%, 61-80 bp deletions accounted for 0.00%, 81-100 bp deletions accounted for 4.14%, and deletions greater than 100 bp accounted for 1.11%; the T5E-Cas12i3-5M strategy deleted longer fragments, of which 1-20 bp deletions accounted for 20.59%, 21-40 bp deletions accounted for 36.61%, 41-60 bp deletions accounted for 25.69%, 61-80 bp deletions accounted for 4.95%, 81-100 The deletion of bp accounted for 5.57%, the deletion of more than 100 bp accounted for 6.48%, and the longest could reach 199 bp; the deletion fragments of the UL12-Cas12i3-5M strategy were similar to those of Cas12i3-5M, among which the deletion of 1-20 bp accounted for 72.64%, the deletion of 21-40 bp accounted for 19.71%, the deletion of 41-60 bp accounted for 4.32%, the deletion of 61-80 bp accounted for 1.67%, the deletion of 81-100 bp accounted for 0.00%, and the deletion of more than 100 bp accounted for 1.67%; the deletion fragments of the PapE-Cas12i3-5M strategy were longer, among which the deletion of 1-20 bp accounted for 13.41%, the deletion of 21-40 bp accounted for 36.22%, the deletion of 41-60 bp accounted for 31.87%, the deletion of 61-80 bp accounted for 7.35%, and the deletion of 81-100 bp accounted for 0.00%. bp deletion accounted for 1.15%, deletion greater than 100 bp accounted for 10.01%, and the longest could reach 134 bp; ME15-Cas12i3-5M strategy deleted longer fragments, of which 1-20 bp deletion accounted for 11.62%, 21-40 bp deletion accounted for 28.43%, 41-60 bp deletion accounted for 30.23%, 61-80 bp deletion accounted for 0.00%, 81-100 bp deletion accounted for 7.79%, deletion greater than 100 bp accounted for 21.93%, and the longest could reach 104 bp. At this site, exonuclease UL12 did not expand the length of the deletion fragment, while the other exonucleases expanded the length of the deletion fragment ( Figure 4 ).

[0085] exist OsBIn the editing strains of the target, the Cas12i3 strategy mainly deleted 1-20 bp, accounting for 87.22%, 21-40 bp deletion accounted for 6.11%, and 41-60 bp deletion accounted for 6.67%; the Cas12i3-5M strategy mainly deleted 1-20 bp, accounting for 81.31%, 21-40 bp deletion accounted for 16.25%, 41-60 bp deletion accounted for 2.44%, and no larger deletion was produced; the T5E-Cas12i3-5M strategy deleted longer fragments, of which 1-20 bp deletion accounted for 26.04%, 21-40 bp deletion accounted for 19.54%, 41-60 bp deletion accounted for 31.40%, 61-80 bp deletion accounted for 12.32%, 81-100 bp deletion accounted for 6.35%, deletions greater than 100 bp accounted for 4.35%, and the longest deletion could reach 131. bp; the deletion fragments of the UL12-Cas12i3-5M strategy are similar to those of Cas12i3-5M, among which 1-20 bp deletions account for 80.47%, 21-40 bp deletions account for 13.35%, 41-60 bp deletions account for 3.38%, 61-80 bp deletions account for 0.81%, 81-100 bp deletions account for 0.88%, and deletions greater than 100 bp account for 1.11%. Compared with Cas12i3-5M, a small number of larger fragments were deleted; the deletion fragments of the PapE-Cas12i3-5M strategy are longer, among which 1-20 bp deletions account for 16.99%, 21-40 bp deletions account for 30.64%, 41-60 bp deletions account for 11.14%, 61-80 bp deletions account for 7.22%, 81-100 bp deletions account for 2.78%, and deletions greater than 100 bp account for 2. bp deletion accounted for 31.23%, and the longest could reach 177 bp; ME15-Cas12i3-5M strategy deleted longer fragments, of which 1-20 bp deletion accounted for 35.28%, 21-40 bp deletion accounted for 32.49%, 41-60 bp deletion accounted for 7.79%, 61-80 bp deletion accounted for 16.29%, 81-100 bp deletion accounted for 0.00%, and deletion greater than 100 bp accounted for 8.14%, and the longest could reach 151 bp. At this site, exonuclease UL12 produced a small number of larger deletion fragments, and the main deletion type was consistent with Cas12i3-5M, and the other exonucleases all expanded the length of the deletion fragments ( Figure 4 ).

