Novel siRNA, composition containing same and application

Abstract

The invention provides siRNA for inhibiting RAGE gene expression. The siRNA contains a positive-sense strand and an antisense strand. The siRNA provided by the invention has good stability, and can efficiently and specifically inhibit RAGE gene expression, so that the siRNA has important clinical value in treatment of RAGE related diseases.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese patent application 202311264167.4 filed on September 27, 2023 and Chinese patent application 202411319454.5 filed on September 20, 2024, and the entire contents of the above patent applications are incorporated herein by reference in their entirety. Technical Field

[0003] The present invention provides an siRNA for inhibiting the expression of receptor for advanced glycation end products (RAGE) and a pharmaceutical composition thereof. The siRNA and the pharmaceutical composition thereof provided by the present invention can treat diseases related to RAGE. Technical Background

[0004] The receptor for advanced glycation end products ("RAGE" or "AGER") is a ~43 kDa transmembrane protein of the immunoglobulin superfamily that functions as a proinflammatory pattern recognition receptor. In its full-length membrane-bound form, the receptor has three functional domains: an extracellular ligand-binding domain, a hydrophobic transmembrane domain, and a cytoplasmic domain that mediates ligand-dependent signaling. A second, non-membrane-bound, soluble form of the receptor (sRAGE) contains only the extracellular ligand binding; formed by proteolytic cleavage (or by alternative splicing) of the full-length membrane-bound RAGE, sRAGE antagonizes RAGE function because it binds ligand but lacks the cytoplasmic signaling domain.

[0005] RAGE is expressed at constitutively high levels in the lung, primarily localized to type 1 alveolar epithelial cells. Other tissues in the body normally express RAGE at low levels, but expression is upregulated in the presence of RAGE ligands and chronic inflammation. As a pattern recognition receptor, RAGE binds a variety of endogenous ligands, including advanced glycation end products (glycomodified proteins or lipids), high-mobility group box 1 (HMGB1), beta-amyloid Aβ, and S100 protein. Different intermediate signaling pathways can be activated by different RAGE ligands (e.g., ERK1 / 2, p38, and JAK / STAT), ultimately leading to the generation of reactive oxygen species, sustained activation of NF-κB, and alterations in proinflammatory genes (e.g., interleukins, interferons, TNF-α). Transcription of the gene encoding RAGE itself is promoted by NF-κB, forming a positive feedback loop that perpetuates chronic inflammation.

[0006] RAGE has been implicated in chronic pathological inflammation that contributes to many diseases, including: pulmonary disease (asthma, acute respiratory distress syndrome, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease, cystic fibrosis, pneumonia, lung cancer, bronchopulmonary dysplasia), cardiovascular disease (atherosclerosis, myocardial infarction, heart failure, peripheral vascular disease), cancer, diabetes, chronic kidney disease, neurodegenerative diseases, rheumatoid arthritis, nonalcoholic steatohepatitis, injury caused by certain viral infections, including SARS-CoV-2, certain ocular inflammatory conditions, and skeletal muscle atrophy.

[0007] In the field of lung disease, RAGE knockout (KO) mice are completely protected physiologically and histologically from allergic asthma caused by house dust mite allergens or ovalbumin. Similarly, RAGE knockout mice are protected from acute lung injury and inflammation induced by hyperoxia or lipopolysaccharide. (See, e.g., Oczypok et al., Paediatr Respir Rev., 23: 40-49 (2017); Wang et al., Shock, 50: 472-482 (2018)). Genome-wide association studies (GWAS) have linked the variable gain-of-function RAGE allele (G82S) to increased inflammation, decreased lung function, and asthma risk (see, e.g., Hancock et al., Nat Genet., 42: 45-52 (2010); Repapi et al., Nat Genet., 42: 36-44 (2010)).

[0008] Although RAGE is potentially attractive as a drug target, the development of effective and selective RAGE inhibitors has proven to be extremely challenging. A wide range of RAGE ligands interact with multiple binding sites within the antibody-like extracellular domain, rather than binding to discrete domains (see, e.g., Rojas et al., Current Drug Targets, 20: 340-346 (2019)). Therefore, there is a need for RAGE RNAi agents suitable for use as therapeutic agents for treating RAGE-related diseases and disorders. Summary of the invention

[0009] The present invention provides siRNA that can effectively inhibit the expression of RAGE gene, and thus provides medicine and method for preventing and / or treating RAGE related diseases.

[0010] siRNA

[0011] In one aspect, the present invention provides a small interfering RNA (siRNA) for inhibiting the expression of the RAGE gene, wherein the siRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises at least 14 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO:1 to SEQ ID NO:419 by no more than 4 (e.g., 0, 1, 2, 3 or 4) nucleotides, and the sense strand is at least partially complementary to the antisense strand.

[0012] The at least partially complementary means that the two sequences can be completely complementary, or generally no more than 4, 3, 2 or 1 mismatched base pairings, while retaining the ability to hybridize under relevant conditions. Those skilled in the art can determine the conditions that are most suitable for testing the complementarity of the two sequences based on the final application of the hybridized nucleotides. Such conditions can be, for example, stringent conditions, such as 400mM NaCl, 40mM PIPES pH 6.4, 1mM EDTA, 50°C or 70°C for 12-16 hours, followed by washing. Other conditions, such as physiologically relevant conditions that may be encountered in vivo, can also be applied.

[0013] In some embodiments, the RAGE mRNA refers to an mRNA having a sequence shown in, for example, Genbank: NM_001136.5.

[0014] In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 4 (e.g., 0, 1, 2, 3, or 4) nucleotides. In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 3 (e.g., 0, 1, 2, or 3) nucleotides. In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 2 (e.g., 0, 1, or 2) nucleotides. In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 1 (e.g., 0 or 1) nucleotide. In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) of the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419.

[0015] In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 2 nucleotides.

[0016] In some embodiments, the antisense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 4 nucleotides.

[0017] In some embodiments, the antisense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 2 (e.g., 0, 1, or 2) nucleotides. In some embodiments, the antisense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 1 (e.g., 0 or 1) nucleotides. In some embodiments, the antisense strand comprises at least 17 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419.

[0018] In some embodiments, the antisense strand is a nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419.

[0019] In some embodiments, the sense strand has no more than 4 nucleotide mismatches with the antisense strand. The sense strand has no more than 3 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 2 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 1 nucleotide mismatch with the antisense strand. In some embodiments, the sense strand is fully complementary to the antisense strand.

[0020] In some embodiments, the sense strand has at least 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides complementary to the antisense strand. In some embodiments, the sense strand has 14 to 19 nucleotides complementary to the antisense strand.

[0021] In some embodiments, the sense strand and the antisense strand have at least 85% (eg, at least 90%, at least 95%, at least 99%) complementarity or complete complementarity over at least 14 consecutive nucleotides.

[0022] In some embodiments, the sense strand has at least 17, 18, 19, 20, or 21 nucleotides of complementarity with the antisense strand. In some embodiments, the sense strand has 17 to 19 nucleotides of complementarity with the antisense strand.

[0023] In some embodiments, the sense strand and the antisense strand have at least 85% (eg, at least 90%, at least 95%, at least 99%) complementarity or complete complementarity over at least 17 consecutive nucleotides.

[0024] In some embodiments, the sense strand and the antisense strand form a duplex region of 14 to 30 nucleotide pairs in length, such as 14 to 25 nucleotide pairs, 14 to 23 nucleotide pairs, 14 to 21 nucleotide pairs, 15 to 25 nucleotide pairs, 15 to 23 nucleotide pairs, 15 to 21 nucleotide pairs, 17 to 25 nucleotide pairs, 17 to 23 nucleotide pairs, or 17 to 21 nucleotide pairs, such as 14, 15, 16, 17, 18, 19, 20, or 21 nucleotide pairs. In some embodiments, the sense strand and the antisense strand form a duplex region of 14 to 19 nucleotide pairs in length.

[0025] In some embodiments, the antisense strand is 14 to 30 (e.g., 14 to 29, 14 to 28, 14 to 27, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 25, 19 to 23, 21 to 25, 21 to 23) nucleotides in length, and the sense strand is 14 to 30 (e.g., 14 to 29, 14 to 28, 14 to 27, 14 to 26, 14 to 25, 14 to 21, 19 to 21) nucleotides in length. In some embodiments, the antisense strand and sense strand are each independently 17 to 30 nucleotides in length.

[0026] In some embodiments, the antisense strand is 19 to 27 nucleotides in length; and the sense strand is 17 to 25 nucleotides in length.

[0027] In some embodiments, the antisense strand is 21 to 23 nucleotides in length; and the sense strand is 19 to 21 nucleotides in length.

[0028] In some embodiments, the antisense strand is 21 nucleotides in length and the sense strand is 19 nucleotides in length.

[0029] In some embodiments, the siRNA comprises blunt ends and / or overhanging ends.

[0030] In some embodiments, the siRNA comprises one or more single-stranded nucleotide overhangs. For example, an overhang of 1, 2, 3 or 4 nucleotides. In some embodiments, the overhang can be on the sense strand, the antisense strand or any combination thereof. In some embodiments, the overhang is present at the 5' end, the 3' end or both ends of the siRNA antisense strand or the sense strand.

[0031] In some embodiments, the 3' end of the antisense strand of the siRNA has an overhang of 2 nucleotides. In some embodiments, the 3' end of the sense strand of the siRNA is blunt-ended.

[0032] In some embodiments, the sense strand of the siRNA comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838 by no more than 4 (e.g., 0, 1, 2, 3, or 4) nucleotides. The at least 14 consecutive nucleotides comprised by the sense strand and antisense strand of the siRNA form a duplex region. In some embodiments, the sense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838 by no more than 3 (e.g., 0, 1, 2, or 3) nucleotides. In some embodiments, the sense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838 by no more than 2 (e.g., 0, 1, or 2) nucleotides. In some embodiments, the sense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838 by no more than 1 (e.g., 0 or 1) nucleotides. In some embodiments, the sense strand has a region of at least 85% (e.g., at least 90%, at least 95%, at least 99%) complementarity or complete complementarity with the antisense strand within the 14 consecutive nucleotides. In some embodiments, the sense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) of the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838. In some embodiments, the sense strand is the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838.

[0033] In some embodiments, the sense strand comprises at least 14 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO:420 to SEQ ID NO:838 by no more than 2 nucleotides.

[0034] In some embodiments, the sense strand of the siRNA comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO:420 to SEQ ID NO:838 by no more than 4 nucleotides.

[0035] In some embodiments, the sense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838 by no more than 2 (e.g., 0, 1, or 2) nucleotides. In some embodiments, the sense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838 by no more than 1 (e.g., 0 or 1) nucleotides. In some embodiments, the sense strand has a region of at least 85% (e.g., at least 90%, at least 95%, at least 99%) complementarity or complete complementarity with the antisense strand within the 17 consecutive nucleotides. In some embodiments, the sense strand comprises at least 17 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838. In some embodiments, the sense strand is the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838.

[0036] In some embodiments, the antisense strand of the siRNA comprises the antisense strand sequence of any double-stranded protein of GPSZRA001 to GPSZRA419 provided in Table 1 or a portion thereof (e.g., at least 14 consecutive nucleotides thereof), and the sense strand of the siRNA comprises the sense strand sequence of the double-stranded protein or a portion thereof (e.g., at least 14 consecutive nucleotides thereof).

[0037] In some embodiments, the antisense strand of the siRNA comprises the antisense strand sequence of any duplex provided in Table 7 or a portion thereof (e.g., at least 14 consecutive nucleotides thereof). Preferably, the sense strand of the siRNA comprises the sense strand sequence of the duplex or a portion thereof (e.g., at least 14 consecutive nucleotides thereof).

[0038] In some embodiments, the antisense strand of the siRNA comprises the antisense strand sequence of any duplex of GPSZRA272, GPSZRA267, GPSZRA271, GPSZRA381, GPSZRA284, GPSZRA266, GPSZRA283, GPSZRA308, GPSZRA360, GPSZRA277, GPSZRA276, GPSZRA288, GPSZRA282 or GPSZRA285 provided in Table 1 or a portion thereof (e.g., at least 14 consecutive nucleotides thereof). Preferably, the sense strand of the siRNA comprises the sense strand sequence of the duplex or a portion thereof (e.g., at least 14 consecutive nucleotides thereof).

[0039] In some embodiments, the antisense strand of the siRNA comprises GPSZRA286, GPSZRA402, GPSZRA092, GPSZRA307, GPSZRA290, GPSZRA410, GPSZRA274, GPSZRA289, GPSZRA382, GPSZRA409, GPSZRA255, GPSZRA087, GPSZRA379, GPSZRA165, GPSZRA275, GPSZRA408, GPSZRA257, GPSZRA318, GPSZRA281, GPSZRA104, GPSZRA254, GPSZRA103, GPSZRA287, GPSZRA252, GPSZRA410, GPSZRA274, GPSZRA289, GPSZRA382, GPSZRA409, GPSZRA255, GPSZRA087, GPSZRA379, GPSZRA165, GPSZRA275, GPSZRA408, GPSZRA257, GPSZRA318, GPSZRA281, GPSZRA104, GPSZRA254, GPSZRA103, GPSZRA287, GPSZRA252, GPSZRA410, GPSZRA274, GPSZRA289, GPSZRA382, GPSZRA409, GPSZRA255 Preferably, the sense strand of the siRNA comprises the sense strand sequence of the duplex or a portion thereof (e.g., at least 14 consecutive nucleotides thereof).

[0040] In some embodiments, the siRNA targets a region within nucleotides 1-400 of RAGE mRNA, for example, the sequence shown in SEQ ID NO: 1417. Preferably, the siRNA comprises an antisense strand and / or a sense strand derived from any duplex of GPSZRA001 to GPSZRA118.

[0041] In some embodiments, the siRNA targets a region within nucleotides 351-750 of RAGE mRNA, for example, the sequence shown in SEQ ID NO: 1418. Preferably, the siRNA comprises an antisense strand and / or a sense strand derived from any duplex of GPSZRA090 to GPSZRA251.

[0042] In some embodiments, the siRNA targets a region within nucleotides 701-1100 of RAGE mRNA, for example, the sequence shown in SEQ ID NO: 1419. Preferably, the siRNA comprises an antisense strand and / or a sense strand derived from any duplex of GPSZRA250 to GPSZRA358.

[0043] In some embodiments, the siRNA targets a region within nucleotides 1021-1420 of RAGE mRNA, for example, the sequence shown in SEQ ID NO: 1420. Preferably, the siRNA comprises an antisense strand and / or a sense strand derived from any duplex of GPSZRA359 to GPSZRA419.

[0044] Modification

[0045] The siRNA of the present invention can be modified in the nucleoside base structure or in the ribose-phosphate backbone structure to reduce the effect of missing the target, and / or increase the biological stability of the molecule, or increase the physical stability of the duplex formed between the antisense and sense nucleic acids. Therefore, the siRNA sequence comprising any modification is also encompassed within the scope of the present invention. The siRNA molecule comprising ribonucleoside analogs or derivatives must maintain the ability to form duplexes and allow or mediate the specific degradation of the target RNA via the RISC approach.

[0046] In some embodiments, the siRNA contains at least one modified nucleotide. The modification need not be the same for each of the plurality of modified ribonucleosides in the siRNA.

[0047] In some embodiments, all nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides or nucleotide analogs. In some embodiments, all nucleotides in the sense strand of the siRNA are modified nucleotides or nucleotide analogs, and all nucleotides in the antisense strand of the siRNA are modified nucleotides or nucleotide analogs.

[0048] In some embodiments, the siRNA comprises 2'-modified nucleotides.

[0049] In some embodiments, the modified nucleotide or nucleotide analog is selected from 2'-methoxy nucleotides, 2'-fluoro nucleotides, 5'-(E)-vinyl phosphate modified nucleotides, 2'-deoxyribonucleotides, 2',3'-split ring nucleotide analogs, 2'-fluoroarabino nucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 3'-methoxy nucleotides, 2'-allyl modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate esters, nucleotides containing 5'-phosphate mimetics, diol-modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleic acids (LNA), unlocked nucleic acids (UNA) or glycerol nucleotides (GNA), but the present invention is not limited thereto.

[0050] In some embodiments, the modified nucleotides or nucleotide analogs are selected from at least one of 2'-methoxy nucleotides, 2'-fluoro nucleotides, nucleotides comprising thiophosphate groups, locked nucleic acids, and 5'-(E)-vinyl phosphate modified nucleotides or a combination thereof. In some embodiments, the sense strand comprises at least one of 2'-methoxy nucleotides, 2'-fluoro nucleotides, or a combination thereof. In some embodiments, the sense strand comprises at least one of 2'-methoxy nucleotides, 2'-fluoro nucleotides, or a locked nucleic acid or a combination thereof. In some embodiments, the antisense strand comprises at least one of 2'-methoxy nucleotides, 2'-fluoro nucleotides, or a 5'-(E)-vinyl phosphate modified nucleotides or a combination thereof. In some embodiments, the sense strand comprises at least one locked nucleic acid. In some embodiments, the sense strand comprises at least one nucleotide comprising a thiophosphate group. In some embodiments, the antisense strand comprises at least one nucleotide comprising a thiophosphate group.

[0051] In some embodiments, the first nucleotide at the 5' end of the antisense strand is a 5'-(E)-vinyl phosphate modified nucleotide. Conventional antisense strands need to be phosphorylated at the 5' end before they can be loaded with the Ago2 protein to form a RISC complex and exert RNAi activity. By introducing 5'-(E)-vinyl phosphate modification (5'-(E)-Vinylphosphonate, 5'-(E)-VP), the antisense strand is pre-phosphorylated and does not need to be rephosphorylated in vivo. It can be directly loaded to form a RISC complex, which improves the antisense strand loading efficiency and improves the overall activity of siRNA.

