A 5'utr element and its application in improving expression of plant target genes

Abstract

The present application relates to the field of molecular biology and plant biotechnology, and provides a 5'UTR element and its application in improving the expression level of a target gene in plants. The nucleotide sequence of the 5'UTR is shown in SEQ ID NO. 1. By introducing a specific nucleotide sequence, the structure and function of the 5'UTR are optimized, which can promote the stability of the target transcript mRNA, thereby improving the ability of mRNA to translate into protein. This method not only improves the expression level of the target gene, but also provides a new translation regulation strategy for plant genetic engineering. Through this innovative method, more efficient expression of the target gene can be achieved in plants, which has important scientific and application value.

Description

TECHNICAL FIELD

[0001] The present application relates to the fields of molecular biology and plant biotechnology, and particularly relates to a 5'UTR element and its application in improving the expression level of a target gene in plants. BACKGROUND

[0002] In plant genetic engineering, improving the expression level of foreign genes is the key to achieving efficient biological production and improving crop traits. Traditional gene expression regulation methods mainly focus on the selection and optimization of promoters, while the importance of 5'UTR in translation regulation is gradually recognized. 5'UTR not only affects the stability of mRNA, but also plays an important role in the recruitment of ribosomes and the initiation of translation.

[0003] Previous studies have shown that certain specific nucleotide sequences can act as translation regulatory elements, significantly affecting the expression of target proteins. For example, upstream open reading frames (uORFs) in 5'UTR play a key role in regulating translation, and they can regulate the translation of main open reading frames (mORFs) by affecting ribosome scanning and re-initiation. In addition, specific sequence features in 5'UTR, such as poly Atract, can act as internal ribosome entry sites (IRES), promoting cap-independent translation of mRNA.

[0004] However, there is a lack of a simple and effective way to systematically optimize 5'UTR to improve the expression level of genes in plants in the prior art. Therefore, it is of great scientific and application value to develop a new translation regulatory element that can effectively enhance gene expression in plants. Current research progress shows that by optimizing the nucleotide sequence in 5'UTR, the expression level of target genes in plants can be significantly improved, which provides a theoretical basis for the development of new translation regulatory elements. SUMMARY

[0005] Therefore, the present application provides a 5'UTR element that significantly improves the expression level of target genes in plants and its application in improving the expression level of target genes in plants.

[0006] The technical solutions of the present application are as follows:

[0007] In a first aspect, the present application provides a 5'UTR element, the nucleotide sequence of which is shown in SEQ ID NO. 1.

[0008] In a second aspect, the present application provides a nucleic acid molecule encoding a target protein, which includes the 5'-UTR element shown in SEQ ID NO. 1.

[0009] Thirdly, the present invention provides an mRNA transcription vector comprising the aforementioned 5'UTR element or nucleic acid molecule.

[0010] Fourthly, the present invention provides a method for preparing an mRNA transcription vector: cloning the sequence shown in SEQ ID NO.1 into the 5'UTR position of FLUC in a plant dual-luciferase vector, as described in claim 5, characterized in that: using a dual-luciferase expression vector plasmid as plasmid DNA, transforming plant protoplasts using the PEG method, and then extracting total protein containing the target protein.

[0011] Fifthly, this invention provides the application of 5'UTR elements, nucleic acid molecules, or mRNA transcription vectors in the production of plant target proteins.

[0012] Preferably, a dual-luciferase expression vector plasmid is used as the plasmid DNA, and plant protoplasts are transformed using the PEG method. Subsequently, total protein containing the target protein is extracted.

[0013] The 5'UTR element of the present invention and its application in improving the expression level of target genes in plants have the following advantages over the prior art:

[0014] (1) High efficiency: By introducing a specific 5'UTR sequence, this invention can significantly increase the expression level of the target gene and promote the stability of the target transcript mRNA, thereby improving the ability of mRNA to be translated into protein and meeting the needs of biopharmaceutical and agricultural improvement. This high efficiency is not only reflected in the improvement of gene expression level, but also in its improvement of crop quality and stress resistance, thereby improving crop yield and quality.

[0015] (2) Simplicity: This method does not require complex promoter engineering or multiple gene manipulation, is easy to operate, and is suitable for wide application in different plant systems. This simplicity makes the technology easy to implement and reduces the complexity and cost of experimental operations.

[0016] (3) Wide applicability: This translation regulatory element is applicable to a variety of plants, including model plants (such as Arabidopsis thaliana) and economic crops (such as rice, maize, and tobacco). This wide applicability allows the technology to function in different plant systems, meeting diverse research and application needs.