[0086] exist OsCKX2In the editing strains of the target, the Cas12i3 strategy mainly deleted within 1-20 bp, accounting for 93.33%, and the deletion of 21-40 bp accounted for 6.67%, and no deletion of larger fragments was produced; the Cas12i3-5M strategy mainly deleted 1-20bp, accounting for 87.56%, 21-40 bp deletion accounted for 7.42%, 41-60 bp deletion accounted for 2.42%, and 61-80 bp deletion accounted for 2.60%; the T5E-Cas12i3-5M strategy deleted longer fragments, of which 1-20 bp deletion accounted for 39.70%, 21-40 bp deletion accounted for 39.16%, 41-60 bp deletion accounted for 16.95%, 61-80 bp deletion accounted for 0.88%, 81-100 bp deletion accounted for 0.81%, deletions greater than 100 bp accounted for 2.50%, and the longest was 116 bp; the deletion fragments of the UL12-Cas12i3-5M strategy are similar to those of Cas12i3-5M, among which 1-20 bp deletions account for 91.36%, 21-40 bp deletions account for 3.36%, 41-60 bp deletions account for 1.92%, 61-80 bp deletions account for 1.45%, 81-100 bp deletions account for 1.19%, and deletions greater than 100 bp account for 0.72%; the deletion fragments of the PapE-Cas12i3-5M strategy are longer, among which 1-20 bp deletions account for 13.40%, 21-40 bp deletions account for 43.21%, 41-60 bp deletions account for 20.08%, 61-80 bp deletions account for 7.39%, 81-100 bp deletions account for 8.25%, and deletions greater than 100 bp account for 7.67%, with the longest being 190 bp; ME15-Cas12i3-5M strategy deleted longer fragments, of which 1-20 bp deletion accounted for 35.60%, 21-40 bp deletion accounted for 37.50%, 41-60 bp deletion accounted for 11.18%, 61-80 bp deletion accounted for 4.53%, 81-100 bp deletion accounted for 5.70%, deletion greater than 100 bp accounted for 5.48%, and the longest was 170 bp. At this site, exonuclease UL12 did not expand the length of the deletion fragment, while the other exonucleases all expanded the length of the deletion fragment ( Figure 4 ).

[0087] exist OsARE1Among the editing strains of the target, the Cas12i3 strategy did not obtain editing plants; the Cas12i3-5M strategy mainly produced 1-20 bp deletions, accounting for 78.69%, 21-40 bp deletions accounted for 19.16%, no 41-100 bp deletions were produced, and deletions greater than 100 bp accounted for 2.15%; the T5E-Cas12i3-5M strategy deleted longer fragments, of which 1-20 bp deletions accounted for 31.31%, 21-40 bp deletions accounted for 44.36%, 41-60 bp deletions accounted for 9.13%, 61-80 bp deletions accounted for 6.20%, 81-100 bp deletions accounted for 0.00%, and deletions greater than 100 bp accounted for 8.99%, with the longest being 238 bp; the UL12-Cas12i3-5M strategy deleted fragments similar to those of Cas12i3-5M, of which 1-20 bp deletion accounted for 77.61%, 21-40 bp deletion accounted for 21.03%, 41-60 bp deletion accounted for 0.00%, 61-80 bp deletion accounted for 1.36%, and no larger fragments were deleted; the PapE-Cas12i3-5M strategy deleted longer fragments, of which 1-20 bp deletion accounted for 24.29%, 21-40 bp deletion accounted for 47.44%, 41-60 bp deletion accounted for 8.64%, 61-80 bp deletion accounted for 8.30%, 81-100 bp deletion accounted for 4.32%, and deletions greater than 100 bp accounted for 7.02%, with the longest being 177 bp; the ME15-Cas12i3-5M strategy deleted longer fragments, of which 1-20 bp deletion accounted for 31.21%, 21-40 bp deletion accounted for 46.13%, 41-60 bp accounted for 6.48%, 61-80 bp accounted for 7.24%, 81-100 bp accounted for 0.00%, and deletions greater than 100 bp accounted for 8.94%, with the longest being 163 bp. At this site, exonuclease UL12 did not extend the length of the deletion fragment, while the other exonucleases all extended the length of the deletion fragment ( Figure 4 ).