[0052] In some embodiments, the nucleotides in the sense strand are selected from at least two of 2'-methoxy nucleotides, 2'-fluoro nucleotides or locked nucleic acids, and / or the nucleotides in the antisense strand are selected from 2'-methoxy nucleotides and 2'-fluoro nucleotides; preferably, the first nucleotide at the 5' end of the antisense strand further comprises a 5'-(E)-vinyl phosphate modification.

[0053] In some embodiments, the siRNA of the present invention comprises a modified internucleoside connection or a modified backbone. The modified internucleoside connection or backbone includes, but is not limited to, phosphorothioate, 2'-O methoxyethyl (MOE), 2'-fluoro, alkyl phosphate, phosphorodithioate, alkyl phosphorothioate, phosphoramidate, carbamate, carbonate, phosphotriester, acetamidate, carboxymethyl ester and combinations thereof.

[0054] In some embodiments, the modified nucleotide is a nucleotide in which the phosphate group is modified by a phosphorothioate group, that is, a non-bridging oxygen atom in a phosphodiester bond is substituted with a sulfur atom, thereby replacing the phosphodiester bond with a phosphorothioate diester bond.

[0055] In some embodiments, the 5' end and / or 3' end of the sense strand independently comprises 1 or 2 phosphorothioate linkages; and / or the 5' end and / or 3' end of the antisense strand independently comprises 1 or 2 phosphorothioate linkages. In some embodiments, the 5' end of the sense strand comprises 1 or 2 phosphorothioate linkages, and the 5' end and / or 3' end of the antisense strand independently comprises 1 or 2 phosphorothioate linkages.

[0056] In some embodiments, the sense strand may include one or more blocking residues or moieties, referred to as "blocking residues". A "blocking residue" is a non-nucleotide compound or other moiety that can be incorporated into one or more ends of the nucleotide sequence of the siRNA. In some embodiments, the blocking residue is present at the 5' end, the 3' end, or both the 5' end and the 3' end of the sense strand.

[0057] In some embodiments, an inverted abasic residue (iab) is added as a capping residue. See F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16. In some embodiments, the 5' end and / or 3' end of the sense strand may contain more than one inverted abasic deoxyribose moiety as a capping residue.

[0058] In some embodiments, one or more inverted abasic residues (iab) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic residues (iab) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues are included at or near one or more ends of the siRNA sense strand.

[0059] Inverted abasic residues may be linked via phosphate, phosphorothioate or other internucleoside linkages.

[0060] In some embodiments, the antisense strand of the siRNA is 21 nucleotides in length and comprises the following modification pattern:

[0061] (1) 5'-NmsNfsNmNfNmNfNmNfNmNfNmNmNmNfNmNfNmNfNmsNmsNm-3' (SEQ ID NO: 1409);

[0062] (2) 5'-NmsNfsNmNmNmNfNmNfNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1410);

[0063] (3) 5'-NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1411);

[0064] (4) 5'-VPNmsNfsNmNfNmNfNmNfNmNfNmNmNmNfNmNfNmNfNmsNmsNm-3' (SEQ ID NO: 1423);

[0065] (5) 5'-VPNmsNfsNmNmNmNfNmNfNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1424); or

[0066] (6) 5'-VPNmsNfsNmNmNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1425);

[0067] Wherein, Nm is a methoxy-modified nucleotide, Nf is a fluorinated-modified nucleotide, VP indicates that the adjacent nucleotide on the right is a 5'-(E)-vinyl phosphate-modified nucleotide, and s is a thiophosphate-linked nucleotide. The nucleotide can be selected from C, G, U or A.

[0068] In some embodiments, the sense strand of the siRNA is 19 nucleotides in length and comprises the following modification pattern:

[0069] (1) 5'-NmsNmNfNmNfNmNfNfNfNmNfNmNfNmNfNmNfNmsNf-3' (SEQ ID NO: 1412);

[0070] (2) 5'-NmsNmNfNmNmNmNfNfNfNmNfNmNfNmNfNmNmNmsNm-3' (SEQ ID NO: 1413);

[0071] (3) 5'-NmsNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmsNm-3' (SEQ ID NO: 1414);

[0072] or

[0073] (5)5'-NmsNmNmNmNfNmNfNfNfNmNmNmNmNmNmNfNmNmNmsNm-3' (SEQ ID NO: 1416);

[0074] Wherein, Nm is a methoxy-modified nucleotide, Nf is a fluorinated-modified nucleotide, N(LNA) is a locked nucleic acid-modified nucleotide, and s is a phosphorothioate linkage. The nucleotide can be selected from C, G, U or A.

[0075] In some embodiments, the siRNA comprises a modification pattern selected from the following, wherein the first SEQ ID NO corresponds to the antisense strand and the second SEQ ID NO corresponds to the sense strand: SEQ ID NO: 1409 and SEQ ID NO: 1412; SEQ ID NO: 1409 and SEQ ID NO: 1413; SEQ ID NO: 1409 and SEQ ID NO: 1414; SEQ ID NO: 1409 and SEQ ID NO: 1415; SEQ ID NO: 1409 and SEQ ID NO: 1416; SEQ ID NO: 1410 and SEQ ID NO: 1412; SEQ ID NO: 1410 and SEQ ID NO: 1413; SEQ ID NO: 1410 and SEQ ID NO: 1414; SEQ ID NO: 1410 and SEQ ID NO: 1415; SEQ ID NO: 1410 and SEQ ID NO: 1416; SEQ ID NO: 1411 and SEQ ID NO: 1412; SEQ ID NO: 1411 and SEQ ID NO: 1413; SEQ ID NO: 1410 and SEQ ID NO: 1414; SEQ ID NO:1411 and SEQ ID NO:1414; SEQ ID NO:1411 and SEQ ID NO:1415; SEQ ID NO:1411 and SEQ ID NO:1416; SEQ ID NO:1423 and SEQ ID NO:1412; SEQ ID NO:1423 and SEQ ID NO:1413; SEQ ID SEQ ID NO:1423 and SEQ ID NO:1414; SEQ ID NO:1423 and SEQ ID NO:1415; SEQ ID NO:1423 and SEQ ID NO:1416; SEQ ID NO:1424 and SEQ ID NO:1412; SEQ ID NO:1424 and SEQ ID NO:1413; SEQ ID NO:1424 and SEQ ID NO:1414; SEQ ID NO:1424 and SEQ ID NO:1415; SEQ ID NO:1424 and SEQ ID NO:1416; SEQ ID NO:1425 and SEQ ID NO:1412; SEQ ID NO:1425 and SEQ ID NO:1413; SEQ ID NO:1425 and SEQ ID NO:1414; SEQ ID NO:1425 and SEQ ID NO:1415; SEQ ID NO:1425 and SEQ ID NO:1416.

[0076] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 839-1123, 1426-1438.

[0077] In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1124-1408.

[0078] In some embodiments, the sequences of the sense strand and the antisense strand of the siRNA are selected from the sense strand and the antisense strand sequences of any duplex of GPSZRA084S1 to GPSZRA402S5-VP provided in Table 4.

[0079] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 882, 1034 and 1037. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1167, 1319 and 1322. In some embodiments, the sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any duplex of GPSZRA318S1, GPSZRA281S4 or GPSZRA284S4 provided in Table 4.

[0080] In some embodiments, the antisense strand comprises SEQ ID NOs: 846, 850, 852, 858, 860, 861, 863, 866, 869, 872, 878, 890, 891, 894, 904, 907, 909, 913-915, 920, 923, 924, 926, 935, 939, 946, 947, 951, 961, 964, 971, 97 2, 980, 992, 996, 1004, 1008, 1018, 1021, 1023, 1028, 1029, 1040, 1049, 1053, 1061, 1065, 1075, 1078, 1080, 1085, 1086, 1094, 1097, 1106, 1118. In some embodiments, the sense strand comprises the nucleotide sequence of SEQ ID NOs: 1131, 1135, 1137, 1143, 1145, 1146, 1148, 1151, 1154, 1157, 1163, 1175, 1176, 1179, 1189, 1192, 1194, 1198-1200, 1205, 1208, 1209, 1211, 1220, 1224, 1231, 1232, 1236, 1246 , 1249, 1256, 1257, 1265, 1277, 1281, 1289, 1293, 1303, 1306, 1308, 1313, 1314, 1325, 1334, 1338, 1346, 1350, 1360, 1363, 1365, 1370, 1371, 1379, 1382, 1391, and the nucleotide sequence shown in any one of the above.In some embodiments, the sequences of the sense strand and the antisense strand of the siRNA are selected from GPSZRA233S2, GPSZRA272S2, GPSZRA284S3, GPSZRA402S5, GPSZRA402S3, GPSZRA314S1, GPSZRA314S3, GPSZRA272S5, GPSZRA314S4, GPSZRA271S3, GPSZRA287S4, GPSZRA287S5, GPSZ RA314S2, GPSZRA314S5, GPSZRA287S2, GPSZRA233S5, GPSZRA402S4, GPSZRA410S2, GPSZRA231S5, GPSZRA231S1, GPSZRA227S2, GPSZRA402S2, GPSZRA272S4, GPSZRA271S4, GPSZRA410S4, GPSZRA276S1, GPSZRA318S2, GPSZRA27 1S2, GPSZRA272S1, GPSZRA285S2, GPSZRA231S4, GPSZRA284S1, GPSZRA318S3, GPSZRA233S1, GPSZRA231S2, GPSZ RA231S3, GPSZRA402S1, GPSZRA233S4, GPSZRA284S5, GPSZRA271S5, GPSZRA272S3, GPSZRA284S2, GPSZRA267S2, The sense and antisense strand sequences of any duplex of GPSZRA222S1, GPSZRA318S4, GPSZRA292S1, GPSZRA287S1, GPSZRA410S3, GPSZRA281S2, GPSZRA275S1, GPSZRA227S5, GPSZRA407S1, GPSZRA227S4, GPSZRA281S1, GPSZRA227S3, GPSZRA381S2 or GPSZRA410S1.

[0081] In some embodiments, the antisense strand comprises SEQ ID NOs: 846, 960, 1017, 847, 904, 961, 1018, 1075, 1076, 850, 907, 964, 1021, 1078, 852, 909, 966, 1023, 1080, 913, 970, 1084, 857, 914, 971, 1028, 1085, 1035, 923, 980, 103 7, 1094, 1040, 1097, 930, 878, 935, 992, 1049, 1106, 939, 996, 1053, 1110, 889, 946, 1003, 890, 947, 1004, 1061, 1118, 891, 948, 1062, 894, 951, 1008, 1065. In some embodiments, the sense strand comprises the nucleotide sequence of SEQ ID NOs: 1131, 1245, 1302, 1132, 1189, 1246, 1303, 1360, 1361, 1135, 1192, 1249, 1306, 1363, 113 7. 1194, 1251, 1308, 1365, 1198, 1255, 1369, 1142, 1199, 1256, 1313, 1370, 1320, 1208, 1265, 1 The nucleotide sequence shown in any one of 1272, 1279, 1325, 1382, 1215, 1163, 1220, 1277, 1334, 1391, 1224, 1281, 1338, 1395, 1174, 1231, 1288, 1175, 1232, 1289, 1346, 1403, 1176, 1233, 1347, 1179, 1236, 1293, and 1350.In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA227S2, GPSZRA227S3, GPSZRA227S4, GPSZRA227S5, GPSZRA228S5, GPSZRA231S1, GPSZRA231S2, GPSZRA231S3, GPSZRA231S4, GPSZRA227S5, GPSZRA228S5, GPSZRA231S1, GPSZRA231S2, GPSZRA231S3, GPSZRA231S4, GPSZRA231S5 ... 4. GPSZRA231S5, GPSZRA233S1, GPSZRA233S2, GPSZRA233S3, GPSZRA233S4, GPSZRA233S5, GPSZRA267S2, GPSZRA267 S3, GPSZRA267S5, GPSZRA271S1, GPSZRA271S2, GPSZRA271S3, GPSZRA271S4, GPSZRA271S5, GPSZRA282S4, GPSZRA28 4S2, GPSZRA284S3, GPSZRA284S4, GPSZRA284S5, GPSZRA287S4, GPSZRA287S5, GPSZRA301S2, GPSZRA314S1, GPSZRA3 14S2, GPSZRA314S3, GPSZRA314S4, GPSZRA314S5, GPSZRA318S2, GPSZRA318S3, GPSZRA318S4, GPSZRA318S5, GPSZRA The sense and antisense strand sequences of any duplex of GPSZRA407S1, GPSZRA407S2, GPSZRA407S4, GPSZRA410S1, GPSZRA410S2, GPSZRA410S3 or GPSZRA410S4.

[0082] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs:846, 960, 1017, 847, 1018, 1075, 1023, 913, 980, 1040, 878, 935, 992, 1049, 1106, 939, 996, 1053, 946, 1003, 890, 947, 1061, 1118, 948, 1062, 894, 951, and 1065. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1131, 1245, 1302, 1132, 1303, 1360, 1308, 1198, 1265, 1325, 1163, 1220, 1277, 1334, 1391, 1224, 1281, 1338, 1231, 1288, 1175, 1232, 1346, 1403, 1233, 1347, 1179, 1236, and 1350. In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA227S4, GPSZRA227S5, GPSZRA233S4, GPSZRA267S2, GPSZRA284S3, GPSZRA287S4, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S4, provided in Table 4. The sense and antisense strand sequences of any duplex of GPSZRA4S4, GPSZRA314S5, GPSZRA318S2, GPSZRA318S3, GPSZRA318S4, GPSZRA381S2, GPSZRA381S3, GPSZRA402S1, GPSZRA402S2, GPSZRA402S4, GPSZRA402S5, GPSZRA407S2, GPSZRA407S4, GPSZRA410S1, GPSZRA410S2 or GPSZRA410S4.

[0083] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 846, 960, 1017, 847, 913, 980, 878, 935, 992, 1106, 939, 1061, and 1118. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1131, 1245, 1302, 1132, 1198, 1265, 1163, 1220, 1277, 1391, 1224, 1346, and 1403. In some embodiments, the sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any double-stranded complex of GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA267S2, GPSZRA284S3, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S5, GPSZRA318S2, GPSZRA402S4 or GPSZRA402S5 provided in Table 4.

[0084] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1426-1438. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1131, 1245, 1302, 1132, 1198, 1265, 1163, 1220, 1277, 1391, 1224, 1346, 1403. In some embodiments, the sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any double-stranded complex of GPSZRA222S1-VP, GPSZRA222S3-VP, GPSZRA222S4-VP, GPSZRA227S1-VP, GPSZRA267S2-VP, GPSZRA284S3-VP, GPSZRA314S1-VP, GPSZRA314S2-VP, GPSZRA314S3-VP, GPSZRA314S5-VP, GPSZRA318S2-VP, GPSZRA402S4-VP, and GPSZRA402S5-VP provided in Table 4.

[0085] deliver

[0086] The siRNA of the present invention can be delivered or introduced by any means known in the art (e.g., delivered in vitro or introduced into cells, or delivered in vivo or introduced into patients). For example, for in vivo delivery, the siRNA can be injected into a tissue site, or systemically administered. In vivo delivery can also be carried out by a beta-glucan delivery system. In vitro introduction into cells includes methods known in the art, such as electroporation and lipofection.

[0087] In some embodiments, the delivery method includes, but is not limited to, viral delivery (retrovirus, adenovirus, lentivirus, baculovirus, AAV); liposomes (Lipofectamine, cationic DOTAP, neutral DOPC); nanoparticles (cationic polymers, PEI); bacterial delivery (tkRNAi); chemical modification of siRNA (LNA) to increase stability; lipid nanoparticles (LNP); neutral liposomes (NL); polymer nanoparticles (low molecular weight polymers or high molecular weight polymers); double-stranded RNA binding motifs (dsRBMs); and other delivery systems known in the art to be suitable for nucleic acid or oligonucleotide delivery.

[0088] Conjugate

[0089] In one aspect, the invention provides a conjugate comprising at least one siRNA of the invention and a pharmaceutically acceptable targeting molecule. The conjugate of the invention is obtained by coupling the siRNA of the invention with a pharmaceutically acceptable targeting molecule, and the conjugate comprises a pharmaceutically acceptable targeting molecule and an optional linker. The siRNA can be non-covalently coupled to the targeting molecule, or covalently coupled to the targeting molecule.

[0090] The pharmaceutically acceptable targeting molecule can be a targeting molecule conventionally used in the field of siRNA administration, which typically enhances the pharmacokinetic or biodistribution properties of the siRNA connected thereto, and improves the cell-specific (or organ-specific) distribution and cell-specific (or organ-specific) uptake of the siRNA. Representative targeting molecules include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies or antibody fragments, antibody mimetics, etc. In some embodiments, the targeting molecules include but are not limited to one or more of the following targeting molecules or their derivatives: integrin family; lipophilic molecules, such as cholesterol, bile acid, vitamins (such as vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as membrane-permeable peptides; aptamers; antibodies; quantum dots; carbohydrates, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid (folate); or receptor ligands expressed by hepatic parenchymal cells, such as asialoglycoproteins, asialosugar residues, lipoproteins (such as high-density lipoproteins, low-density lipoproteins, etc.), glucagon, neurotransmitters (such as adrenaline), growth factors, transferrin, etc.

[0091] The linker can be a linker conventionally used in the field of siRNA administration, including but not limited to one or more of the following linkers or their derivatives: amide linker portion, amino linker portion, carbonyl linker portion, carbamate linker portion, urea linker portion, ether linker portion, disulfide linker portion, succinylamino linker portion, etc.

[0092] In some embodiments, the targeting molecule can be directly or indirectly connected to the siRNA of the present invention via a joint / connecting group. In some embodiments, the targeting molecule is connected to the siRNA via an unstable, cleavable or reversible bond or joint. In some embodiments, the targeting molecule is connected to at least one end of the sense strand and / or antisense strand of the siRNA. In some embodiments, the targeting molecule is connected to the 5' end and / or 3' end of the sense strand. In some embodiments, the targeting molecule is connected to the 5' end and / or 3' end of the antisense strand.