[0017] (4) Environmental friendliness: By optimizing gene expression, dependence on external chemicals is reduced, thereby reducing negative impacts on the environment. This environmental friendliness meets the requirements of sustainable development in modern agriculture. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is a map of the mRNA transcription vectors of the present invention;

[0020] Figure 2 Diagrams showing protease activity (A) and mRNA expression levels in Arabidopsis protoplasts (B);

[0021] Figure 3 The diagram shows the protease activity (A) and mRNA expression level (B) of transformed rice protoplasts.

[0022] Figure 4 Diagrams showing protease activity (A) and mRNA expression levels in maize protoplasts (B);

[0023] Figure 5 The diagram shows the protease activity (A) and mRNA expression level (B) of transformed tobacco protoplasts. Detailed Implementation

[0024] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0025] In eukaryotes, the 5'UTR is crucial for ribosome recruitment of messenger RNA (mRNA) and start codon selection, and plays a significant role in controlling translation efficiency and shaping the cellular proteome. The ribosome initiation complex assembles onto mRNA via cap-dependent or cap-independent mechanisms. Furthermore, secondary structures within the 5'UTR also affect start codon initiation efficiency; strong stem-loop structures immediately downstream of the start codon cause 40S subunit scanning to stall, increasing its "residence time" and thus reducing the likelihood of leakage scanning via near-homologous or AUG triplet structures in harsh environments.

[0026] The core of this invention is to provide a specific 5'UTR sequence and optimize its structure and function. This sequence, acting as a translation regulatory element, promotes the stability of the target transcript mRNA when present at the 5'UTR position of the target gene, thereby enhancing the ability of mRNA to be translated into protein and the expression level of the target gene in plant systems. The design of this sequence is based on a deep understanding of plant mRNA translation mechanisms and aims to optimize ribosome binding and translation efficiency.

[0027] 1. 5'UTR element

[0028] The nucleotide sequence of the 5'UTR element in this embodiment is: CGGGCAGCCTAACTACGGGTACACCCGAAGCTCAAACAATAGGCACACAT (SEQ ID NO.1). Because it contains 50 nucleotides, it will be referred to as "N50-high" for short.

[0029] II. Construction of Dual-Luciferase Expression Vector

[0030] like Figure 1 As shown, this dual-luciferase expression vector mainly contains two expression frameworks: one is RLUC (Renilla luciferase) driven by the 35S promoter; the other is FLUC (Firefly luciferase) driven by the Ubiquitin promoter. The N50-high sequence was cloned into the 5'UTR position of FLUC in the plant dual-luciferase vector to construct the recombinant expression vector. The specific steps are as follows:

[0031] (1) PCR amplification of N50-high sequence

[0032] The N50-high sequence was amplified using PCR technology. Primers and reaction mixture are shown in the table below. Ensure the amplified fragment contains the required restriction enzyme site (BsaI) for subsequent cloning steps.

[0033] PCR primers

[0034] Upstream primer: CCGGTCTCCGATATCGGGCAGCCTAACTACG; Downstream primer: CCGGTCTCCCCCGTATGTGTGCCTATTGTTTG.

[0035] Template sequence (N50-high sequence): CGGGCAGCCTAACTACGGGTACACCCGAAGCTCAAACAATAGGCACACAT.

[0036] Table 1 PCR reaction system

[0037] Ingredients Volume Nuclease-free Water 20 uL Biorun Pfu PCR Mix 25 uL Upstream primer (10 μΜ) 2 uL Downstream primer (10 μΜ) 2 uL Template 1 uL Total volume 50 uL

[0038] Table 2 PCR reaction conditions

[0039] Step Cycle number 94℃ for 3min 1 94℃ for 30sec 30 50℃ for 30sec 30 72℃ for 10sec 30 72℃ for 5min 1 16℃ for 30min 1

[0040] (2) Enzyme digestion of target gene and vector

[0041] The N50-high sequence and the plant dual-luciferase vector were digested using the selected restriction endonuclease BsaI. After digestion, agarose gel electrophoresis was performed, and the target fragment and linearized vector were recovered by gel extraction.

[0042] (3) Connecting the target gene and the vector

[0043] The digested N50-high sequence was ligated to a linearized plant dual-luciferase vector using T4 DNA ligase.