[0088] exist OsBADH2In the editing strains of the target, the Cas12i3 strategy mainly deleted within 1-20 bp, accounting for 83.33%, and the deletion of 21-40 bp accounted for 16.67%, and no deletion of larger fragments was produced; the Cas12i3-5M strategy mainly deleted 1-20bp, accounting for 90.05%, the deletion of 21-40 bp accounted for 9.62%, and the deletion of 41-60 bp accounted for 0.33%, and no deletion of larger fragments was produced; the T5E-Cas12i3-5M strategy deleted longer fragments, among which the deletion of 1-20 bp accounted for 39.82%, the deletion of 21-40bp accounted for 42.71%, the deletion of 41-60 bp accounted for 14.00%, the deletion of 61-80 bp accounted for 1.89%, the deletion of 81-100 bp accounted for 1.26%, the deletion of more than 100 bp accounted for 0.32%, and the longest deletion was 121. bp; the deletion fragments of the UL12-Cas12i3-5M strategy are similar to those of Cas12i3-5M, of which 1-20 bp deletions account for 86.50%, 21-40 bp deletions account for 13.06%, and 41-60 bp deletions account for 0.44%, and no larger deletions are produced; the deletion fragments of the PapE-Cas12i3-5M strategy are longer, of which 1-20 bp deletions account for 29.49%, 21-40 bp deletions account for 41.14%, 41-60 bp deletions account for 16.04%, 61-80 bp deletions account for 6.96%, 81-100 bp deletions account for 4.70%, and deletions greater than 100 bp account for 1.67%, with the longest being 134 bp; the deletion fragments of the ME15-Cas12i3-5M strategy are longer, of which 1-20 bp deletions account for 28.85%, 21-40 bp accounted for 31.62%, 41-60 bp accounted for 31.62%, 61-80 bp accounted for 2.78%, 81-100 bp accounted for 2.56%, and deletions greater than 100 bp accounted for 2.56%, with the longest being 154 bp. At this site, exonuclease UL12 did not extend the length of the deleted fragment, while the other exonucleases all extended the length of the deleted fragment ( Figure 4 ).

[0089] exist OsDEP1In the editing strains of the target, the Cas12i3 strategy mainly deleted within 1-20 bp, accounting for 84.13%, and the deletion of 21-40 bp accounted for 15.87%, and no deletion of larger fragments was produced; the Cas12i3-5M strategy mainly deleted 1-20bp, accounting for 72.41%, 21-40 bp accounted for 14.78%, 41-60 bp accounted for 5.32%, 61-80 bp accounted for 6.51%, and 81-100 bp accounted for 0.98%; the T5E-Cas12i3-5M strategy deleted longer fragments, of which 1-20 bp accounted for 46.24%, 21-40 bp accounted for 32.70%, 41-60 bp accounted for 5.11%, 61-80 bp accounted for 10.83%, 81-100 bp accounted for 2.08%, and deletions greater than 100 The deletion of bp accounted for 3.03%, and the longest was 163 bp; the deletion fragments of the UL12-Cas12i3-5M strategy were similar to those of Cas12i3-5M, among which the deletion of 1-20 bp accounted for 83.63%, the deletion of 21-40 bp accounted for 6.97%, the deletion of 41-60 bp accounted for 0.93%, the deletion of 61-80 bp accounted for 0.58%, the deletion of 81-100 bp accounted for 1.17%, and the deletion of more than 100 bp accounted for 6.73%; the deletion fragments of the PapE-Cas12i3-5M strategy were longer, among which the deletion of 1-20 bp accounted for 9.71%, the deletion of 21-40 bp accounted for 43.30%, the deletion of 41-60 bp accounted for 16.46%, the deletion of 61-80 bp accounted for 10.79%, the deletion of 81-100 bp accounted for 10.24%, and the deletion of more than 100 bp accounted for 1 bp deletion accounted for 9.50%, and the longest was 205 bp; ME15-Cas12i3-5M strategy deleted longer fragments, of which 1-20 bp deletion accounted for 42.44%, 21-40 bp deletion accounted for 21.99%, 41-60 bp deletion accounted for 11.06%, 61-80 bp deletion accounted for 11.90%, 81-100 bp deletion accounted for 2.24%, and deletion greater than 100 bp accounted for 10.36%, with the longest being 189 bp. At this site, exonuclease UL12 did not expand the length of the deletion fragment, while the other exonucleases expanded the length of the deletion fragment ( Figure 4 ).

[0090] In summary, statistical analysis was performed on the deletion types of edited plants obtained by six strategies, including Cas12i3, Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M. The results showed that UL12 exonuclease could not expand the rice genome deletion fragment produced by Cas12i3-5M, while T5E, PapE, ME15, etc. could expand the length of the genome deletion fragment produced by Cas12i3-5M.

[0091] 2.3 Efficiency of rice multi-gene editing mediated by different exonuclease strategies In order to determine the efficiency of Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M strategies for simultaneous editing of multiple targets in rice, three genes were constructed ( OxY - OsB - OsCKX2 ), four genes ( OxY - OsB - OsCKX2-OsARF4 ), five genes ( OxY - OsB - OsCKX2-OsARF4-OsARE1 ) and six genes ( OxY - OsB - OsCKX2-OsARF4-OsARE1- OsBADH2 ) Simultaneously edited vectors ( Figure 2 ), and each vector was replicated three times for Agrobacterium-mediated rice genetic transformation.