[0093] Pharmaceutical composition

[0094] In one aspect, the invention provides a pharmaceutical composition comprising at least one siRNA of the invention.

[0095] In some embodiments, the pharmaceutical composition contains 1 siRNA as described above.

[0096] In other embodiments, the pharmaceutical composition contains at least two siRNAs described above (for example, but not limited to 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) as active ingredients. Preferably, the at least two siRNAs each target different target sequences in the RAGE gene, so that it is expected that they will act simultaneously on different target sequences to bring about a synergistic effect. Here, the so-called "different target sequences" means that there is no overlap between the target sequences, or the number of overlapping continuous nucleotides between the target sequences is less than 5 (for example, the number of overlapping continuous nucleotides is 4, 3, 2, 1, 0). In this case, the at least two siRNAs described above may be present in any different ratios. Preferably, the at least two siRNAs described above may be present in a molar ratio of 1:100 to 100:1; more preferably, the at least two siRNAs described above may be present in a molar ratio of 1:10 to 10:1, 1:5 to 5:1 or 1:2 to 2:1. In some embodiments, the at least two aforementioned siRNAs are present in the same molar ratio.

[0097] In other embodiments, the pharmaceutical composition contains at least one siRNA of the present invention and also contains at least one siRNA targeting other targets (e.g., other genes other than RAGE). In this case, the siRNA of the present invention and the siRNA targeting other targets can be present in any different ratios, such as in a molar ratio of 1:100 to 100:1, such as in a molar ratio of 1:10 to 10:1, 1:5 to 5:1 or 1:2 to 2:1, such as in the same molar ratio.

[0098] In some embodiments, the pharmaceutical composition comprises an effective amount of siRNA. An "effective amount" means the amount of siRNA that is effective to produce the desired pharmacological, therapeutic or preventive result. For example, if a given clinical treatment is considered effective when there is at least a 10% reduction in a measurable parameter associated with a disease or condition, the therapeutically effective amount of a drug for treating the disease or condition is the amount required to achieve at least a 10% reduction in the parameter. For example, a therapeutically effective amount of siRNA targeting RAGE can reduce RAGE mRNA levels by at least 10%.

[0099] In some embodiments, in the pharmaceutical composition described in any of the above embodiments, the siRNA can be linked to a targeting molecule to form a conjugate. Therefore, in some embodiments, the pharmaceutical composition comprises a conjugate of the present invention.

[0100] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0101] In some embodiments, the pharmaceutically acceptable carrier and / or excipient is a delivery vector. A delivery vector is a substance that improves the delivery of nucleic acids or oligonucleotides to cells or tissues. Such substances can be any delivery vector known in the art that is suitable for nucleic acid or oligonucleotide delivery, including but not limited to: viruses (retroviruses, adenoviruses, lentiviruses, baculoviruses, AAV); liposomes (Lipofectamine, cationic DOTAP, neutral DOPC); nanoparticles (cationic polymers, PEI); bacteria (tkRNAi); lipid nanoparticles (LNP); neutral liposomes (NL); polymer nanoparticles (low molecular weight polymers or high molecular weight polymers); double-stranded RNA binding motifs (dsRBMs), etc.

[0102] In some embodiments, the siRNA may be packaged by the delivery vehicle.

[0103] In some embodiments, the siRNA can be directly or indirectly connected to the delivery vector via a joint / connecting group. In some embodiments, the delivery vector is connected to the siRNA via an unstable, cleavable or reversible bond or joint. In some embodiments, the delivery vector is connected to at least one end of the sense strand and / or antisense strand of the siRNA. In some embodiments, the delivery vector is connected to the 5' end and / or 3' end of the sense strand. In some embodiments, the delivery vector is connected to the 5' end and / or 3' end of the antisense strand.

[0104] In some embodiments, the pharmaceutical composition comprises one siRNA provided by the present invention, and the siRNA is encapsulated by the delivery vector. The one siRNA can be encapsulated in the same delivery vector or in different delivery vectors.

[0105] In other embodiments, the pharmaceutical composition comprises at least two siRNAs provided by the present invention (for example, but not limited to, two, three, four, five, six, seven, eight, nine, ten or more), wherein the siRNAs are packaged by the delivery vector. The at least two siRNAs can be packaged in the same delivery vector or in different delivery vectors. Preferably, the at least two siRNAs each target a different target sequence in the RAGE gene.

[0106] In other embodiments, the pharmaceutical composition comprises at least one siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE), wherein the siRNA is packaged by the delivery vector. The siRNA provided by the present invention and the siRNA targeting other targets (e.g., other genes other than RAGE) can be packaged in the same delivery vector or in different delivery vectors.

[0107] In some embodiments, the pharmaceutical composition of the present invention is formulated into a dosage form compatible with its intended route of administration, for example, it can be administered locally (such as direct injection or implantation), systemically, or subcutaneously, intravenously, intraperitoneally, or parenterally, including intracranial (such as intraventricular, intrameningeal, or intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration.

[0108] In some embodiments, the pharmaceutical composition is administered by suction, intranasal administration, intratracheal administration or oropharyngeal inhalation. The preparation suitable for inhalation administration can be prepared by mixing the required amount of active ingredient in a suitable solvent and then aseptically filtering. Generally, the preparation for inhalation administration is a sterile solution at physiological pH and has low viscosity. Salt can be added to the preparation to balance tension. In some cases, a surfactant or cosolvent can be added to increase the solubility of the active ingredient and improve aerosol properties. In some cases, an excipient can be added to control viscosity to ensure the size and distribution of the atomized droplets.

[0109] In other embodiments, the pharmaceutical composition can be administered by injection, such as intravenous, intramuscular, subcutaneous, intradermal, intraarticular, intraocular, intraperitoneal or topical administration. Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the temporary preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, antibacterial water, or phosphate buffered saline (PBS) and the like. The pharmaceutical composition should remain stable under production and storage conditions, and should prevent the contamination of microorganisms such as bacteria and fungi. For example, sterile injection solutions can be prepared by the following method: the active ingredient of the required dose is mixed in an appropriate solvent, and optionally, other desired ingredients (including but not limited to, pH regulators, surfactants, adjuvants, ionic strength enhancers, diluents, agents for maintaining osmotic pressure, agents for delayed absorption, preservatives, or any combination thereof) are mixed at the same time, followed by filtration and sterilization. In addition, sterile injection solutions can be prepared as sterile lyophilized powders (e.g., by vacuum drying or freeze drying) for easy storage and use.

[0110] The siRNA of the present invention can be formulated in dosage unit form for ease of administration. Dosage unit form refers to physically discrete units suitable as unitary dosages for the subject to be treated; each unit contains a predetermined quantity of active ingredient calculated to produce the desired therapeutic effect in combination with the required pharmaceutical carrier.

[0111] In the present invention, the dosage regimen can be adjusted to obtain the best desired response (e.g., therapeutic or preventive response). For example, the dosage can be administered once, multiple times over a period of time, or the dosage can be reduced or increased in proportion to the urgency of the treatment situation.

[0112] application

[0113] Inhibition of RAGE expression

[0114] The siRNA of the present invention can be used to inhibit the expression of RAGE in vitro and / or in vivo. The RAGE mRNA refers to an mRNA having a sequence shown in, for example, Genbank: NM_001136.5.

[0115] In one aspect, the present invention provides a method for inhibiting RAGE expression in a cell, the method comprising: introducing into the cell an siRNA, a conjugate or a pharmaceutical composition of the present invention. In some embodiments, the method is implemented in vitro. The siRNA of the present invention can be introduced by any nucleic acid delivery method known in the art, such as electroporation or lipofection.

[0116] The term "inhibiting the expression of RAGE" means at least partial suppression of RAGE gene expression, which can be expressed as a decrease in the amount of detectable RAGE mRNA. For example, the degree of inhibition can be expressed as: (mRNA in control cells)-(mRNA in treated cells) / (mRNA in control cells)*100%. Alternatively, the degree of inhibition can be given as a decrease in a parameter functionally associated with RAGE gene expression, such as the amount of protein encoded by the RAGE gene. In principle, RAGE gene silencing can be measured in any cell expressing RAGE (constitutively or by genetic engineering) and by any suitable assay. Measurements can be performed at multiple time points, before, during and after the administration of siRNA, to determine the effect of siRNA. The level or expression of RAGE can be measured by evaluation of mRNA (e.g., by Northern blot or PCR) or protein (e.g., Western blot). For example, the effect of siRNA on RAGE expression can be determined by measuring the transcription rate of the RAGE gene (e.g., by RT-PCR). For example, the effect of siRNA on RAGE expression can be determined by measuring the expression level of a reporter gene (eg, luciferase) fused to the RAGE gene.

[0117] In some embodiments, by administering the siRNA of the present invention, the expression of the RAGE gene is suppressed by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or 50%. In some embodiments, by administering the siRNA of the present invention, the expression of the RAGE gene is suppressed by at least about 60%, 70% or 80%. In some embodiments, by administering the siRNA of the present invention, the expression of the RAGE gene is suppressed by at least about 85%. In some embodiments, by administering the siRNA of the present invention, the expression of the RAGE gene is suppressed by at least about 90%. In some embodiments, by administering the siRNA of the present invention, the expression of the RAGE gene is suppressed by at least about 95%. In some embodiments, by administering the siRNA of the present invention, the expression of the RAGE gene is suppressed by at least about 96%, 97%, 98%, 99% or 100%.

[0118] In some embodiments, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (eg, siRNA targeting a different target sequence in the RAGE gene or siRNA targeting other targets).

[0119] In some embodiments, one siRNA provided by the present invention is used. The siRNA is optionally packaged by a delivery vector. In some embodiments, the one siRNA is packaged in the same delivery vector. In other embodiments, the one siRNA is packaged in different delivery vectors.

[0120] In other embodiments, at least two siRNAs provided by the present invention (for example, but not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) are used, preferably each of the at least two siRNAs targets a different target sequence in the RAGE gene. The at least two siRNAs are optionally packaged by a delivery vector. In some embodiments, the at least two siRNAs are packaged in the same delivery vector. In other embodiments, the at least two siRNAs are packaged in different delivery vectors.

[0121] In other embodiments, at least one siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are used. The siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are optionally packaged by a delivery vector. In some embodiments, the siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are packaged in the same delivery vector. In other embodiments, the siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are respectively packaged in different delivery vectors.

[0122] Treatment of RAGE-related diseases

[0123] The siRNAs of the invention can be used to treat diseases or conditions that would benefit from reduced levels or inhibition of expression of RAGE.

[0124] In one aspect, the present invention provides a method for preventing and / or treating a disease associated with RAGE in a subject, the method comprising administering an effective amount of the siRNA, conjugate or pharmaceutical composition of the present invention to a subject in need thereof. The present invention also relates to the use of the siRNA or pharmaceutical composition of the present invention in the preparation of a medicament for treating and / or preventing a disease associated with RAGE.

[0125] In some embodiments, the RAGE-related disease involves RAGE overexpression. RAGE overexpression refers to RAGE levels (e.g., RAGE levels present in plasma or tissues of a subject, and preferably in damaged tissues) that are higher than normal RAGE levels (e.g., corresponding levels of healthy controls).

[0126] In some embodiments, the RAGE-associated disease would benefit from decreased levels or inhibition of RAGE expression.

[0127] In some embodiments, the RAGE-associated disease is a respiratory disease, such as cystic fibrosis, pneumonia, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infection, primary ciliary dyskinesia, or lung cancer cystic fibrosis.

[0128] In some embodiments, the respiratory disease is chronic obstructive pulmonary disease (COPD).

[0129] In some embodiments, the RAGE-associated disease is a neurological disease, such as Alzheimer's disease or stroke.

[0130] In some embodiments, the RAGE-related disease is a urological disease, such as diabetic nephropathy.

[0131] In some embodiments, if RAGE expression is elevated for a particular disease, treatment with the siRNA of the invention may reduce the level or expression of RAGE to a level that is within the normal range considered to be normal for individuals without such a disorder.

[0132] In some embodiments, the disease associated with RAGE involves inflammation, such as chronic inflammation. In some embodiments, the disease associated with RAGE is an inflammatory disease. In some embodiments, the disease associated with RAGE will benefit from the inhibition of inflammation. In some embodiments, the siRNA of the present invention inhibits or reduces the expression of RAGE and thus inhibits or reduces the signaling pathway mediated by RAGE, thereby reducing or inhibiting the inflammatory response.

[0133] In some embodiments, the disease associated with RAGE is an inflammatory respiratory disease. In some embodiments, the disease associated with RAGE is an inflammatory nervous system disease. In some embodiments, the disease associated with RAGE is an inflammatory urological disease. In some embodiments, the disease associated with RAGE is a diabetic complication, such as diabetic nephropathy, arteriosclerosis, and retinopathy.

[0134] In some embodiments, the subject is a mammal, such as a human.

[0135] In some embodiments, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (e.g., siRNA targeting a different target sequence in the RAGE gene or siRNA targeting other targets), for example, administered simultaneously or sequentially.

[0136] In some embodiments, one siRNA provided by the present invention is used. The siRNA is optionally packaged by a delivery vector. In some embodiments, the one siRNA is packaged in the same delivery vector. In other embodiments, the one siRNA is packaged in different delivery vectors.

[0137] In other embodiments, at least two siRNAs provided by the present invention (for example, but not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) are used, preferably each of the at least two siRNAs targets a different target sequence in the RAGE gene. The at least two siRNAs are optionally packaged by a delivery vector. In some embodiments, the at least two siRNAs are packaged in the same delivery vector. In other embodiments, the at least two siRNAs are packaged in different delivery vectors.

[0138] In other embodiments, at least one siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are used. The siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are optionally packaged by a delivery vector. In some embodiments, the siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are packaged in the same delivery vector. In other embodiments, the siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are respectively packaged in different delivery vectors.

[0139] Definition of terms

[0140] In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Meanwhile, in order to better understand the present invention, the definitions and explanations of the relevant terms are provided below.

[0141] Herein, the mRNA sequence of the receptor for advanced glycation end products (RAGE) is well known to those skilled in the art, for example, see the mRNA sequence shown in Genbank registration number NM_001136.5. Further, if not otherwise specified, the term "target gene" used herein refers to a gene that can transcribe the above RAGE mRNA, the term "target mRNA" refers to the above RAGE mRNA, and the term "inhibiting RAGE gene" refers to inhibiting the expression of RAGE.

[0142] In this article, capital letters C, G, U, A, and T represent the base composition of nucleotides, including modified or unmodified nucleotides; lowercase letter m indicates that the nucleotide adjacent to the left of the letter m is a methoxy-modified nucleotide; lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a fluorine-modified nucleotide; (LNA) indicates that the nucleotide adjacent to the left of the (LNA) is a locked nucleic acid-modified nucleotide; lowercase letter s indicates that the two nucleotides adjacent to the left and right of the letter s are connected by thiophosphate groups; capital letter VP indicates that the nucleotide adjacent to the right of the VP is a 5'-(E)-vinyl phosphate-modified nucleotide.

[0143] Herein, the term "modified nucleotide" refers to a nucleotide or nucleotide analog that independently has a modified ribose moiety, a modified internucleoside bond, or a modified base. Therefore, the term "modified nucleotide" encompasses substitution, addition, or removal (e.g., using a functional group or atom) of an internucleoside bond, a ribose moiety, or a base. "Nucleotide analog" refers to a group that can replace a nucleotide in a nucleic acid, but is structurally different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Such as isonucleotides, bridged nucleic acids (BNA for short) or acyclic nucleotides. Modifications suitable for use in the present invention include all types of modifications disclosed herein or known in the art. As an example, a modified nucleotide may include a nucleotide or nucleotide analog formed by replacing the hydroxyl group at the 2' position of the ribose moiety of the nucleotide with other groups, or a nucleotide whose base on the nucleotide is a modified base, or a nucleotide modified with a 5'-phosphate analog.

[0144] The structures of the following exemplary modified nucleotides are provided herein:

[0145] The structure of the fluorinated nucleotide is shown below:

[0146]

[0147] The structure of a methoxy-modified nucleotide is shown below:

[0148]

[0149] The nucleotide structure of the locked nucleic acid is as follows:

[0150]

[0151] The structure of a 5'-(E)-vinyl phosphate modified nucleotide is shown below:

[0152]

[0153] Herein, the term "siRNA" means an RNA molecule that can induce RNAi phenomenon with sequence specificity, is composed of a sense strand and an antisense strand, and has a partially or completely complementary double-stranded structure. In the siRNA involved in the present invention, the length of the complementary double-stranded structure can be 14 to 30 base pairs, such as 14, 15, 16, 17, 18, 19, 20 or 21 base pairs, such as 14 to 19 base pairs. In some embodiments of the present invention, the siRNA may also contain modified nucleotides as needed, and the modified nucleotides will not cause the siRNA to significantly weaken or lose the function of inhibiting the expression of the RAGE gene. At present, there are many ways to modify siRNA in the art, including, for example, backbone modification (such as phosphate group modification), ribose group modification and base modification (Watts, JK, GF Deleavey, and MJ Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008. 13 (19-20): p. 842-55).

[0154] The term "antisense strand" includes a region that is substantially complementary to the target sequence. The term "sense strand" when used herein refers to a strand of a region that is substantially complementary to a region of the antisense strand. The term "complementarity region" refers to a region on the antisense strand that is substantially complementary to the RAGE mRNA or a region on the sense strand that is substantially complementary to the antisense strand. When the complementary region is not completely complementary to the target sequence, the mismatch may be in the interior or terminal regions of the molecule. Typically, the most tolerated mismatch is in the terminal region, for example, within 5, 4, 3, 2 or 1 nucleotides of the 5' and / or 3' ends.