[0092] for OxY - OsB - OsCKX2 For the vector with three gene target sites in series, the Cas12i3-5M strategy obtained a total of 38 transgenic strains, of which 26 strains were found to be edited at the three sites at the same time, with an editing efficiency of 68.42%; the T5E-Cas12i3-5M strategy obtained a total of 31 transgenic strains, of which 22 strains were found to be edited at the three sites at the same time, with an editing efficiency of 70.97%; the UL12-Cas12i3-5M strategy obtained a total of 29 transgenic strains, of which 24 strains were found to be edited at the three sites at the same time, with an editing efficiency of 82.76%; the PapE-Cas12i3-5M strategy obtained a total of 54 transgenic strains, of which 38 strains were found to be edited at the three sites at the same time, with an editing efficiency of 70.37%; the ME15-Cas12i3-5M strategy obtained a total of 29 transgenic strains, of which 21 strains were found to be edited at the three sites at the same time, with an editing efficiency of 72.41% ( Figure 5 ). Compared with Cas12i3-5M, the editing efficiency of the fusion exonuclease strategy was improved. Among them, the UL12-Cas12i3-5M strategy had the highest efficiency of editing three genes simultaneously, which was 1.21 times higher than that of Cas12i3-5M (82.76% / 68.42%).

[0093] for OxY - OsB - OsCKX2-OsARF4 For the vector with four gene target sites in series, the Cas12i3-5M strategy obtained a total of 19 transgenic strains, and it was identified that 10 strains were edited at the same time at four sites, with an editing efficiency of 52.63%; the T5E-Cas12i3-5M strategy obtained a total of 14 transgenic strains, and it was identified that 8 strains were edited at the same time at four sites, with an editing efficiency of 57.14%; the UL12-Cas12i3-5M strategy obtained a total of 44 transgenic strains, and it was identified that 27 strains were edited at the same time at four sites, with an editing efficiency of 61.36%; the PapE-Cas12i3-5M strategy obtained a total of 28 transgenic strains, and it was identified that 16 strains were edited at the same time at four sites, with an editing efficiency of 57.14%; the ME15-Cas12i3-5M strategy obtained a total of 33 transgenic strains, and it was identified that 19 strains were edited at the same time at four sites, with an editing efficiency of 57.58% ( Figure 5 ). Compared with Cas12i3-5M, the editing efficiency of the fusion exonuclease strategy was improved. Among them, the UL12-Cas12i3-5M strategy had the highest efficiency of editing four genes simultaneously, which was 1.17 times higher than that of Cas12i3-5M (61.36% / 52.63%).

[0094] for OxY - OsB - OsCKX2-OsARF4-OsARE1For the vector with five gene target sites in series, the Cas12i3-5M strategy obtained a total of 30 transgenic strains, of which 13 strains were found to have been edited at the five sites at the same time, with an editing efficiency of 43.33%; the T5E-Cas12i3-5M strategy obtained a total of 20 transgenic strains, of which 10 strains were found to have been edited at the five sites at the same time, with an editing efficiency of 50.00%; the UL12-Cas12i3-5M strategy obtained a total of 34 transgenic strains, of which 18 strains were found to have been edited at the five sites at the same time, with an editing efficiency of 52.94%; the PapE-Cas12i3-5M strategy obtained a total of 30 transgenic strains, of which 14 strains were found to have been edited at the five sites at the same time, with an editing efficiency of 46.67%; the ME15-Cas12i3-5M strategy obtained a total of 11 transgenic strains, of which 5 strains were found to have been edited at the five sites at the same time, with an editing efficiency of 45.45% ( Figure 5 ). Compared with Cas12i3-5M, the editing efficiency of the fusion exonuclease strategy was improved. Among them, the UL12-Cas12i3-5M strategy had the highest efficiency of editing five genes simultaneously, which was 1.22 times higher than that of Cas12i3-5M (52.94% / 43.33%).