[0155] In this article, unless otherwise specified, the term "complementary" refers to the ability of an oligonucleotide of a first sequence to hybridize with an oligonucleotide of a second sequence under certain conditions and form a double-stranded structure. "At least partially complementary" means that the two sequences can be completely complementary, or generally no more than 6, 5, 4, 3 or 2 or 1 mismatched base pairings, while retaining the ability to hybridize under relevant conditions. In addition, in the case where two oligonucleotides are designed to form one or more single-stranded overhangs during hybridization, such overhangs should not be regarded as mismatches in terms of determining complementarity. In this article, when the above hybridization ability requirements are met, the "complementary" sequence can also include or be completely formed from non-Watson (Watson) -Crick (Crick) base pairs and / or base pairs formed from non-natural and modified nucleotides. Such non-Watson (Watson) -Crick (Crick) base pairs include but are not limited to G: U wobble base pairing or Hoogstein (Hu Gesten) base pairing. Correspondingly, in this article, unless otherwise specified, "mismatch" means that in the siRNA duplex molecule, the bases at corresponding positions are not paired in a complementary form.

[0156] Those skilled in the art will be able to determine the conditions most suitable for testing the complementarity of two sequences based on the ultimate application of the hybridized nucleotides. Such conditions may, for example, be stringent conditions, such as 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. for 12-16 hours, followed by washing. Other conditions, such as physiologically relevant conditions that may be encountered in vivo, may also be applied.

[0157] In this article, unless otherwise specified, "nucleotide sequence difference" means that the base type of the nucleotide at the same or corresponding position has changed compared to the original nucleotide sequence. For example, when one nucleotide base in the original nucleotide sequence is A, when the nucleotide base at the same or corresponding position is changed to U, C, G or dT, dC, dG, etc., it is considered that there is a difference in the nucleotide sequence at this position. It should be noted here that, compared to the original nucleotide sequence, when the nucleotide at the same or corresponding position differs only in whether there is a modification or the type of modification, it is not considered that there is a difference in the nucleotide sequence at this position.

[0158] In this article, if not otherwise specified, the term "pharmaceutically acceptable carrier and / or excipient" refers to a carrier, a delivery vehicle, a diluent, an adjuvant and / or the salt / ester / hydrate formed thereof, etc., which is usually chemically or physically compatible with other ingredients (such as the siRNA of the present invention) constituting a certain pharmaceutical dosage form, and is physiologically compatible with the subject. "Pharmaceutically acceptable carrier and / or excipient" does not play or is not intended to play a therapeutic effect at the expected dose. Such ingredients can play the following roles: a) help the processing of the drug delivery system during manufacturing, b) protect, support or enhance the stability, bioavailability or patient acceptability of the active ingredient, c) assist product identification, and / or d) enhance the overall safety, effectiveness, delivery, etc. of the active ingredient during storage and use. For example, the siRNA of the present invention can be wrapped by a delivery vehicle. "Pharmaceutically acceptable carriers and / or excipients" include, but are not limited to: viruses, liposomes, nanoparticles, bacteria, lipid nanoparticles (LNP), neutral liposomes (NL), polymer nanoparticles, double-stranded RNA binding motifs (dsRBMs), pH regulators, surfactants, adjuvants, ionic strength enhancers, diluents, agents for maintaining osmotic pressure, agents for delaying absorption, preservatives. For example, viruses include, but are not limited to, retroviruses, adenoviruses, lentiviruses, baculoviruses, AAV. Liposomes include, but are not limited to, Lipofectamine, cationic DOTAP, neutral DOPC. Nanoparticles include, but are not limited to, cationic polymers, PEI. Bacteria include, but are not limited to, tkRNAi. Polymer nanoparticles include, but are not limited to, low molecular weight polymers or high molecular weight polymers. For example, pH regulators include, but are not limited to, phosphate buffers. Surfactants include, but are not limited to, cationic, anionic or non-ionic surfactants, such as Tween-80. Ionic strength enhancers include, but are not limited to, sodium chloride. Preservatives include, but are not limited to, various antibacterial agents and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and the like. Agents that maintain osmotic pressure include, but are not limited to, sugars, NaCl and the like. Agents that delay absorption include, but are not limited to, monostearate and gelatin. Diluents include, but are not limited to, water, aqueous buffers (such as buffered saline), alcohols and polyols (such as glycerol), and the like.

[0159] In this article, unless otherwise specified, the term "inhibition" refers to the situation where the expression of the target gene is down-regulated (down-regulation) due to the degradation of the mRNA of the target gene mediated by siRNA. The "down-regulation" refers to the situation where the expression level of the target gene decreases by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% or more or even 100% relative to the situation without siRNA treatment. Among them, a 100% decrease in the expression level of the target gene refers to the expression of the target gene at no detectable level.

[0160] In this article, the term "overhang" or "nucleotide overhang" refers to at least one unpaired nucleotide protruding from the siRNA duplex structure. For example, when the 3' end of one strand of the siRNA extends beyond the 5' end of the other strand (or vice versa), there is an overhang. The siRNA may include an overhang of at least one nucleotide, or the overhang may include at least 2nt, at least 3nt, at least 4nt, at least 5nt or more. The overhang may include nucleotide / nucleoside analogs, or be composed of nucleotide / nucleoside analogs, and the nucleotide / nucleoside analogs include deoxyribonucleotides / nucleosides. The overhang may be on the sense strand, the antisense strand, or any combination thereof. The nucleotides of the overhang may be present on the 5' end, 3' end, or both ends of the antisense strand or the sense strand of the siRNA. Accordingly, the term "flat end" refers to the absence of nucleotide overhangs.

[0161] As used herein, the term "prevention" refers to a method implemented to prevent or delay the occurrence of a disease or disorder or symptom in a subject; the term "treatment" refers to a method implemented to obtain a beneficial or desired clinical result. For the purposes of the present invention, beneficial or desired clinical results include, but are not limited to, alleviating symptoms, reducing the scope of the disease, stabilizing (i.e., no longer worsening) the state of the disease, delaying or slowing the development of the disease, improving or alleviating the state of the disease, and alleviating symptoms (whether partial or complete), whether detectable or undetectable. In addition, "treatment" can also refer to prolonging survival compared to the expected survival if not receiving treatment.

[0162] As used herein, the term "effective amount" refers to an amount sufficient to obtain or at least partially obtain the desired effect. For example, a disease prevention effective amount refers to an amount sufficient to prevent, prevent, or delay the occurrence of a disease; a disease treatment effective amount refers to an amount sufficient to cure or at least partially prevent the disease and its complications in a patient who already has the disease. Determining such an effective amount is well within the capabilities of those skilled in the art. For example, an effective amount for therapeutic use will depend on the severity of the disease to be treated, the overall state of the patient's own immune system, the patient's general condition such as age, weight and sex, the mode of administration of the drug, and other treatments administered simultaneously, etc.

[0163] Advantageous Effects of the Invention

[0164] The siRNA of the present invention can effectively inhibit RAGE gene expression in vitro and / or in vivo, inhibit or reduce RAGE-mediated signaling pathways, and has good stability. Therefore, the siRNA of the present invention can be used to inhibit inflammatory responses, treat diseases or conditions that benefit from reduced RAGE levels or suppressed expression, and has important clinical value for the treatment of RAGE-related diseases, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0165] Figure 1A-1G :Gel running results of modified siRNA RNase stability.

[0166] Figure 2A-2F : Gel running results of modified siRNA serum stability.

[0167] Figure 3A-3G : Gel running results of modified siRNA human lung S9 stability.

[0168] Figure 4A-4C :Gel running results of VP-modified siRNA RNase stability.

[0169] Figure 5A-Figure 5C :Gel running results of serum stability of VP-modified siRNA.

[0170] Figure 6A-6C :Gel running results of VP-modified siRNA human lung S9 stability.

[0171] Figure 7A-Figure 7I : Cytotoxicity of VP-modified siRNA against A549 RAGE LV.

[0172] Figure 8A-8I : Cytotoxicity of VP-modified siRNA against BEAS-2B RAGE LV.

[0173] Figure 9A-9K: The results of VP-modified siRNA stimulating human PBMC to secrete cytokines (TNF-α, IFN-α, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12P70, IL-17, IFN-γ).

[0174] Embodiments of the present invention will be described in detail below in conjunction with examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention, rather than to limit the scope of the present invention. According to the following detailed description of preferred embodiments, various objects and advantages of the present invention will become implementable for those skilled in the art. DETAILED DESCRIPTION

[0175] The invention is now described in the following non-limiting examples.

[0176] Those skilled in the art will appreciate that the embodiments describe the present invention by way of example and are not intended to limit the scope of protection claimed in the present application. The experimental methods in the embodiments are conventional methods unless otherwise specified. If specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially.

[0177] It is known to those skilled in the art that the siRNA of the present invention can be obtained by conventional siRNA preparation methods in the art (e.g., solid phase synthesis and liquid phase synthesis), wherein both solid phase synthesis and liquid phase synthesis have commercial customization services. It is also clear to those skilled in the art that modified nucleotide groups can be introduced into the siRNA of the present invention by using nucleotide monomers with corresponding modifications. Methods for preparing nucleotide monomers with corresponding modifications are well known to those skilled in the art, and commercial monomers are also available on the market.

[0178] Preparation Example 1: Unmodified siRNA Synthesis

[0179] This preparation example provides a siRNA for inhibiting the expression of RAGE. The nucleotide sequence of the siRNA is designed based on the target mRNA, as shown in Table 1.

[0180] Table 1: siRNA sequences

[0181]

[0182]

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191] Preparation Example 2: Synthesis of modified siRNA

[0192] This preparation example provides a modified siRNA for inhibiting RAGE expression. The modification pattern of the siRNA is shown in Table 2, the overall modification mode combination of the siRNA is shown in Table 3, and the modified siRNA sequence is shown in Table 4.

[0193] Modification instructions:

[0194] In Tables 2-4, Nm is a methoxy-modified nucleotide, Nf is a fluorinated-modified nucleotide, N(LNA) is a locked nucleic acid-modified nucleotide, VP indicates that the adjacent nucleotide on the right is a 5'-(E)-vinyl phosphate-modified nucleotide, and s is a thiophosphate-linked nucleotide. In Table 3, the sequence name suffixes S1, S2, S3, S4, S5, S1-VP, S2-VP, S3-VP, S4-VP, and S5-VP respectively represent different modification methods, and the different modification methods are described as follows:

[0195] S1 represents the positive strand modification pattern SEQ ID NO: 1412 + the antisense strand modification pattern SEQ ID NO: 1409. The positive strand includes the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by thiophosphate groups, the nucleotides at positions 1, 2, 4, 6, 10, 12, 14, 16, and 18 are methoxy-modified nucleotides, and the nucleotides at positions 3, 5, 7, 8, 9, 11, 13, 15, 17, and 19 are fluorinated modified nucleotides; the antisense strand includes the following chemical modifications: Modification: From the 5' end to the 3' end, the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 4, 6, 8, 10, 14, 16, and 18 are fluorine-modified nucleotides.

[0196] S2 represents the sense strand modification pattern SEQ ID NO: 1413 + antisense strand modification pattern SEQ ID NO: 1410. The sense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 18 and 19 are linked by thiophosphate groups, the nucleotides at positions 1, 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides, and the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated modified nucleotides; the antisense strand includes the following chemical modifications: Modification: From the 5' end to the 3' end, the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 8, 14, and 16 are fluorine-modified nucleotides.

[0197] S3 represents the sense strand modification pattern SEQ ID NO: 1414 + antisense strand modification pattern SEQ ID NO: 1411. The sense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 18 and 19 are linked by thiophosphate groups, the nucleotides at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are methoxy-modified nucleotides, and the nucleotides at positions 7, 8, and 9 are fluorinated-modified nucleotides; the antisense strand includes the following chemical modifications: Modification: From the 5' end to the 3' end, the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 14, and 16 are fluorine-modified nucleotides.

[0198] S4 represents the sense strand modification pattern SEQ ID NO: 1415 + antisense strand modification pattern SEQ ID NO: 1410. The sense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by thiophosphate groups, the nucleotide at position 1 is a locked nucleic acid modified nucleotide, the nucleotides at positions 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy modified nucleotides, and the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated modified nucleotides; the antisense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and at positions 18 and 19 are linked by thiophosphate groups, the nucleotides at positions 1 and 2 are methoxy modified nucleotides, and the nucleotides at positions 1 and 2 are fluorinated modified nucleotides; The chain includes the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 8, 14, and 16 are fluorine-modified nucleotides.

[0199] S5 indicates that the positive strand modification pattern is SEQ ID NO: 1416 + the antisense strand modification pattern is SEQ ID NO: 1410. The positive strand includes the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by thiophosphate groups, the nucleotides at positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides, and the nucleotides at positions 5, 7, 8, 9, and 15 are fluorinated modified nucleotides; the antisense strand includes the following chemical modifications: Modification: From the 5' end to the 3' end, the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 8, 14, and 16 are fluorine-modified nucleotides.

[0200] S1-VP represents the positive strand modification pattern SEQ ID NO: 1412 + the antisense strand modification pattern SEQ ID NO: 1423. The positive strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 18 and 19 are linked by thiophosphate groups, the nucleotides at positions 1, 2, 4, 6, 10, 12, 14, 16, and 18 are methoxy-modified nucleotides, and the nucleotides at positions 3, 5, 7, 8, 9, 11, 13, 15, 17, and 19 are fluorinated modified nucleotides; the antisense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and at positions 18 and 19 are linked by thiophosphate groups, the nucleotides at positions 1, 2, 4, 6, 10, 12, 14, 16, and 18 are methoxy-modified nucleotides, and the nucleotides at positions 3, 5, 7, 8, 9, 11, 13, 15, 17, and 19 are fluorinated modified nucleotides; The nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, 20, and 21 are methoxy-modified nucleotides, the nucleotides at positions 2, 4, 6, 8, 10, 14, 16, and 18 are fluorine-modified nucleotides, and the nucleotide at position 1 also includes a 5'-(E)-vinyl phosphate modification.

[0201] S2-VP represents the sense strand modification pattern SEQ ID NO: 1413 + antisense strand modification pattern SEQ ID NO: 1424. The sense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 18 and 19 are linked by thiophosphate groups, the nucleotides at positions 1, 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides, and the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated modified nucleotides; the antisense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and at positions 18 and 19 are linked by thiophosphate groups, the nucleotides at positions 1, 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides, and the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated modified nucleotides; The nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, the nucleotides at positions 2, 6, 8, 14, and 16 are fluorine-modified nucleotides, and the nucleotide at position 1 also includes a 5'-(E)-vinyl phosphate modification.

[0202] S3-VP represents the positive strand modification pattern SEQ ID NO: 1414 + the antisense strand modification pattern SEQ ID NO: 1425. The positive strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 18 and 19 are linked by thiophosphate groups, the nucleotides at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are methoxy-modified nucleotides, and the nucleotides at positions 7, 8, and 9 are fluorinated modified nucleotides; the antisense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 18 and 19 are linked by thiophosphate groups, the nucleotides at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are methoxy-modified nucleotides, and the nucleotides at positions 7, 8, and 9 are fluorinated modified nucleotides; The nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, the nucleotides at positions 2, 6, 14, and 16 are fluorine-modified nucleotides, and the nucleotide at position 1 also includes a 5'-(E)-vinyl phosphate modification.

[0203] S4-VP represents the sense strand modification pattern SEQ ID NO: 1415 + the antisense strand modification pattern SEQ ID NO: 1424. The sense strand includes the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by thiophosphate groups, the nucleotide at position 1 is a locked nucleic acid modified nucleotide, the nucleotides at positions 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy modified nucleotides, and the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated modified nucleotides; the antisense strand includes the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and at positions 18 and 19 are linked by thiophosphate groups, the nucleotide at position 1 is a locked nucleic acid modified nucleotide, the nucleotides at positions 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy modified nucleotides, and the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated modified nucleotides; In the direction from the 'end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, the nucleotides at positions 2, 6, 8, 14, and 16 are fluorinated-modified nucleotides, and the nucleotide at position 1 also includes a 5'-(E)-vinyl phosphate modification.

[0204] S5-VP indicates that the modification pattern of the sense strand is SEQ ID NO: 1416 + the modification pattern of the antisense strand is SEQ ID NO: 1424. The sense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 18 and 19 are linked by thiophosphate groups, the nucleotides at positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides, and the nucleotides at positions 5, 7, 8, 9, and 15 are fluorinated modified nucleotides; the antisense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and at positions 18 and 19 are linked by thiophosphate groups, the nucleotides at positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides, and the nucleotides at positions 5, 7, 8, 9, and 15 are fluorinated modified nucleotides; The nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, the nucleotides at positions 2, 6, 8, 14, and 16 are fluorine-modified nucleotides, and the nucleotide at position 1 also includes a 5'-(E)-vinyl phosphate modification.

[0205] Table 2: Modification patterns of siRNA

[0206]

[0207] Table 3: Modification patterns of siRNA - overall

[0208]

[0209]

[0210] Table 4: Modified siRNA sequences

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219] The following examples relate to the detection of siRNA biological activity. The experimental methods in the examples are conventional methods unless otherwise specified. If the specific conditions are not specified in the examples, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be obtained commercially. The experimental cells involved in the following examples are 293T, which were purchased from the cell bank of the Chinese Academy of Sciences.