[0095] for OxY - OsB - OsCKX2 - OsARF4 - OsARE1 - OsBADH2 For the vector with six gene target sites in series, the Cas12i3-5M strategy obtained a total of 48 transgenic strains, of which 20 strains were found to have been edited at the six sites at the same time, with an editing efficiency of 41.67%; the T5E-Cas12i3-5M strategy obtained a total of 34 transgenic strains, of which 16 strains were found to have been edited at the six sites at the same time, with an editing efficiency of 47.06%; the UL12-Cas12i3-5M strategy obtained a total of 47 transgenic strains, of which 24 strains were found to have been edited at the six sites at the same time, with an editing efficiency of 51.07%; the PapE-Cas12i3-5M strategy obtained a total of 43 transgenic strains, of which 20 strains were found to have been edited at the six sites at the same time, with an editing efficiency of 46.51%; the ME15-Cas12i3-5M strategy obtained a total of 14 transgenic strains, of which 6 strains were found to have been edited at the six sites at the same time, with an editing efficiency of 42.86% ( Figure 5 ). Compared with Cas12i3-5M, the editing efficiency of the fusion exonuclease strategy was improved. Among them, the UL12-Cas12i3-5M strategy had the highest efficiency of editing four genes simultaneously, which was 1.23 times higher than that of Cas12i3-5M (51.07% / 41.67%).

[0096] The present invention constructs a rice multi-gene editing system by using Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M and ME15-Cas12i3-5M strategies with high editing efficiency, and designs combinations of three genes, four genes, five genes and six genes knocked out in series, respectively, to carry out Agrobacterium-mediated stable genetic transformation of rice. The results show that the fusion of exonucleases T5E, UL12, PapE and ME15 can improve the multi-gene editing efficiency of Cas12i3-5M, among which the UL12-Cas12i3-5M strategy maintains the highest editing efficiency in the combination of each gene series, and the efficiencies of simultaneous editing of three genes, four genes, five genes and six genes mediated by it are 82.76%, 61.36%, 52.94% and 51.07%, respectively. Therefore, the present invention uses the strategy of fusing the Cas12i3-5M variant with different exonucleases to establish an efficient multi-gene editing system in rice, among which UL12-Cas12i3-5M has the highest efficiency, and the multi-gene editing efficiency of different combinations is not less than 50%.

[0097] 2.4 T 0 Off-target analysis of edited plants Using the Offtarget (http: / / skl.scau.edu.cn / offtarget / ) website, we predicted rice OsHRC, OsSBEIIb , OsCKX2, OsARE1, OsBADH2, OsDEP1 and OsARF4 The potential off-target sites of the selected target of the gene were identified, and specific primers were designed for PCR amplification and sequencing. The sequence alignment of the sequencing results was used to determine whether the selected target had off-target conditions. The predicted potential off-target sites are shown in Table 3, and a total of 96 strains were identified for each site.

[0098] for OsARF4 A total of 96 strains were identified, of which 6 strains had off-targets at the predicted potential off-target sites of OsARF4-OFF1 and OsARF4-OFF2, respectively, with off-target rates of 6.25% for both sites; no off-targets were identified at the remaining potential off-target sites (Table 3).

[0099] Table 3. T 0 Off-target analysis of edited plants

[0100] Note: The first three underlined letters of the "potential off-target site sequence" represent the PAM sequence, and the bold letters represent the mismatch sequence.

[0101] 3. Conclusion The present invention establishes an efficient and high-efficiency single gene knockout system by testing single gene editing of rice on Cas12i3, Cas12i3-5M variants and fusions of Cas12i3-5M with exonucleases such as T5E, UL12, PapE, and ME15; further, the efficient Cas12i3-5M, T5E-Cas12i3-5M, UL12-Cas12i3-5M, PapE-Cas12i3-5M, and ME15-Cas12i3-5M strategies are used to carry out rice multi-gene editing research. The UL12-Cas12i3-5M strategy maintains the highest simultaneous editing efficiency in three genes, four genes, five genes, and six gene combinations. The establishment of the above-mentioned rice efficient multi-gene editing system provides important tools and technical support for the use of CRISPR / Cas12i3 for crop gene function research and the generation of multiple excellent alleles to create new crop germplasm. The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