[0220] Example 1: On-target activity detection of unmodified siRNA for inhibition of RAGE

[0221] This example provides an on-target activity detection experiment of unmodified siRNA for inhibiting RAGE. A plasmid vector is constructed using a psiCHECK2 vector for detection. The psiCHECK2 vector is a plasmid vector that can monitor changes in the expression of a target gene fused with a reporter gene. The vector uses Renilla luciferase as the main reporter gene. The target fragment is cloned into a multiple cloning site downstream of the translation termination codon of Renilla luciferase. The RNAi process against the target gene initiated by the synthetic siRNA leads to the shearing and subsequent degradation of the fusion mRNA. By detecting changes in the activity of Renilla luciferase, it can be determined whether the siRNA has a targeting relationship with the target gene fragment. The experimental process is as follows:

[0222] (1) Construction of detection plasmid RAGE-psiCHECK2

[0223] Using psiCHECK TM -2(Promega TM ) Plasmid construction detection plasmid, the detection plasmid contains the following insertion sequence, the insertion sequence is derived from the mRNA sequence shown in Genbank registration number NM_001136.5, a single copy of the insertion sequence is cloned into psiCHECK TM -2 plasmid Xho I / Not I site, to obtain the detection plasmids GPRAGE-1-psiCHECK2, GPRAGE-2-psiCHECK2, GPRAGE-3-psiCHECK2 and GPRAGE-4-psiCHECK2;

[0224] The inserted sequence of GPRAGE-1-psiCHECK2 is RAGE mRNA1: 5’-agacagagccaggaccctggaaggaagcaggatggctgccggaacagcagttggagcctgggtgctggtcctcagtctgtggggggcagtagtaggtgctcaaaacatcacagcccggattggcgagccactggtgctgaagtgtaagggggcccccaagaaaccaccccagcggctggaatggaaactgaacacaggccggacagaagcttggaaggtcctgtctccccagggaggaggcccctgggacagtgtggctcgtgtccttcccaacggctccctcttccttccggctgtcgggatccaggatgaggggattttccggtgccaggcaatgaacaggaatggaaaggagaccaagtccaactaccgagtccgtgtctaccagattcctgggaag-3’(SEQ ID NO:1417);

[0225] The inserted sequence of GPRAGE-2-psiCHECK2 is RAGE mRNA2: 5’-aggagaccaagtccaactaccgagtccgtgtctaccagattcctgggaagccagaaattgtagattctgcctctgaactcacggctggtgttcccaataaggtggggacatgtgtgtcagagggaagctaccctgcagggactcttagctggcacttggatgggaagcccctggtgcctaatgagaagggagtatctgtgaaggaacagaccaggagacaccctgagacagggctcttcacactgcagtcggagctaatggtgaccccagcccggggaggagatccccgtcccaccttctcctgtagcttcagcccaggccttccccgacaccgggccttgcgcacagcccccatccagccccgtgtctgggagcctgtgcctctggaggaggtccaatt-3’(SEQ ID NO:1418);

[0226] The inserted sequence of GPRAGE-3-psiCHECK2 is the RAGE mRNA3: 5’-cccatccagccccgtgtctgggagcctgtgcctctggaggaggtccaattggtggtggagccagaaggtggagcagtagctcctggtggaaccgtaaccctgacctgtgaagtccctgcccagccctctcctcaaatccactggatgaaggatggtgtgcccttgccccttccccccagccctgtgctgatcctccctgagatagggcctcaggaccagggaacctacagctgtgtggccacccattccagccacgggccccaggaaagccgtgctgtcagcatcagcatcatcgaaccaggcgaggaggggccaactgcaggctctgtgggaggatcagggctgggaactctagccctggccctggggatcctgggaggcctggggacagccgccctgc-3’ (SEQ ID NO:1419);

[0227] The inserted sequence of GPRAGE-4-psiCHECK2 is the RAGE mRNA4: 5’-aggctctgtgggaggatcagggctgggaactctagccctggccctggggatcctgggaggcctggggacagccgccctgctcattggggtcatcttgtggcaaaggcggcaacgccgaggagaggagaggaaggccccagaaaaccaggaggaagaggaggagcgtgcagaactgaatcagtcggaggaacctgaggcaggcgagagtagtactggagggccttgaggggcccacagacagatcccatccatcagctcccttttctttttcccttgaactgttctggcctcagaccaactctctcctgtataatctctctcctgtataaccccaccttgccaagctttcttctacaaccagagccccccacaatgatgattaaacacctgacacatcttg-3’ (SEQ ID NO:1420);

[0228] The above-mentioned synthesized siRNA sequences were grouped and tested, see Table 5. Among them, GPSZRA001-GPSZRA118 used the detection plasmid GPSZRA-1-psiCHECK2, GPSZRA090-GPSZRA251 used the detection plasmid GPSZRA-2-psiCHECK2, GPSZRA250-GPSZRA358 used the detection plasmid GPSZRA-3-psiCHECK2, and GPSZRA359-GPSZRA419 used the detection plasmid GPSZRA-4-psiCHECK2.

[0229] Table 5: siRNA grouping experiment

[0230] serial number siRNA Name Corresponding carrier Corresponding negative reference 1 GPSZRA001-GPSZRA118 GPSZRA-1-psiCHECK2 NC1 2 GPSZRA090-GPSZRA251 GPSZRA-2-psiCHECK2 NC1 3 GPSZRA250-GPSZRA358 GPSZRA-3-psiCHECK2 NC1 4 GPSZRA359-GPSZRA419 GPSZRA-4-psiCHECK2 NC1

[0231] (2) Cell culture and transfection

[0232] In a 96-well plate, 12.5 μl of Opti-MEM containing 20 ng GPSZRA-1-psiCHECK2 detection plasmid (using the corresponding detection plasmid according to siRNA) and 32.5 μl of Opti-MEM plus 0.3 μl Lipofectamine 2000 (purchased from Invitrogen, catalog number 11668-019) were added to each well of 5 μl siRNA and incubated at room temperature for 15 minutes. Then, 50 μl of DMEM complete medium containing 1×104 293T cells (purchased from TransgenBiotech, catalog number FI101-01) was added to each well of the above mixture and cultured at 37°C for 24 hours for subsequent dual luciferase detection experiments. The experimental concentration was carried out at a final siRNA concentration of 1 nM.

[0233] (3) Dual luciferase assay

[0234] The 5× lysate in the dual luciferase assay kit (purchased from Promega, catalog number E2940) was diluted with water to 1× lysate. The cells obtained by culturing in step 2 were discarded, and each well was diluted and washed twice with PBS buffer (purchased from Hyclone, catalog number SH30256.01), and 50 μL / well of 1× lysate was added to each cell plate, and lysed at room temperature for 20 minutes to obtain a lysed cell plate; 30 μL / well of lysate was drawn from the lysed cell plate and added to an opaque 96-well detection plate, and the dual luciferase assay kit was taken, and two substrates were prepared according to the instructions, and the two substrates were added to new 96-well plates, and 30 μL / well of substrate 1 and substrate 2 were added, respectively, and each time the substrate was added, the multifunctional microplate reader was used for detection, and the numerical results of firefly luciferase and Renilla luciferase were obtained, respectively.

[0235] Renilla luciferase was detected using an ELISA instrument. The luminescence ratio of each well of the ELISA plate was calculated as Renilla / Firefly. The luminescence ratio of each test group or control group was the average of the luminescence ratios of three culture wells. The luminescence ratio of each test group was normalized based on the luminescence ratio of the control group to obtain the ratio R of luminescence ratio (test) / luminescence ratio (control), which represents the expression level of the Renilla reporter gene, i.e., the relative residual activity. The inhibition rate of siRNA is (1-R)×100%.

[0236] The on-target activity results are shown in Table 6 below, which show that these duplexes have inhibitory activity on RAGE expression.

[0237] Table 6: On-target activity detection of unmodified siRNA

[0238]

[0239]

[0240]

[0241]

[0242]

[0243]

[0244] MOCK is a blank control group with only transfection reagent and plasmid added; NC1 is a negative control siRNA, and the sequence information is shown in Table 7 below:

[0245] Table 7: NC1 sequence

[0246]

[0247] Conclusion: The candidate naked sequences ranked high in psiCHECK single concentration effect, and the silencing efficiency of the sequences entering the next round of screening was greater than 75%, totaling 198 sequences.

[0248] Example 2: On-target activity detection of unmodified siRNA for inhibition of RAGE

[0249] The sequences with higher inhibition rates in Example 1 were tested for on-target activity under conditions where the final siRNA concentrations were 0.01 nM, 0.1 nM and 1 nM. The test method used was the same as that used in Example 1, except that the final siRNA concentrations were different. The test results are shown in Table 7 below, and the results show that these duplexes have good inhibitory activity on RAGE expression at different concentrations.

[0250] Table 8: On-target activity detection of unmodified siRNA at different concentrations

[0251]

[0252]

[0253]

[0254]

[0255]

[0256] MOCK is a blank control group in which only transfection reagent and plasmid are added; NC1 is a negative control siRNA, and the sequence information is shown in Table 7 in Example 1.

[0257] Conclusion: The candidate naked sequences ranked high in the three concentration effects of psiCHECK; sequences with silencing efficiency greater than 30% at 0.01nM, 75% at 0.1nM and 85% at 1nM were retained, and a total of 57 sequences entered the next round.

[0258] Example 3: On-target activity detection of modified siRNA for inhibiting RAGE

[0259] The sequences with higher inhibition rates in Examples 1 and 2 were chemically modified in siRNA, and the specific sequences are shown in Table 3. On-target activity was detected under conditions where the final concentration of siRNA was 0.1 nM and 1 nM. The test method used was the same as that used in Example 1, except that the siRNA was different. The test results are shown in Table 9 below, and the results show that the chemically modified duplex has good inhibitory activity on RAGE expression at different concentrations.

[0260] Table 9: On-target activity detection of modified siRNA at different concentrations

[0261]

[0262]

[0263]

[0264]

[0265]

[0266]

[0267]

[0268]

[0269] Among them, MOCK is a blank control group with only transfection reagent and plasmid added; NC1 is a negative control siRNA, and the sequence information is shown in Table 19.

[0270] Conclusion: Each candidate sequence has a better effect than other modification combinations except itself; sequences with 0.1nM silencing efficiency greater than 60% and 1nM silencing efficiency greater than 80% were retained for the next round, totaling 102 sequences.

[0271] Example 4: Verification of the inhibitory effect of siRNA on the target gene RAGE at the cell level

[0272] 4.1 Single concentration test

[0273] Experimental principle: siRNA is transfected into the selected cell line, and the intracellular siRNA interferes with and silences the target RAGE-mRNA. The relative expression of the RAEG target protein gene of the cell is obtained using the relative quantitative method; the activity of the endogenous expression mRNA of the silenced RAGE target protein gene of each sequence is analyzed.

[0274] Experimental purpose: To verify the inhibitory effect of siRNA on the target gene RAGE at the cellular level and retain the sequence with better effect.

[0275] The experimental steps are as follows:

[0276] 1. Cell Transfection

[0277] (1) Experimental reagents, as shown in Table 10.

[0278] Table 10: Experimental reagents used in the experiment

[0279] Reagent name factory Article number / Batch number Storage conditions DEPC water GenePharma - / 240088 4℃ Opti-MEM Gibco 31985-070 / 2537156 2-8℃ Lipofectamine RNAiMAX ThermoFisher 56532 / CN2488104 4℃ F12K medium GIBCO 21127-022 / 2616994 4℃ DMEM GIBCO 11965-092 / 2646156 4℃ 0.25% pancreatin GIBCO 25200-072 / 2468314 4℃ PBS Sigma-Aldrich 806552-500ML / RNBL3279 4℃ Buffer CRL GenePharma - / 20220401 normal temperature Buffer CRW0 GenePharma - / 20220401 normal temperature Buffer CRW1 GenePharma - / 20220401 normal temperature DNase I GenePharma - / 20220401 -20℃ Magnetic beads Luoyang Jinte GNT-104 / 20220407 normal temperature

[0280] (2) Preparation before the experiment

[0281] Nanodrop was used to detect the purity and concentration of siRNA to ensure that the purity and concentration of siRNA met the requirements for subsequent screening.

[0282] (3) Cell preparation

[0283] A549 was obtained from the Cell Bank of the Chinese Academy of Sciences, and BEAS-2B was purchased from Cybio. A549RAGE LV or BEAS-2B RAGE LV cells cultured in 10 cm culture dishes were routinely trypsinized 48 h after passage. A549RAGE LV cells were resuspended in complete medium and cultured at 2.8×10 5 / mL, BEAS-2B RAGE LV cells were expressed at 2.4×10 5 / mL, 50 μL / well, inoculated in 96-well plates for subsequent experiments.

[0284] (4) Cell transfection

[0285] The single siRNA concentration was set to 1nM; the three concentrations were set to a concentration gradient of 1nM, 0.1nM, and IC50 was set to a concentration gradient of 10nM, 1nM, 0.3nM, 0.1nM, 0.03nM, 0.01nM, 0.003nM, and 0.001nM. The transfection reagent lipofectamine RNAiMAX was used at a dosage of 0.25μL / well. After considering the loss, the transfection complex was prepared, i.e., 25μL of Opti-MEM was used to dilute the siRNA and lipofectamine RNAiMAX transfection reagent in each well, and after standing for 5min, the two components were mixed and allowed to stand for 20min.

[0286] After the resting time was up, the transfection complex was added to the corresponding wells at 50 μL / well to make a final volume of 100 μL in each well.

[0287] About 12 hours after transfection, the transfection complex was discarded, 100 μl of complete culture medium was added to each well, and the cells were placed in an incubator for continued culture.

[0288] 48 hours after transfection, take out the transfected 96-well plate, discard the supernatant, pipette 100 μL Buffer CRL into each well to mix, and let stand at room temperature for 5 minutes.

[0289] (5) RNA extraction

[0290] 1) Plate loading

[0291] Second plate: Add lysate sample to each well, then add 400 μL isopropanol, mix by pipetting, and then add 20 μL magnetic beads (the beads should be mixed by pipetting with a pipette to avoid clumping, which reduces the adsorption efficiency of the magnetic beads);

[0292] Plate 3: Add 900 μL Buffer CRW 0 to each well;

[0293] First plate: add 200 μL DNase I reaction solution to each well;

[0294] Fourth plate: add 900 μL Buffer CRW 0 to each well;

[0295] Fifth plate: add 900 μL Buffer CRW 1 to each well;

[0296] Plate 6: Add 100 μL DEPC water to each well.

[0297] 2) Computer program, as shown in Table 11.

[0298] Table 11: Magnetic bead method automatic extraction procedure

[0299]

[0300]

[0301] 3) RNA should be temporarily stored at 4°C and used in PCR experiments within one day. (If stored for a long time, it should be kept at -80°C).

[0302] 2.qRT-PCR detection

[0303] GAPDH was used as an internal reference for relative expression analysis.

[0304] (1) The primers used in the qRT-PCR assay are shown in Table 12, and the experimental reagents are shown in Table 13.

[0305] Table 12: Primers used in qRT-PCR assays

[0306]

[0307] Table 13: Reagents used and their sources

[0308] Reagent name factory Article number / Batch number Storage conditions HiScript II U+One Step qRT-PCR Probe Kit Vazyme Q223-01 / 017E2290JA -20℃ H-RAGE-F Synbio Tech / -20℃ H-RAGE-R Synbio Tech / -20℃ H-RAGE-PR GenePharma / -20℃ GAPDH-F Synbio Tech / -20℃ GAPDH-R Synbio Tech / -20℃ GAPDH-PR GenePharma / -20℃

[0309] (2) gDNA removal: the reaction system is shown in Table 14.

[0310] Table 14: Reaction system

[0311] system Single reaction dosage 10x Buffer 2μL DNase1 2μL RNA template 16μL

[0312] 20 μL of the reaction solution was placed at 37°C for 15 min to remove genomic DNA, and then 2 μL of EDTA was added.

[0313] (3) PCR reaction system, as shown in Table 15

[0314] Table 15: PCR reaction system

[0315]

[0316]

[0317] (4) PCR reaction procedure, as shown in Table 16.

[0318] Table 16: PCR reaction program

[0319]

[0320] The experimental results are as follows:

[0321] Table 17: Comparison of candidate sequences and different modifications

[0322]

[0323]

[0324] Summary of all sequences:

[0325] Table 18: Summary results of all sequences

[0326]

[0327]

[0328]

[0329] MOCK is a blank control group with only transfection reagent and plasmid added; NC5 is a negative control siRNA, and the sequence information is shown in Table 4; BLANK: no substance was added.

[0330] Note: NC1 is a meaningless naked sequence, which is used as a negative reference for naked sequences in psiCHECK experiments and is also used in subsequent psiCHECK modified sequence screening; NC5 is a meaningless sequence with modification. Considering that all screening sequences in the cell line are modified, NC5 is used as a negative reference in all cell experiments. The sequences of NC1 and NC5 are shown in Table 19.

[0331] Table 19: NC series sequence

[0332]

[0333] Conclusion: The sequences with A549 RAGE LV silencing efficiency greater than 90% and BEAS-2B RAGE LV silencing efficiency greater than 80% were selected to enter the next round: GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA227S2, GPSZRA227S3, GPSZRA227S4, GPSZRA227S5, GPSZRA228S5, GPSZRA231S1, GPSZRA231S2, GPSZRA231S3, GPSZRA231S4, GPSZRA2 31S5, GPSZRA233S1, GPSZRA233S2, GPSZRA233S3, GPSZRA233S4, GPSZRA233S5, GPSZRA267S2, GPSZRA267S3, GPS ZRA267S5, GPSZRA271S1, GPSZRA271S2, GPSZRA271S3, GPSZRA271S4, GPSZRA271S5, GPSZRA282S4, GPSZRA284S2 , GPSZRA284S3, GPSZRA284S4, GPSZRA284S5, GPSZRA287S4, GPSZRA287S5, GPSZRA301S2, GPSZRA314S1, GPSZRA 314S2, GPSZRA314S3, GPSZRA314S4, GPSZRA314S5, GPSZRA318S2, GPSZRA318S3, GPSZRA318S4, GPSZRA318S5, GP SZRA381S1, GPSZRA381S2, GPSZRA381S3, GPSZRA402S1, GPSZRA402S2, GPSZRA402S3, GPSZRA402S4, GPSZRA402S5, GPSZRA407S1, GPSZRA407S2, GPSZRA407S4, GPSZRA410S1, GPSZRA410S2, GPSZRA410S3, GPSZRA410S4, a total of 59 items.