[0102] References Bortesi, L., C. Zhu, J. Zischewski, L. Perez, L. Bassie, R. Nadi, G.Forni, SB Lade, E. Soto, X. Jin, V. Medina, G. Villorbina, P. Munoz, G.Farre, R. Fischer, RM Twyman, T. Capell, P. Christou&S. Schillberg (2016)Patterns of CRISPR / Cas9 activity in plants, animals and microbes. Plant Plant Biotechnol J,[[]] 14,2203-2216. Ding, Y., F. Zhang, F. Sun, J. Liu, Z. Zhu, X. He, G. Bai, Z. Ni, Q.Sun&Z. Su (2023) Loss of OsHRC function confers blast resistance withoutyield penalty in rice. Plant Biotechnol J,[[]] 21,1516-1518. Guo, D., X. Ling, X. Zhou, X. Li, J. Wang, S. Qiu, Y. Yang&B. Zhang(2020) Evaluation of the Quality of a High-Resistant Starch and Low-GlutelinRice (Oryza sativa L.) Generated through CRISPR / Cas9-Mediated TargetedMutagenesis. J Agric Food Chem,[[]] 68,9733-9742. He, Y., Y. Han, Y. Ma, S. Liu, T. Fan, Y. Liang, X. Tang, X. Zheng,Y. Wu, T. Zhang, Y. Qi&Y. Zhang (2024) Expanding plant genome editing scopeand profiles with CRISPR-FrCas9 systems targeting palindromic TA sites. Plant Plant Biotechnol J,[[]] 22,2488-2503. Hu, Z., S. J. Lu, M. J. Wang, H. He, L. Sun, H. Wang, X. H. Liu, L.Jiang, J. L. Sun, X. Xin, W. Kong, C. Chu, H. W. Xue, J. Yang, X. Luo&J. X.Liu (2018) A Novel QTL qTGW3 Encodes the GSK3 / SHAGGY-Like Kinase OsGSK5 / OsSK41 that Interacts with OsARF4 to Negatively Regulate Grain Size andWeight in Rice. Mol Plant,[[]] 11,736-749. Hui, S., H. Li, A. M. Mawia, L. Zhou, J. Cai, S. Ahmad, C. Lai, J.Wang, G. Jiao, L. Xie, G. Shao, Z. Sheng, S. Tang, J. Wang, X. Wei, S. Hu&P.Hu (2022) Production of aromatic three-line hybrid rice using novel allelesof BADH2. Plant Biotechnol J,[[]] 20,59-74. Li, C., Z. Zhou, X. Xiong, C. Li, C. Li, E. Shen, J. Wang, W. Zha, B.Wu, H. Chen, L. Zhou, Y. Lin&A. You (2024) Development of a multi-resistanceand high-yield rice variety using multigene transformation and geneediting. Plant Biotechnol J,[[]] 22,3118-3120. Li, J., S. Zhang, R. Zhang, J. Gao, Y. Qi, G. Song, W. Li, Y. Li&G.Li (2021) Efficient multiplex genome editing by CRISPR / Cas9 in commonwheat.Plant Biotechnol J,[[]] 19,427-429. Li, S., L. Shen, P. Hu, Q. Liu, X. Zhu, Q. Qian, K. Wang&Y. Wang(2019) Developing disease-resistant thermosensitive male sterile rice bymultiplex gene editing. J Integr Plant Biol,[[]] 61,1201-1205. Liang, Z., Y. Wu, Y. Guo&S. Wei (2023) Addition of the T5 exonucleaseincreases the prime editing efficiency in plants. J Genet Genomics,[[]] 50,582-588. Liu, K., Y. Sakuraba, N. Ohtsuki, M. Yang, Y. Ueda&S. Yanagisawa(2023) CRISPR / Cas9-mediated elimination of OsHHO3, a transcriptionalrepressor of three AMMONIUM TRANSPORTER1 genes, improves nitrogen useefficiency in rice. Plant Biotechnol J,[[]] 21,2169-2172. Lorenzo, CD, K. Debray, D. Herwegh, W. Develtere, L. Impens, D.Schaumont, W. Vandeputte, S. Aesaert, G. Coussens, Y. De Boe, K. Demuynck, T.Van Hautegem, L. Pauwels, TB Jacobs, T. Ruttink, H. Nelissen&D. Inze(2023) BREEDIT: a multiplex genome editing strategy to improve complexquantitative traits in maize. Plant Cell,[[]] 35,218-238. Luo, J., S. Li, J. Xu, L. Yan, Y. Ma&L. Xia (2021) Pyramidingfavorable alleles in an elite wheat variety in one generation by CRISPR-Cas9-mediated multiplex gene editing. Mol Plant,[[]] 14,847-850. Lv, P., F. Su, F. Chen, C. Yan, D. Xia, H. Sun, S. Li, Z. Duan, C.Ma, H. Zhang, M. Wang, X. Niu, J. K. Zhu&J. Zhang (2024) Genome editing inrice using CRISPR / Cas12i3. Plant Biotechnol J,[[]] 22,379-385. Miao Liu, J., Q. Mei, C. Yun Xue, Z. Yuan Wang, D. Pin Li, Y. XinZhang&Y. Hu Xuan (2021) Mutation of G-protein gamma subunit DEP1 increasesplanting density and resistance to sheath blight disease in rice. Plant Plant Biotechnol J,[[]] 19,418-420. Ming, M., Q. Ren, C. Pan, Y. He, Y. Zhang, S. Liu, Z. Zhong, J. Wang,A. A. Malzahn, J. Wu, X. Zheng, Y. Zhang&Y. Qi (2020) CRISPR-Cas12b enablesefficient plant genome engineering. Nat Plants,[[]] 6,202-208. Pan, W., C. Gao, D. Niu, J. Cheng, J. Zhang, X. Yan, Q. Long, Y. Zhu,W. Sun, Q. Xie, Y. He, XW Deng, H. Zhang&J. Li (2024) Efficient genedisruption in polyploid genome by Cas9-Trex2 fusion protein. J Integr Plant Biol . Rong, C., Y. Liu, Z. Chang, Z. Liu, Y. Ding&C. Ding (2022) Cytokininoxidase / dehydrogenase family genes exhibit functional divergence and overlapin rice growth and development, especially in control of tillering. J Exp Bot,[[]] 73,3552-3568. Schreiber, T., A. Prange, P. Schafer, T. Iwen, R. Grutzner, S.Marillonnet, A. Lepage, M. Javelle, W. Paul&A. Tissier (2024) Efficient scar-free knock-ins of several kilobases in plants by engineered CRISPR-Casendonucleases. Mol Plant,[[]] 17,824-837. Shan, Q., Y. Wang, J. Li, Y. Zhang, K. Chen, Z. Liang, K. Zhang, J.Liu, JJ Xi, JL Qiu&C. Gao (2013) Targeted genome modification of cropplants using a CRISPR-Cas system. Nat Biotechnol,[[]] 31,686-8. Sun, S., L. Wang, H. Mao, L. Shao, X. Li, J. Xiao, Y. Ouyang&Q. Zhang(2018) A G-protein pathway determines grain size in rice. Nat Commun,[[]] 9,851. Tang, X., L. G. Lowder, T. Zhang, A. A. Malzahn, X. Zheng, D. F.Voytas, Z. Zhong, Y. Chen, Q. Ren, Q. Li, E. R. Kirkland, Y. Zhang&Y. Qi(2017) A CRISPR-Cpf1 system for efficient genome editing and transcriptionalrepression in plants. Nat Plants,[[]] 3,17103. Wang, M., Y. Mao, Y. Lu, X. Tao&J. K. Zhu (2017) Multiplex GeneEditing in Rice Using the CRISPR-Cpf1 System. Mol Plant,[[]] 10,1011-1013. Wang, Q., J. Nian, X. Xie, H. Yu, J. Zhang, J. Bai, G. Dong, J. Hu,B. Bai, L. Chen, Q. Xie, J. Feng, X. Yang, J. Peng, F. Chen, Q. Qian, J. Li&J. Zuo (2018) Genetic variations in ARE1 mediate grain yield by modulatingnitrogen utilization in rice. Nat Commun,[[]] 9,735. Wu, Y., Q. Yuan, Y. Zhu, X. Gao, J. Song&Z. Yin (2020) ImprovingFnCas12a Genome Editing by Exonuclease Fusion. CRISPR J,[[]] 3,503-511. Xu, R., R. Qin, H. Li, D. Li, L. Li, P. Wei&J. Yang (2017) Generationof targeted mutant rice using a CRISPR-Cpf1 system. Plant Biotechnol J,[[]] 15,713-717. Zhang, D., B. Tian, Y. Ling, L. Ye, M. Xiao, K. Yuan, X. Zhang, G.Zheng, X. Li, J. Zheng, Y. Liao, B. Shu&B. Gu (2024) CRISPR / Cas12a-PoweredAmplification-Free RNA Diagnostics by Integrating T7 Exonuclease-AssistedTarget Recycling and Split G-Quadruplex Catalytic Signal Output. Anal Chem,[[]] 96,10451-10458. Zhang, H., X. Kong, M. Xue, J. Hu, Z. Wang, Y. Wei, H. Wang, J. Zhou,W. Zhang, M. Xu, X. Shen, F. Yin, Z. Ai, G. Huang, J. Xia, X. Song, H. Li, Y.Yuan, J. Li, N. Zhong, M. Zhang, Y. Zhou&H. Yang (2023) An engineered xCas12iwith high activity, high specificity, and broad PAM range. Protein Cell,[[]] 14,538-543. Zheng, X., S. Zhang, Y. Liang, R. Zhang, L. Liu, P. Qin, Z. Zhang, Y.Wang, J. Zhou, X. Tang&Y. Zhang (2023) Loss-function mutants of OsCKX genefamily based on CRISPR-Cas systems revealed their diversified roles inrice. Plant Genome,[[]] 16,e20283.