[0334] 4.2 Second concentration test

[0335] The 59 sequences screened in 4.1 were subjected to the next round of screening. The experimental steps were the same as 4.1, except that the screening was performed at two concentrations, 0.1 nM and 1 nM.

[0336] The experimental results are shown in Table 19.

[0337] Table 19: Summary results of two-concentration test sequence

[0338]

[0339]

[0340]

[0341] Among them, MOCK is a blank control group with only transfection reagent and plasmid added; NC5 is a negative control siRNA, and the sequence information is shown in Table 19; BLANK: no substance was added.

[0342] Conclusion: The top 50% of sequences with the highest potency at these concentrations advanced to the next round: GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA227S4, GPSZRA227S5, GPSZRA233S4, GPSZRA267S2, GPSZRA284S3, GPSZRA287S4, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S4, GP SZRA314S5, GPSZRA314S5, GPSZRA318S2, GPSZRA318S3, GPSZRA318S4, GPSZRA381S2, GPSZRA381S3, GPSZRA402S1, GPSZRA402S2, GPSZRA402S4, GPSZRA402S5, GPSZRA407S2, GPSZRA407S4, GPSZRA410S1, GPSZRA410S2, GPSZRA410S4, a total of 29 items.

[0343] Example 5: IC50 test

[0344] Conduct cell line IC50 test and determine the final candidate sequence based on the absolute IC50 value.

[0345] Experimental principle: Use Graphpad software, set the X axis to log (concentration), the Y axis to inhibition rate, and use "non-linear regression" to fit the IC50 curve. The curve equation is "Y = Bottom + (Top-Bottom) / (1 + 10 ((LogIC50 -X)*HillSlope) )". Bottom in the formula is the minimum inhibition rate, Top is the maximum inhibition rate, HillSlope is the slope of the curve, and LogIC50 is the logarithm of IC50 (half inhibition concentration).

[0346] Experimental purpose: Conduct cell line IC50 test and determine the final candidate sequence based on the absolute value of IC50.

[0347] The test results are shown in Table 20 and Table 21.

[0348] Table 20: Naked sequences of siRNA sequences involved in IC50 test

[0349] Sequence number sense seq(5'-3') Antisense seq (5'-3') GPSZRA222 UCUUCACACUGCAGUCGGA UCCGACUGCAGUGUGAAGAGC GPSZRA227 ACACUGCAGUCGGAGCUAA UUAGCUCCGACUGCAGUGUGA GPSZRA233 CAGUCGGAGCUAAUGGUGA UCACCAUUAGCUCCGACUGCA GPSZRA267 GCAGUAGCUCCUGGUGGAA UUCCACCAGGAGCUACUGCUC GPSZRA284 CCGUAACCCUGACCUGUGA UCACAGGUCAGGGUUACGGUU GPSZRA287 UAACCCUGACCUGUGAAGU ACUUCACAGGUCAGGGUUACG GPSZRA314 ACUGGAUGAAGGAUGGUGU ACACCAUCCUUCAUCCAGUGG GPSZRA318 GAUGAAGGAUGGUGUGCCC GGGCACACCAUCCUUCAUCCA GPSZRA381 AUCAGUCGGAGGAACCUGA UCAGGUUCCUCCGACUGAUUC GPSZRA402 CCAACUCUCUCCUGUAUAA UUAUACAGGAGAGAGUUGGUC GPSZRA407 CCUGUAUAACCCCACCUUG CAAGGUGGGGUUAUACAGGAG GPSZRA410 GUAUAACCCCACCUUGCCA UGGCAAGGUGGGGUUAUACAG

[0350] Table 21: IC50 results show

[0351]

[0352]

[0353] Results: The sequences with IC50 values ​​less than 30 in A549 RAGE LV or less than 65 in BEAS-2B RAGE LV were selected and retained: GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA267S2, GPSZRA284S3, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S5, GPSZRA318S2, GPSZRA402S4, and GPSZRA402S5, a total of 13 sequences.

[0354] Example 6: Stability Test

[0355] Experimental principle: After entering the human body, siRNA will pass through the blood and various tissues and organs, and finally enter the cells to exert a silencing effect. During this transportation process, many environmental factors will affect the stability of siRNA, such as human serum and ubiquitous RNase, as well as entering various tissue metabolites and enzymes. Stability directly affects its in vivo activity. This experiment simulates three environments in vitro: RNase, serum, and tissue metabolic enzyme (S9) to examine the stability of siRNA.

[0356] Experimental purpose: To test the stability of candidate sequences in RNase, human serum and Human Lung S9 in vitro.

[0357] Experimental steps:

[0358] (1) Preparation of RNase A solution: Take the solutions and reagents in Table 22 in turn and add pure water to make up to 10 mL to obtain a 10 mg / mL stock solution. Store at 4°C for later use.

[0359] Table 22: RNase A solution preparation table

[0360]

[0361]

[0362] 5 μL siRNA (10 μM) was taken, 1 μl RNase A (0.1 mg / ml) and 4 μl water were added, and 6 tubes were prepared for each group. The tubes were treated in a 37°C water bath at different reaction times of 1 min, 15 min, 30 min, 60 min, 120 min, and 240 min (the actual time gradient is subject to the experimental result chart). After the treatment, the tubes were quickly frozen with liquid nitrogen and stored at -80°C.

[0363] (2) Serum stability

[0364] The reaction system was prepared according to Table 23, with 5 tubes in each group. The tubes were treated in a 37°C water bath at different reaction times of 1 min, 3 h, 6 h, 24 h, and 48 h (the actual time gradient is subject to the experimental result diagram). After the treatment, the tubes were quickly frozen with liquid nitrogen and stored at -80°C.

[0365] Table 23: Serum stability addition status table

[0366]

[0367] (3) S9 stability

[0368] 5 μL siRNA (10 μM) was taken, and 1 μL Human Lung S9 (5 mg / mL) and 4 μL incubation solution (125 mM Tris·HCl, 7.5 mM MgCl2, 2.5 mM EDTA, the formula is as shown in Table 24 below) were added. Six tubes were prepared for each group and treated in a 37°C water bath at different reaction times of 1 h, 3 h, 6 h, 24 h, 48 h, and 72 h (the actual time gradient is subject to the experimental result diagram). After treatment, the cells were quickly frozen with liquid nitrogen and stored at -80°C.

[0369] Table 24: S9 incubation solution formula (100 mL)

[0370]

[0371] (4) siRNA gel analysis

[0372] Use 20% PAGE gel, run for 55 min at 200 V and 400 A, then take photos for analysis. When treating serum samples, dilute with DEPC water according to the proportions in the table above before loading.

[0373] (5) Experimental results

[0374] 1) RNase test results Figure 1A-1G , as shown in Table 25.

[0375] Table 25: Grayscale results of RNase stability gel run

[0376]

[0377]

[0378] The number plus UM indicates an unmodified sequence.

[0379] 2) Serum stability, experimental results such as Figure 2A-2F , as shown in Table 26.

[0380] Table 26: Grayscale results of serum stability gel run

[0381]

[0382]

[0383] The number plus UM indicates an unmodified sequence.

[0384] 3) S9 stability, experimental results are as follows Figure 3A-3G , as shown in Table 27.

[0385] Table 27: S9 stability run grayscale results

[0386]

[0387] The number plus UM indicates an unmodified sequence.

[0388] Conclusion: The stability of siRNA is shown by the decrease of grayscale over time. The slower the grayscale decreases over time, the more stable the siRNA is. The results showed that GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA267S2, GPSZRA284S3, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S5, GPSZRA318S2, GPSZRA402S4, GPSZRA402S5, a total of 13 test sequences, showed good stability in vitro against RNase, serum, and S9 compared with their corresponding unmodified sequences.

[0389] Example 7: IC50 test after adding VP modification

[0390] In order to further increase the inhibitory activity of siRNA, we modified the siRNA obtained by screening in Example 6 with VP and tested the IC50 after modification.

[0391] The experimental steps and methods are shown in Example 5.

[0392] The experimental results are shown in Tables 28 and 29.

[0393] Table 28: Naked siRNA sequences used in this experiment

[0394] Sequence number sense seq(5'-3') Antisense seq (5'-3') GPSZRA222 UCUUCACACUGCAGUCGGA UCCGACUGCAGUGUGAAGAGC GPSZRA227 ACACUGCAGUCGGAGCUAA UUAGCUCCGACUGCAGUGUGA GPSZRA267 GCAGUAGCUCCUGGUGGAA UUCCACCAGGAGCUACUGCUC GPSZRA284 CCGUAACCCUGACCUGUGA UCACAGGUCAGGGUUACGGUU GPSZRA314 ACUGGAUGAAGGAUGGUGU ACACCAUCCUUCAUCCAGUGG GPSZRA318 GAUGAAGGAUGGUGUGCCC GGGCACACCAUCCUUCAUCCA GPSZRA402 CCAACUCUCUCCUGUAUAA UUAUACAGGAGAGAGUUGGUC

[0395] Table 29: siRNA inhibitory activity after VP modification

[0396]

[0397] Results: After VP modification, the inhibitory activity of siRNA was significantly enhanced.

[0398] Example 8: ELISA test to verify the in vitro inhibitory effect of siRNA on RAGE protein

[0399] Experimental principle: The expression of target protein is positively correlated with its mRNA level. The ELISA kit is used to detect the intracellular and extracellular protein expression of RAGE after cell transfection with siRNA, which directly reflects its in vitro efficacy.

[0400] Experimental purpose: To verify the in vitro inhibitory effect of siRNA sequence on RAGE protein. The supernatant contains sRAGE (RAGE protein free outside the cell) and the cell lysate contains fRAGE (RAGE protein located on the cell membrane).

[0401] Experimental steps:

[0402] (1) Experimental reagents are shown in Table 30

[0403] Table 30: Experimental reagents used in ELISA

[0404]

[0405] (2) Sample preparation

[0406] Supernatant: 48 hours after cell transfection, directly aspirate the supernatant and freeze it in a -80℃ refrigerator.

[0407] Lysis buffer: 48 h after transfection, cells were washed twice with 100 μL PBS and 100 μL M-PER lysis buffer (containing 1× Halt TM Protease Inhibitor Cocktail), pipetted five times, and stored in a -80℃ refrigerator.

[0408] (3) Preparation of relevant solutions for the experiment

[0409] Wash Buffer: Return the Wash Buffer concentrate to room temperature, mix gently until the crystals dissolve, and dilute the Wash Buffer concentrate 1:25 with deionized or distilled water.

[0410] Substrate solution: Color reagents A and B should be mixed together in equal volumes within 15 minutes of use. Protect from light.

[0411] Standard preparation: After the standard powder in the kit returns to room temperature, refer to the label bottle and reconstitute it with deionized or distilled water. Mix gently and use it after it is fully dissolved for 15 minutes. This reconstitution produces a 50,000 pg / mL stock solution, which should be stored at 4°C.

[0412] Transfer 900μL of calibrator diluent RD5-5 to the 5000pg / mL tube. Transfer 500μL of calibrator diluent to the remaining tubes. Add 100μL of standard stock solution to the 5000pg / mL tube, mix thoroughly, then take 500μL and add it to the 2500pg / mL tube, mix thoroughly, and repeat the above steps to obtain 5000pg / mL, 2500pg / mL, 1250pg / mL, 625pg / mL, 313pg / mL, 156pg / mL, and 78pg / mL standard solutions.

[0413] (4) Detection experiment process

[0414] 1) Remove the multi-month microplate strips from the well plate, place them back into the foil bag containing the desiccant, and reseal.

[0415] 2) Add 100 μL of assay diluent RD1-60 to each well.

[0416] 3) Dilute the sample to be tested with diluent RD5-5 according to the set dilution ratio, and add 50 μL of standard, control or sample to each well according to the layout. Cover with the provided adhesive strips. Incubate at room temperature for 2 hours.

[0417] 4) Aspirate and wash each well, 400 μL per well, for a total of 4 washes. After the last wash, invert the plate and blot dry with a clean paper towel.

[0418] 5) Add 200 μL Human RAGE Conjugate to each well. Cover with a new gel strip. Incubate at room temperature for 2 hours.

[0419] 6) Repeat the above steps for washing.

[0420] 7) Add 200 μL of substrate solution to each well and incubate at room temperature for 30 min, avoiding direct light.

[0421] 8) Add 50 μL of stop solution to each well, gently shake the plate to mix the liquid and then test immediately.

[0422] 9) Using a microplate reader set at a wavelength of 450 nm, immediately measure the absorbance of each well.

[0423] 10) Using an ELISA reader set at a wavelength of 570 nm, the absorbance value of each well was immediately measured. The experimental results are shown in Tables 31 to 34.

[0424] Table 31: Inhibition rate of siRNA on A549 RAGE LV supernatant

[0425]

[0426] Table 32: Inhibition rate of siRNA on A549 RAGE LV lysate

[0427]

[0428] Table 33: Inhibition rate of siRNA on BEAS-2B RAGE LV supernatant

[0429]

[0430]

[0431] Table 34: Inhibition rate of siRNA on BEAS-2B RAGE LV lysate

[0432]

[0433] Results: The modified siRNA of the present application has a very strong inhibitory effect on both sRAGE and fRAGE proteins. Summary: The inhibitory data of the screening sequences with superior activity are summarized in Table 35.

[0434] Table 35: Summary of inhibitory data for screening sequences with superior activity

[0435]

[0436]

[0437]

[0438] Results: As shown in Table 35, GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA267S2, GPSZRA284S3, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S5, GPSZRA318S2, GPSZRA402S4, GPSZRA402S5, a total of 13 sequences, and the corresponding 13 VP modifications (GPSZRA222S1-VP, GPSZRA222S3-VP, GPSZRA222S4-VP, GPS The on-target activity of siRNAs of the corresponding naked sequences (GPSZRA222, GPSZRA267, GPSZRA284, GPSZRA314, GPSZRA318, GPSZRA402) was excellent in inhibiting the target gene RAGE in A549RAGE LV cells and BEAS-2B RAGE LV cells, and the activity was further enhanced with the increase of modifications.

[0439] Example 9: Stability Test

[0440] The purpose of this experiment is to test the stability of siRNA modified with VP. The experimental steps are shown in Example 6.

[0441] Experimental results:

[0442] (1) RNase stability, experimental results such as Figure 4A-4C , as shown in Table 36.

[0443] Table 36: Grayscale results of RNase stability gel run

[0444]

[0445] Sequences plus UM indicate unmodified siRNA sequences.

[0446] (2) Serum stability, experimental results such as Figure 5A-Figure 5C , as shown in Table 37.

[0447] Table 37: Grayscale results of serum stability gel run

[0448]

[0449] Sequences plus UM indicate unmodified siRNA sequences.

[0450] (3) S9 stability test results are as follows Figure 6A-6C , as shown in Table 38.

[0451] Table 38: S9 stability run grayscale results

[0452]

[0453]

[0454] Sequences plus UM indicate unmodified siRNA sequences.

[0455] Conclusion: The stability of siRNA is shown by the decrease of grayscale over time. The slower the grayscale decreases over time, the more stable the siRNA is. The results show that siRNA sequences with different modification patterns still have excellent RNase stability, serum stability and human lung S9 stability after further adding VP modification.

[0456] Example 10: Cytotoxicity

[0457] Experimental principle: CCK-8 experiment is a method for detecting cell proliferation and cytotoxicity. Its principle is to use the dehydrogenase in the cell mitochondria to reduce WST-8 in the CCK-8 reagent to a colored formazan product. The OD value at 450nm is measured to detect the content of dehydrogenase, and the proliferation activity of the cell at this time is indirectly measured. The CCK-8 experiment after siRNA transfection can evaluate whether siRNA has proliferation toxicity to cells.

[0458] Experimental purpose: To test the cytotoxicity of modified siRNA to A549 RAGE LV (A549 cells overexpressing RAGE) or BEAS-2BRAGE LV (BEAS-2B overexpressing RAGE) cells.

[0459] The CCK8 cell proliferation curve was used to verify whether the sequence pair had cytotoxicity.

[0460] Experimental steps:

[0461] (1) Experimental reagents

[0462] Table 39: Sources of experimental reagents used

[0463] Reagent name factory Article number / Batch number Storage conditions CCK8 Detection Kit DOJINDO CK04 4℃

[0464] (2) Cell preparation

[0465] A549 RAGE LV (A549 cells overexpressing RAGE) or BEAS-2BRAGELV (BEAS-2B overexpressing RAGE) cells cultured in 10 cm culture dishes were routinely trypsinized 48 h after passage. Resuspended in complete medium, and then plated at the corresponding cell number of 1.4 × 10 4 / hole or 1.2×10 4 / well, 50 μL / well was inoculated into a 96-well plate (the transfection complex was added after the cells were plated into the cell plate), and 100 μL PBS was added to the peripheral wells to prevent the influence of the edge wells for subsequent experiments.

[0466] (3) Cell transfection

[0467] There are 9 sequences in total, and NC1, MOCK, BLANK, and complete culture medium are used as controls. The MOCK group is a group that only adds interference reagents without any sequence; BLANK is a group with only cells. NC1 is a negative control siRNA, and the sequence information is shown in Table 7 in Example 1.

[0468] The concentration gradient of siRNA was set: 10nM, 1nM, 0.1nM, 0.01nM for transfection, and the amount of transfection reagent lipofectamineRNAiMAX was 0.25μL / well. After considering the loss, the transfection complex was prepared, that is, 25μL opti-MEM was used to dilute siRNA and lipofectamine RNAiMAX transfection reagent in each well, and after standing for 5 minutes, the two components were mixed and stood for 20 minutes.

[0469] After the resting time was up, the transfection complex was added to the corresponding wells at 50 μL / well to make a final volume of 100 μL in each well.

[0470] About 6 hours after transfection, the transfection complex was discarded and the reading at 0 hours was determined.

[0471] At other time points, add 100 μL of complete culture medium to each well and place the well in the incubator for further culture.