Claims

1. A fusion protein comprising an exonuclease and Cas12i3-5M, wherein the exonuclease is UL12, T5E, ME15 or PapE.

2. The fusion protein according to claim 1, characterized in that: The UL12 is as follows: A1), A2) or A3): A1) a protein having amino acids 20 to 344 of SEQ ID No. 6; A2) a protein having the same function as SEQ ID No. 6 with one or more amino acid residues substituted and / or deleted and / or added at positions 20-344; A3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of A1) or A2); The T5E is as follows: B1), B2) or B3): B1) a protein having amino acids 20 to 309 of SEQ ID No. 8; B2) a protein having the same function as SEQ ID No. 8 with one or more amino acid residues substituted and / or deleted and / or added at positions 20-309; B3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of B1) or B2); The PapE is as follows: C1), C2) or C3): C1) a protein whose amino acids are positions 20-625 of SEQ ID No. 10; C2) a protein having the same function as SEQ ID No. 10 with one or more amino acid residues substituted and / or deleted and / or added at positions 20-625; C3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of C1) or C2); The ME15 is as follows (D1), D2) or D3): D1) a protein whose amino acids are positions 20 to 322 of SEQ ID No. 12; D2) a protein having the same function as SEQ ID No. 12 with one or more amino acid residues substituted and / or deleted and / or added at positions 20-322; D3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of D1) or D2); The Cas12i3-5M is as follows (E1), E2) or E3): E1) a protein whose amino acids are positions 42 to 1089 of SEQ ID No. 4; E2) a protein having the same function as SEQ ID No. 4, wherein one or more amino acid residues at positions 42 to 1089 are substituted and / or deleted and / or added; E3) is a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of E1) or E2).

3. The fusion protein according to claim 1 or 2, characterized in that: The fusion protein further comprises a nuclear localization signal and / or a connecting peptide.

4. The fusion protein according to any one of claims 1 to 3, characterized in that: The fusion protein is UL12-Cas12i3-5M fusion protein, T5E-Cas12i3-5M fusion protein, PapE-Cas12i3-5M fusion protein or ME15-Cas12i3-5M fusion protein; The UL12-Cas12i3-5M fusion protein is a protein whose amino acid is SEQ ID No.6; The T5E-Cas12i3-5M fusion protein is a protein whose amino acid is SEQ ID No. 8; The PapE-Cas12i3-5M fusion protein is a protein whose amino acid sequence is SEQ ID No. 10; The ME15-Cas12i3-5M fusion protein is a protein whose amino acid sequence is SEQ ID No.

12.

5. The biological material related to the fusion protein according to any one of claims 1 to 4, which is at least one of the following H1) to H4): H1) A nucleic acid molecule encoding the fusion protein according to any one of claims 1 to 4; H2) an expression cassette containing the nucleic acid molecule described in H1); H3) a recombinant vector containing the nucleic acid molecule described in H1) or a recombinant vector containing the expression cassette described in H2); H4) A recombinant microorganism containing the nucleic acid molecule described in H1), a recombinant microorganism containing the expression cassette described in H2), or a recombinant microorganism containing the recombinant vector described in H3).

6. The biomaterial according to claim 5, characterized in that: H1) In the nucleic acid molecule, the nucleic acid molecule encoding the UL12 is a DNA molecule whose coding sequence is positions 58 to 1032 of SEQ ID No. 5 in the sequence list; The nucleic acid molecule encoding the T5E is a DNA molecule whose coding sequence is positions 58-927 of SEQ ID No. 7 in the sequence list; The nucleic acid molecule encoding the PapE is a DNA molecule whose coding sequence is positions 58 to 1875 of SEQ ID No. 9 in the sequence list; The nucleic acid molecule encoding the ME15 is a DNA molecule whose coding sequence is positions 58-966 of SEQ ID No. 11 in the sequence list; The nucleic acid molecule encoding the Cas12i3-5M is a DNA molecule whose coding sequence is SEQ ID No. 3 at positions 124-3267 in the sequence table.

7. The biomaterial according to claim 5 or 6, characterized in that: H3) The recombinant vector also contains a crRNA expression cassette, which contains the tRNA DNA fragment shown at positions 1327-1403 of SEQ ID No.13, the DR sequence of Cas12i3 crRNA shown at positions 1404-1439 or positions 1417-1439, and the HDV DNA fragment shown at positions 1448-1515.

8. Use of the fusion protein according to any one of claims 1 to 4 in rice gene editing.

9. Use of the biological material described in any one of claims 5 to 7 in rice gene editing.

10. The use according to claim 8 or 9, characterized in that: The gene is a single gene or a plurality of genes.

Images