[0472] (4) Cell testing

[0473] After 24h and 48h, the cell plates were removed and a mixture of 10 μl CCK-8 solution and 90 μl of empty culture medium was added to each well. The CCK8 reading of the blank wells of each 96-well plate with complete culture medium was used as the background.

[0474] After the culture plate was incubated in an incubator for 4 hours, the absorbance at 450 nm was measured using an enzyme reader.

[0475] Experimental results:

[0476] (1) The cytotoxicity of modified siRNA to A549 RAGE LV cells. The experimental results are as follows Figure 7A-Figure 7I , as shown in Table 40.

[0477] Table 40: Cytotoxicity of modified siRNA against A549 RAGE LV

[0478]

[0479]

[0480] The MOCK group is a group with only interference reagents added but no sequence; the BLANK group is a group with only cells. NC5 is a negative control siRNA, and the sequence information is shown in Table 19 in Example 4.

[0481] (2) The cytotoxicity of modified siRNA to BEAS-2B RAGE LV. The experimental results are as follows Figure 8A-8I , as shown in Table 41.

[0482] Table 41: Cytotoxicity of modified siRNA to BEAS-2B RAGE LV

[0483]

[0484]

[0485] The MOCK group is a group with only interference reagents added but no sequence; the BLANK group is a group with only cells. NC5 is a negative control siRNA, and the sequence information is shown in Table 19 in Example 4.

[0486] Conclusion: GPSZRA314S1-VP, GPSZRA314S2-VP, GPSZRA314S3-VP, GPSZRA314S5-VP, GPSZRA402S4-VP, GPSZRA402S5-VP, GPSZRA222S3-VP, GPSZRA222S4-VP, and GPSZRA318S2-VP, a total of 9 sequences, had no significant difference in toxicity to A549 RAGE LV and BEAS-2BRAGE LV cells and compared with BLANK, MOCK, and negative references, and therefore had no cytotoxicity to these cells.

[0487] Example 11: Immunotoxicity

[0488] Experimental principle: PBMC is a mixture of multiple immune cells, which are key components of the innate and adaptive immune systems. When PBMC cells are stimulated by external pathogens, they will induce a series of immune responses and eventually express interferons and cytokines. SiRNA is co-incubated with PBMC to detect the expression of representative downstream cytokines and interferons to determine whether siRNA has immunotoxicity.

[0489] Experimental purpose: Sequence transfection of PBMC cells, detection of downstream immune response-related molecules, and verification of whether the sequence is immunotoxic.

[0490] In this experiment, PHA is used as phytohemagglutinin, which can be used as a positive drug to stimulate immune cells to produce immune responses and induce the expression of cytokines; Poly IC is a double-stranded RNA analog that can induce the expression of interferon and verification factors; Donor is the donor of PBMC cells, and Donor1, Donor2, and Donor3 represent three different healthy people. This experiment first isolates PBMC from the donor, and then transfects PBMC cells with modified siRNA to detect downstream immune response-related molecules and verify whether the sequence is immunotoxic.

[0491] Experimental steps:

[0492] (1) Experimental reagents, see Table 42.

[0493] Table 42: Sources of experimental reagents

[0494]

[0495] (2) Cell preparation

[0496] Isolation of PBMCs:

[0497] Prepare three donor blood samples, take three 15mL centrifuge tubes (marked with serial numbers), pour the blood into (about 2mL), add 2mL PBS, and mix by inversion;

[0498] Prepare three 15 mL centrifuge tubes, add 3 mL of blood cell separation solution, slowly transfer the mixed blood sample to the tube with a gun, and centrifuge in a low-temperature centrifuge with parameters of 2000 r, 20 min, 4 ° C, acceleration 9, and deceleration 6;

[0499] Prepare three 15 mL centrifuge tubes, add 4 mL of PBS, and draw 2 mL of the membrane between the upper yellow layer and the middle white layer after centrifugation (this is the cell), and centrifuge in a low-temperature centrifuge with parameters of 1500 r, 10 min, 4 ° C, acceleration 9, and deceleration 9;

[0500] Pour off the supernatant, add 2 mL of PBS to wash, no need to resuspend the pellet, and centrifuge again, with the same parameters as above;

[0501] Discard the supernatant, add 300 μL 1640 to resuspend, take three 1.5 mL EP tubes, add 180 μL PBS, take 20 μL of cell suspension and mix well (dilute 10 times), and count with a cell counter;

[0502] Then 2×10 6 cell / mL, and 50 μL / well was inoculated in a 96-well plate for subsequent transfection experiments.

[0503] (3) Cell transfection

[0504] There are 7 sequences in total, and PHA, Poly IC, Inclisiran, MOCK, and complete culture medium are used as controls. The MOCK group is a group that only adds interfering reagents without any sequence.

[0505] Final siRNA concentration: 100 nM; final poly IC concentration: 2 μg / ml.

[0506] Preparation of siRNA diluent: Take 1 μL of 10 μM siRNA stock solution and add 12.5 μL DNA diluent B and mix well;

[0507] Preparation of Poly IC diluent: Take 1 μL of 0.2 μg / μL Poly IC solution and add 12.5 μL DNA diluent B and mix well;

[0508] Preparation of GenePORTER2 dilution: 1.75 μL GenePORTER2 dissolved in 7 μL opti-MEM;

[0509] Preparation of transfection complex: Mix siRNA dilution or Poly IC dilution with GenePORTER2 dilution respectively and incubate at room temperature for 5-10 minutes;

[0510] When the incubation time is up, add 22.25 μL / well of the transfection complex to the corresponding wells, add the corresponding siRNA, and then supplement the culture medium to make the final volume of each well 100 μL;

[0511] Note: PHA does not require transfection reagent. Take 15 μL directly and mix it with the cell suspension, and add culture medium to a final volume of 100 μL.

[0512] About 48 hours after transfection, the cell supernatant was collected for subsequent immunogenicity detection experiments.

[0513] (4) Immunogenicity testing

[0514] Place 2 mL of calibrant in a centrifuge tube and mark it as the highest concentration;

[0515] Add 2 mL of sample diluent and let stand at room temperature for 15 min (use within 4 h);

[0516] Use a pipette to gently pipette for 30 seconds, avoiding violent shaking and avoiding bubbles;

[0517] Take 11 sample tubes, label them as 1:2, 1:4, 1:8, 1:16, 1:32, 1:64, 1:128, 1:256, 1:512, 1:1024, 1:2048, and add 300 μL of sample diluent to each tube (use within 4 hours);

[0518] Take 300 μL of the highest concentration and add it to the 1:2 tube, pipette and mix well, take 300 μL of the 1:2 tube and add it to the 1:4 tube, and so on, up to the 1:2048 tube;

[0519] Calculate the total number of samples (33 samples, 11 calibrators, 1 negative control), and calculate the amount of capture microsphere mixture (25 μL / portion) based on the total number of samples;

[0520] The capture microsphere mixture was pipetted for 30 seconds, the required amount of capture microsphere mixture was aspirated, and the mixture was centrifuged at 200g for 5 minutes at a low speed. The supernatant was carefully aspirated, and an equal volume of microsphere buffer was added. After pipetting, the mixture was incubated in the dark for 15-30 minutes.

[0521] Add 25 μL of fluorescence detection reagent to each experimental tube;

[0522] Add 25 μL of the graded diluted calibrator to the calibrator tube, add 25 μL of the sample to be tested to the sample tube, and vortex to mix;

[0523] After incubation, the capture microsphere mixture was pipetted for 30 s, and 25 μL was added to each experimental tube and shaken;

[0524] After operation, incubate at room temperature in the dark for 2.5-3h;

[0525] Add 1 mL of washing solution to each experimental tube, centrifuge at 200 g for 5 min, pour out the liquid in the tube, and absorb the remaining liquid at the tube mouth with paper;

[0526] Add 200 μL of washing solution to each experimental tube, place it away from light, and wait for detection;

[0527] The experimental tubes were loaded onto the machine in the order of calibration (from small to large concentration), negative control (25 μL microspheres + 300 μL washing solution), and experimental samples. Each experimental tube was vortexed for 3-5 seconds and then immediately loaded onto the machine for testing.

[0528] The experimental results are as follows Figure 9A-9KAs shown in Tables 43 and 44 below, compared with the MOCK group, PHA activated cytokines TNF-α, interferon IFN-α, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12P70, IL-17, and IFN-γ, while the test sequence did not lead to significant upregulation of these cytokines.

[0529] Tables 43 and 44 summarize the experimental results by calculating the average of the three donor values.

[0530] Table 43: Cellular immune response induced by modified siRNA

[0531]

[0532]

[0533] As shown in Table 43, compared with the MOCK group, the secretion of IFN-α, IL-1β, IL-2, IL-4, IL-5, and IL-6 was increased by the stimulation of PHA or Poly IC, while the siRNA treatment group had no significant effect.

[0534] Table 44: Cellular immune response induced by modified siRNA

[0535]

[0536] As shown in Table 44, compared with the MOCK group, the secretion of IL-10, IL-12P70, IL-17, IFN-γ, and TNF-α was increased by the stimulation of PHA, while the siRNA treatment group did not lead to an increase in the secretion of these factors.

[0537] Conclusion: GPSZRA314S1-VP, GPSZRA314S2-VP, GPSZRA314S3-VP, GPSZRA314S5-VP, GPSZRA402S4-VP, and GPSZRA402S5-VP, a total of 6 sequences have no immunotoxicity.

[0538] Example 12: PSICHECK off-target testing

[0539] Experimental principle: In some cases, siRNA may downregulate non-target genes whose 3'-untranslated regions of certain transcripts are complementary to the guide strand seed region (nucleotides 2 to 8). This off-target effect has a regulatory mechanism similar to the target silencing mechanism of miRNA, which is called miRNA-like off-target. In addition, other types of off-target effects of siRNA may be due to the loading of the sense strand in the RNA-induced silencing complex, that is, sense strand off-target. In order to simultaneously investigate whether siRNA has miRNA-like off-target risks, sense strand off-target risks, and sense strand seed region off-target risks, we designed three off-target plasmids: GSSM (antisense strand seed region off-target plasmid), PSCM (sense strand off-target plasmid), PSSM (sense strand seed region off-target plasmid), and the positive target plasmid (GPSZRA) was co-transfected with siRNA into 293T cells to evaluate whether there is an off-target risk by the level of silencing efficiency.

[0540] Experimental purpose: The psiCHECK system was used to evaluate the off-target risks of candidate sequences and VP modifications in vitro, including the off-target risks of the antisense strand seed region, the sense strand off-target risk, and the sense strand seed region off-target risk.

[0541] Experimental steps:

[0542] (1) Experimental reagents are shown in Table 45.

[0543] Table 45: Experimental reagents used in the experiment

[0544]

[0545] (2) Cell preparation

[0546] The conventionally cultured 293T cells were digested with trypsin and resuspended in complete medium to adjust the cell concentration to 1×10 6 / mL for subsequent experiments.

[0547] (3) Cell transfection

[0548] 1) Dilution of transfection reagent

[0549] According to the actual number of wells to be transfected and after taking into account the loss, the transfection reagent was diluted with opti-MEM and then added to the 96-well plate (transfection reagent + RNA plate) using a dispenser so that each well contained 130 μL opti-MEM and 1.2 μL Lipofectamine 2000 transfection reagent. This is the transfection reagent dilution plate.

[0550] 2) Dilution of siRNA (RNA oligo)

[0551] Dissolve siRNA: 1OD + 250μL DEPC water. At this time, the siRNA concentration is 10μM and can be stored at -20℃ for later use. Prepare siRNA according to the predetermined siRNA concentration. If 10nM siRNA is required, pipette 4μL of 10μM siRNA into 196μL opti-MEM water. At this time, the siRNA concentration is 200nM for later use. Dilute the 200nM siRNA to 20nM. Add the prepared siRNA to the 96-well plate (transfection reagent + RNA plate) at 20μL / well according to the distribution of siRNA on the well plate.

[0552] 3) Dilution of plasmid

[0553] According to the distribution of siRNA on the well plate, take the corresponding plasmid, dilute it with opti-MEM according to the number of wells and taking into account the loss, mix it well and add it to a 96-well plate (arranged according to the well position of the corresponding siRNA) so that each well contains 80 ng of plasmid in 50 μL of opti-MEM. This is the plasmid dilution plate.

[0554] 4) Transfection

[0555] Use a dispensing gun to arrange the plasmids according to the "plasmid plate", pipette 50μL of plasmid into each well and add it to the corresponding "transfection reagent + RNA plate" to obtain 200μL / well of transfection complex, and let it stand for about 20 minutes. Use the fully automatic liquid workstation to run the program, pipette 50μL / well of the transfection reagent complex (containing 200μL / well of transfection complex) and add it to 3 cell complex plates, and then add 50μL of cells in 6.1 to each well and put it into the incubator.

[0556] 5) Cell lysis assay

[0557] Take out the cell plate from the CO2 incubator and use a liquid handling station to aspirate and discard 20 μL of the original cell culture medium.

[0558] Add L in the kit to a new 96-well plate and run the program on the fully automated liquid handling station to complete the addition of 75 μL / well of Luciferase Reagent. Leave at room temperature for 20 min, run the program on the fully automated liquid workstation, transfer 75 μL of lysate to the white plate, use an ELISA reader to detect Firefly luciferase, and use a multifunctional ELISA reader to read the Firefly fluorescence value.

[0559] Use the fully automated liquid handling station to run the program, i.e. add 75 μL of Stop& Reagent. Use a microplate reader to detect Renilla luciferase.

[0560] The results are shown in Tables 46 to 49 below.

[0561] Table 46: siRNA sequence positive target plasmid (GPSZRA) inhibition efficiency

[0562]

[0563]

[0564] Table 47: Off-target plasmid inhibition efficiency of the antisense strand seed region of siRNA sequences

[0565]

[0566] Table 48: SiRNA sequence positive strand off-target plasmid inhibition efficiency

[0567]

[0568]

[0569] Table 49: Off-target plasmid inhibition efficiency of the seed region of the sense strand of siRNA sequence

[0570]

[0571] Conclusion: The modified siRNA has a very high on-target rate and an acceptable off-target rate, and is suitable for use as a candidate molecule for drugs.

[0572] Example 13: In vivo activity detection

[0573] This experiment was designed to detect the efficiency of siRNA in knocking out RAGE mRNA and protein in mice.

[0574] In vivo activity detection in RAGE humanized (CDS region) homozygous / RAGE humanized (CDS+3'UTR region) heterozygous mice

[0575] (1) In vivo administration: Commercial RAGE homozygous / heterozygous mice. In the in vivo experiment, each group had 3-4 mice, male, 6-8 weeks old. 3 mg / kg of candidate siRNA molecules were delivered to the lungs by airway administration through a nebulizer needle, and the nebulization volume was 50 ul each time. The mice were anesthetized and killed after 11 or 15 days of treatment. The alveolar lavage fluid (BALF) was first obtained with pre-cooled PBS, and the supernatant was centrifuged to measure the RAGE protein expression level. After perfusion, the lung tissue was obtained and frozen to detect the expression of RAGE at the mRNA level and protein level.

[0576] (2) RNA expression detection: After removing the lung tissue from the body, quickly freeze it in liquid nitrogen and then place it in a -80℃ refrigerator for long-term storage. Use a disposable blade to cut the fresh or ultra-low temperature frozen sample into 20-40 mg blocks and add it to a 1.5 ml sterilized tube, and quickly place it in liquid nitrogen. According to the instructions of the TaKaRa MiniBEST Universal RNA Extraction Kit (Takara: 9767), add the prepared tissue lysis solution, and add magnetic beads to homogenize on a tissue homogenizer. After homogenization, perform the subsequent RNA extraction steps according to the instructions. Use One Step PrimeScript TM RT-PCR Kit (Takara: RR064A) was used to expand the detection of gene expression. Real-time fluorescence PCR was performed in ABIQS5 real-time fluorescence PCR system using ΔΔCt determination method. Three replicate wells were performed for each mouse lung tissue sample. The results of the duplex in vivo activity test are shown in Tables 50-54 below.

[0577] TRiM delivery is the name of the siRNA delivery system developed by Arrowhead. siRNA has a large molecular weight and strong hydrophilicity, making it difficult to penetrate into cells. In order to deliver siRNA to specific tissue cells, a specific small molecule target head is coupled to the end of the positive chain of siRNA through a linker with a specific structure. The small molecule target head can specifically bind to specific receptors (integrin αvβ6) on the target tissue cells, mediate the internalization of the siRNA coupled with the small molecule target head, enter the cell, and further initiate the RNA interference process to exert the drug effect.

[0578] (3) Protein level expression detection: After anesthesia, mice were perfused with pre-cooled PBS to obtain alveolar lavage fluid. The samples were centrifuged at 12000 rpm for 15 min at 4°C, and the supernatant was then collected for protein quantification (Pierce TM BCA Protein AssayKits (Thermo-23225). For the obtained lung tissue, cut the tissue into small pieces, weigh 30-50 mg / tube on a balance, and wash twice with pre-cooled PBS. Add RIPA (containing PMSF) lysis buffer, add magnetic beads and vortex oscillate 3 times, then centrifuge at 4°C, 14000g for 5 minutes to precipitate tissue or cell fragments, transfer the supernatant as total tissue protein, aliquot and store at -80°C. Use Human RAGE ELISA KIT (R&D-DRG00) to detect RAGE protein expression. Two replicate wells were performed for each mouse lung tissue sample. The results of the in vivo activity test of the duplex are shown in Tables 50-54 below.

[0579] Table 50: Knockdown of RAGE mRNA and protein activity in RAGE humanized (CDS region) homozygous mice 15 days after aerosolized airway administration of GPSZRA314S1-VP, GPSZRA314S2-VP, GPSZRA314S3-VP (TRiM delivery)

[0580]

[0581]

[0582] Table 51: Knockdown of RAGE mRNA and protein activity in RAGE humanized (CDS region) homozygous mice 15 days after nebulized airway administration of 314S5-VP (TRiM delivery)

[0583]

[0584] Table 52: Knockdown of RAGE mRNA and protein activity in RAGE humanized (CDS region) homozygous mice 15 days after aerosolized airway administration of GPSZRA222S4-VP, GPSZRA318S2-VP (TRiM delivery)

[0585]

[0586] Table 53: Knockdown of RAGE mRNA and protein activity in RAGE humanized (CDS region) homozygous mice 15 days after aerosolized airway administration of GPSZRA233S4-VP, GPSZRA222S3-VP (TRiM delivery)

[0587]

[0588] Table 54: Knockdown of RAGE mRNA and protein activity in RAGE humanized (CDS+3'UTR region) heterozygous mice 11 days after nebulized airway administration of 402S4-VP (TRiM delivery)

[0589]

[0590] Results: This in vivo experiment showed that VP-modified siRNA could effectively reduce the expression of RAGE mRNA and protein in mice.

[0591] Example 14: In vivo activity detection in cynomolgus monkeys

[0592] This experiment was designed to detect the efficiency of siRNA in knocking down RAGE protein in cynomolgus monkeys.

[0593] Experimental methods:

[0594] (1) Animal enrollment: A male and a female cynomolgus monkey were randomly selected for physical examination of their coat, limbs, mouth and nose, and basic physiological functions. If no abnormalities were found after the examination, the animal was placed in a cage and a two-week animal adaptation period began.

[0595] (2) In vivo administration: Two cynomolgus monkeys were fasted for more than 3 hours before administration. After the animals were anesthetized with Zota (5 mg / kg), endotracheal intubation was performed. The animals were kept in a supine position, and the spray head of the high-pressure sprayer was passed through the endotracheal cannula into the trachea. The test siRNA molecules were sprayed into the trachea at 1.2 mg / kg. After administration, the animals were kept in a semi-recumbent position and returned to the monkey cage after they woke up.

[0596] siRNA was also delivered using TRiM, as described in Example 13.

[0597] (3) BALF sample collection: Before BALF sample collection, the animals must fast for more than 3 hours. After anesthetizing the animals with Zota (5 mg / kg), use a bronchoscope to inject 5 mL of saline into the right lower lung. Gently change the animal's posture to allow the saline to lavage the bronchus, and then try to aspirate the injected saline. Centrifuge (2000×g, 4°C, 5 minutes) to separate the BALF supernatant and cells. The supernatant is the BALF sample, which is stored at -80°C, and the cells are discarded. The end time of tracheal administration is Day 0 (D0), 0h, and the BALF collection time points are before D0 administration, D7, D14, D21, D28, D35, D42, D49, and D56. All samples are frozen at -80°C.

[0598] (4) BALF sample protein level expression detection: BALF supernatant was used to detect RAGE protein expression using Monkey RAGE ELISA KIT (Aimeng Youning Cat No: LV50407M). Two replicate wells were performed for each monkey sample. Two monkeys, one male and one female, were enrolled. The RAGE expression in the female monkey's BALF was too low and could not be detected by the kit. Subsequently, only the RAGE protein knockdown in the male monkey's BALF was tested. The results of the in vivo activity test of the duplex are shown in Table 55 below.

[0599] Table 55: Inhibition of RAGE protein activity in monkeys at different time points after nebulized airway administration of 402S4-VP (TRiM delivery)

[0600]

[0601] Results: This in vivo experiment showed that VP-modified GPSZRA402S4-VP could effectively reduce the expression of RAGE protein in monkeys.

[0602] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes may be made to the details according to all the teachings that have been published, and these changes are within the scope of protection of the present invention. The full scope of the present invention is given by the attached claims and any equivalents thereof.

Claims

1. A small interfering RNA (siRNA) for the expression of the receptor for advanced glycation end products (RAGE) gene, wherein the siRNA comprises a sense strand and an antisense strand, wherein: The antisense strand comprises at least 14 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 4 (e.g., 0, 1, 2, 3 or 4) nucleotides, and the sense strand is at least partially complementary to the antisense strand.

2. The siRNA according to claim 1, wherein The antisense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 2 (eg, 0, 1 or 2) nucleotides.

3. The siRNA according to claim 1 or 2, wherein The sense strand comprises at least 14 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838 by no more than 4 (e.g., 0, 1, 2, 3 or 4) nucleotides; Preferably, the sense strand has a region of at least 85% complementarity with the antisense strand within the 14 consecutive nucleotides; Preferably, the sense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO:420 to SEQ ID NO:838 by no more than 2 (eg, 0, 1 or 2) nucleotides.

4. The siRNA according to any one of claims 1 to 3, wherein The siRNA comprises a blunt end and / or an overhang of 1-4 nucleotides; Preferably, the siRNA comprises an overhang of 1 or 2 nucleotides; Preferably, the overhang is present at the 5' end and / or the 3' end of the antisense strand and / or the sense strand; Preferably, the 3' end of the antisense strand of the siRNA comprises an overhang of 2 nucleotides.

5. The siRNA according to any one of claims 1 to 4, wherein The length of the antisense strand and the sense strand is independently 14 to 30 nucleotides; preferably, the length of the antisense strand and the sense strand is independently 17 to 30 nucleotides; preferably, the length of the antisense strand is 19 to 27 nucleotides; preferably, the length of the sense strand is 17 to 25 nucleotides.

6. The siRNA according to any one of claims 1 to 4, wherein The antisense strand is 21 to 23 nucleotides in length, and the sense strand is 19 to 21 nucleotides in length.

7. The siRNA according to any one of claims 1 to 6, wherein The sense strand has no more than 4 (e.g., 0, 1, 2, 3, or 4) nucleotide mismatches with the antisense strand; Preferably, the sense strand has no more than 2 (eg, 0, 1 or 2) nucleotide mismatches with the antisense strand.

8. The siRNA according to any one of claims 1 to 7, wherein The sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any duplex of GPSZRA001 to GPSZRA419 provided in Table 1; Preferably, the sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any duplex provided in Table 7.

9. The siRNA according to any one of claims 1 to 8, wherein The siRNA contains at least one modified nucleotide.

10. The siRNA according to claim 9, wherein All nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides or nucleotide analogs; Preferably, all nucleotides in the sense strand of the siRNA are modified nucleotides or nucleotide analogs, and all nucleotides in the antisense strand of the siRNA are modified nucleotides or nucleotide analogs.

11. The siRNA according to claim 9 or 10, wherein The modified nucleotide or nucleotide analog is selected from 2'-methoxy nucleotides, 2'-fluoro nucleotides, 5'-(E)-vinyl phosphate modified nucleotides, 2'-deoxyribonucleotides, 2',3'-split ring nucleotide analogs, 2'-fluoroarabino nucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 3'-methoxy nucleotides, 2'-allyl modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate esters, nucleotides containing 5'-phosphate mimetics, diol-modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleic acids, unlocked nucleic acids or glycerol nucleotides.

12. The siRNA according to any one of claims 9 to 11, wherein The nucleotides in the sense strand of the siRNA are selected from at least two of 2'-methoxy nucleotides, 2'-fluoro nucleotides or locked nucleic acids; and / or the nucleotides in the antisense strand of the siRNA are selected from 2'-methoxy nucleotides and 2'-fluoro nucleotides; preferably, the first nucleotide of the antisense strand further comprises a 5'-(E)-vinyl phosphate modification.

13. The siRNA according to any one of claims 9 to 12, wherein The sense strand and / or antisense strand of the siRNA comprises a modified internucleoside linkage; Preferably, the 5' end and / or 3' end of the sense strand independently comprises 1 or 2 phosphorothioate linkages; and / or the 5' end and / or 3' end of the antisense strand independently comprises 1 or 2 phosphorothioate linkages.

14. The siRNA according to any one of claims 9 to 13, wherein The antisense strand of the siRNA comprises the following modification pattern: (1)5'-NmsNfsNmNfNmNfNmNfNmNfNmNmNmNfNmNfNmNfNmsNmsNm-3' (SEQ ID NO: 1409); (2) 5'-NmsNfsNmNmNmNfNmNfNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1410); (3) 5'-NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1411); (4) 5'-VPNmsNfsNmNfNmNfNmNfNmNfNmNmNmNfNmNfNmNfNmsNmsNm-3' (SEQ ID NO: 1423); (5) 5'-VPNmsNfsNmNmNmNfNmNfNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1424); or (6) 5'-VPNmsNfsNmNmNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1425); Among them, Nm is a methoxy-modified nucleotide, Nf is a fluorinated-modified nucleotide, VP is a 5'-(E)-vinyl phosphate-modified nucleotide, and s is a phosphorothioate linkage.

15. The siRNA according to any one of claims 9 to 14, wherein The sense strand of the siRNA comprises the following modification pattern: (1) 5'-NmsNmNfNmNfNmNfNfNfNmNfNmNfNmNfNmNfNmsNf-3' (SEQ ID NO: 1412); (2) 5'-NmsNmNfNmNmNmNfNfNfNmNfNmNfNmNfNmNmNmsNm-3' (SEQ ID NO: 1413); (3) 5'-NmsNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmsNm-3' (SEQ ID NO: 1414); or (5)5'-NmsNmNmNmNfNmNfNfNfNmNmNmNmNmNmNfNmNmNmsNm-3' (SEQ ID NO: 1416); Among them, Nm is a methoxy-modified nucleotide, Nf is a fluorinated-modified nucleotide, N(LNA) is a locked nucleic acid-modified nucleotide, and s is a phosphorothioate linkage.

16. The siRNA according to any one of claims 9 to 15, wherein The antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 839-1123, 1426-1438.

17. The siRNA according to any one of claims 9 to 16, wherein The positive strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1124-1408.

18. The siRNA according to any one of claims 9 to 17, wherein The sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any duplex of GPSZRA084S1 to GPSZRA402S5-VP provided in Table 4; Preferably, the antisense strand comprises a member selected from the group consisting of SEQ ID NOs: 846, 960, 1017, 847, 904, 961, 1018, 1075, 1076, 850, 907, 964, 1021, 1078, 852, 909, 966, 1023, 1080, 913, 970, 1084, 857, 914, 971, 1028, 1085, 1035, 923, 980, 103 7, the nucleotide sequence shown in any one of 1094, 1040, 1097, 930, 878, 935, 992, 1049, 1106, 939, 996, 1053, 1110, 889, 946, 1003, 890, 947, 1004, 1061, 1118, 891, 948, 1062, 894, 951, 1008, and 1065; Preferably, the sense strand comprises a member selected from the group consisting of SEQ ID NOs: 1131, 1245, 1302, 1132, 1189, 1246, 1303, 1360, 1361, 1135, 1192, 1249, 1306, 1363, 1137, 1194, 1251, 1308, 1365, 1198, 1255, 1369, 1142, 1199, 1256, 1313, 1370, 1320, 1208, 1265, 1 the nucleotide sequence represented by any one of 322, 1379, 1325, 1382, 1215, 1163, 1220, 1277, 1334, 1391, 1224, 1281, 1338, 1395, 1174, 1231, 1288, 1175, 1232, 1289, 1346, 1403, 1176, 1233, 1347, 1179, 1236, 1293, and 1350; More preferably, the sequences of the sense strand and the antisense strand of the siRNA are selected from GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA227S2, GPSZRA227S3, GPSZRA227S4, GPSZRA227S5, GPSZRA228S5, GPSZRA231S1, GPSZRA231S2, GPSZRA231S3, GPSZRA231S4, G PSZRA231S5, GPSZRA233S1, GPSZRA233S2, GPSZRA233S3, GPSZRA233S4, GPSZRA233S5, GPSZRA267S2, GPSZRA267S3 , GPSZRA267S5, GPSZRA271S1, GPSZRA271S2, GPSZRA271S3, GPSZRA271S4, GPSZRA271S5, GPSZRA282S4, GPSZRA284S 2. GPSZRA284S3, GPSZRA284S4, GPSZRA284S5, GPSZRA287S4, GPSZRA287S5, GPSZRA301S2, GPSZRA314S1, GPSZRA31 4S2, GPSZRA314S3, GPSZRA314S4, GPSZRA314S5, GPSZRA318S2, GPSZRA318S3, GPSZRA318S4, GPSZRA318S5, GPSZRA3 The sense and antisense strand sequences of any duplex of GPSZRA407S1, GPSZRA407S2, GPSZRA407S4, GPSZRA410S1, GPSZRA410S2, GPSZRA410S3 or GPSZRA410S4.

19. The siRNA according to any one of claims 9 to 17, wherein The antisense strand comprises a nucleotide sequence selected from any one of SEQ ID NOs: 846, 960, 1017, 847, 1018, 1075, 1023, 913, 980, 1040, 878, 935, 992, 1049, 1106, 939, 996, 1053, 946, 1003, 890, 947, 1061, 1118, 948, 1062, 894, 951, and 1065; Preferably, the sense strand comprises a nucleotide sequence selected from any one of SEQ ID NOs: 1131, 1245, 1302, 1132, 1303, 1360, 1308, 1198, 1265, 1325, 1163, 1220, 1277, 1334, 1391, 1224, 1281, 1338, 1231, 1288, 1175, 1232, 1346, 1403, 1233, 1347, 1179, 1236, 1350; More preferably, the sequences of the sense strand and the antisense strand of the siRNA are selected from GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA227S4, GPSZRA227S5, GPSZRA233S4, GPSZRA267S2, GPSZRA284S3, GPSZRA287S4, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S4 provided in Table 4 4. The sense and antisense strand sequences of any duplex of GPSZRA314S5, GPSZRA318S2, GPSZRA318S3, GPSZRA318S4, GPSZRA381S2, GPSZRA381S3, GPSZRA402S1, GPSZRA402S2, GPSZRA402S4, GPSZRA402S5, GPSZRA407S2, GPSZRA407S4, GPSZRA410S1, GPSZRA410S2 or GPSZRA410S4.

20. The siRNA according to any one of claims 9 to 17, wherein The antisense strand comprises a nucleotide sequence selected from any one of SEQ ID NOs: 846, 960, 1017, 847, 913, 980, 878, 935, 992, 1106, 939, 1061, and 1118; Preferably, the sense strand comprises a nucleotide sequence selected from any one of SEQ ID NOs: 1131, 1245, 1302, 1132, 1198, 1265, 1163, 1220, 1277, 1391, 1224, 1346, and 1403; More preferably, the sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any double-stranded complex of GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA267S2, GPSZRA284S3, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S5, GPSZRA318S2, GPSZRA402S4 or GPSZRA402S5 provided in Table 4.

21. The siRNA according to any one of claims 9 to 17, wherein The antisense strand comprises a nucleotide sequence selected from any one of SEQ ID NOs: 1426-1438; Preferably, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1131, 1245, 1302, 1132, 1198, 1265, 1163, 1220, 1277, 1391, 1224, 1346, 1403; More preferably, the sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any double-stranded complex of GPSZRA222S1-VP, GPSZRA222S3-VP, GPSZRA222S4-VP, GPSZRA227S1-VP, GPSZRA267S2-VP, GPSZRA284S3-VP, GPSZRA314S1-VP, GPSZRA314S2-VP, GPSZRA314S3-VP, GPSZRA314S5-VP, GPSZRA318S2-VP, GPSZRA402S4-VP, and GPSZRA402S5-VP provided in Table 4.

22. A conjugate, wherein: The conjugate comprises the siRNA according to any one of claims 1 to 21 and a pharmaceutically acceptable targeting molecule.

23. A pharmaceutical composition, wherein: The pharmaceutical composition comprises the siRNA according to any one of claims 1 to 21 or the conjugate according to claim 22, and a pharmaceutically acceptable carrier and / or excipient.

24. The pharmaceutical composition according to claim 23, wherein The pharmaceutically acceptable carrier is a delivery carrier; preferably, the siRNA is encapsulated by the delivery carrier.

25. Use of the siRNA according to any one of claims 1 to 21, the conjugate according to claim 22 and / or the pharmaceutical composition according to claim 23 or 24 in the preparation of a medicament for treating and / or preventing a disease associated with RAGE; Preferably, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (eg, siRNA targeting a different target sequence in the RAGE gene or siRNA targeting other targets).

26. The use according to claim 25, wherein The RAGE-related disease is a respiratory disease, such as cystic fibrosis, pneumonia, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infection, primary ciliary dyskinesia or lung cancer cystic fibrosis; preferably, the respiratory disease is asthma or chronic obstructive pulmonary disease (COPD).

27. The use according to claim 25, wherein The RAGE-related disease is a neurological disease, such as Alzheimer's disease or stroke.

28. The use according to claim 25, wherein The disease associated with RAGE is a urological disease, such as diabetic nephropathy.

29. The use according to claim 25, wherein The RAGE-related disease is an inflammatory disease or involves inflammation.

30. A method for inhibiting RAGE expression in a cell, the method comprising: Introducing the siRNA according to any one of claims 1 to 18, the conjugate according to claim 22, and / or the pharmaceutical composition according to claim 23 or 24 into a cell; Preferably, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (eg, siRNA targeting a different target sequence in the RAGE gene or siRNA targeting other targets).

31. A method for preventing and / or treating a disease associated with RAGE in a subject, the method comprising administering to a subject in need thereof an effective amount of the siRNA of any one of claims 1 to 22, the conjugate of claim 22, and / or the pharmaceutical composition of claim 23 or 24; Preferably, the RAGE-associated disease is a respiratory disease, such as cystic fibrosis, pneumonia, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infection, primary ciliary dyskinesia, or lung cancer cystic fibrosis; Preferably, the respiratory disease is chronic obstructive pulmonary disease (COPD). Preferably, the RAGE-related disease is a nervous system disease, such as Alzheimer's disease or stroke; Preferably, the RAGE-related disease is a urological disease, such as diabetic nephropathy; Preferably, the RAGE-related disease is an inflammatory disease or involves inflammation; Preferably, the subject is a mammal, such as a human; Preferably, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (eg, siRNA targeting a different target sequence in the RAGE gene or siRNA targeting other targets).

Images