[0044] (4) Transformation of competent cells

[0045] Transform the ligation product into DH5α competent cells: Place 50 μL of competent cells in an ice bath and add 5 μL of the ligation product. Incubate on ice for 30 minutes, then heat shock at 42°C for 90 seconds. Add 500 μL of antibiotic-free LB broth and incubate at 37°C with shaking for 1 hour. Spread 100 μL of the bacterial culture onto a Kana plate and incubate overnight at 37°C.

[0046] (5) Screen positive clones and extract recombinant plasmids.

[0047] Positive clones were screened using a culture medium containing Kana antibiotic. Recombinant plasmids were extracted using alkaline lysis or a kit (such as the OmegaPlasmid Mini Kit) and verified by restriction enzyme digestion and sequencing to ensure that the N50-high sequence was correctly inserted into the 5'UTR position of the FLUC.

[0048] Negative control: The 5' UTR sequence of Arabidopsis thaliana TBF1 shown in SEQ ID NO.2, the specific sequence is as follows:

[0049] TCTAGAAACAGCATCCGTTTTTATAATTTAATTTTCTTACAAAGGTAGGACCAACATTTGTGATCTATAAATCTTCCTACTACGTTATATAGAGACCCTTCGACATAACACTTAACTCGTTTTATATATTTGTTTTACTTGTTTTGCACATACACACAAAAATAAAAAAGACTTTATATTTATTTACTTTTTAATCACACGGATTAGCTCCGGCGAAGTATGGTCGTCGTCTTCATCTTCTTC CTCCATCATCAGATTTTTCCTTTAAATGGAAGAAACCAAACGAAACTCCGATCTTCTCCGTTCTCGTGTTTTCCTCTCTGGCTTTTATTGCTGGGATTGGGAATTTCTCACCGCTCTCTTGCTTTTTAGTTGCTGATTCTTTTTCCTTCGACTTTCTATTTCCAATCTTTCTTCTTCTTTGTGTATTAGATTATTTTTAGTTTTATTTTTCTGTGGTAAAATAAAAAAAGTTCGCCGGAG.

[0050] Positive control: The plant universal translation enhancement element-Omega sequence shown in SEQ ID NO.3, the specific sequence is as follows:

[0051] GCCGGTCTAGAGTATTTTTACAACAATTACCAACAACAACAAACAACAAACAACATTACAATTACTATTTACAATT.

[0052] III. Preparation of Arabidopsis thaliana protoplast cells

[0053] Select healthy, disease-free, and appropriately sized leaves from Arabidopsis plants 3-4 weeks before flowering (when they have 5-7 true leaves), and isolate the protoplasts.

[0054] The isolation method is as follows: Select 10-15 healthy leaves from Arabidopsis thaliana plants, cut them off, and place them in a petri dish or dissecting dish. Use a sharp blade to cut them into thin strips 0.5-1 mm wide; the finer the better to increase enzymatic hydrolysis efficiency. Immediately after cutting, transfer them to the enzymatic hydrolysis solution. 10-15 leaves require 5-10 ml of enzymatic hydrolysis solution, ensuring the leaves are fully immersed. Place the container containing the enzymatic hydrolysis solution in a vacuum pump and evacuate (0.06-0.08 MPa) for 30 minutes to remove air from the interstitial spaces and improve enzymatic hydrolysis efficiency. After evacuation, restore normal pressure. Under light-protected conditions, place the sample on a gyroscope or shaking plate and shake slowly at 50 rpm at room temperature for approximately 3 hours. Observation during the process: Observe the release of protoplasts from the leaf cells using a microscope every 30 minutes. The enzymatic hydrolysis reaction ends when large areas of the mesophyll cell walls dissolve and protoplasts begin to be released in large quantities and appear round.

[0055] The enzymatic hydrolysate consisted of: Cellulase R10 1.5 wt% (final concentration), Macerozyme R10 0.4 wt% (final concentration), Mannitol 0.4 M (final concentration), KCl 20 mM (final concentration), and MES (pH 5.7) 10 mM (final concentration). The pH was adjusted to 5.8, and the solution was heated at 55°C for 10 min. After mixing by inverting the solution three times and cooling to room temperature, CaCl2 10 mM (final concentration) and BSA (Sigma A-6793) 0.1 wt% (final concentration) were added. ddH2O was added to a final volume of 10 mL. The solution was then sterilized by filtration through a 0.22 μm filter membrane and used immediately.

[0056] After enzymatic digestion, add an equal volume of W5 solution to the sample and gently shake the centrifuge tube horizontally for 10 seconds to release the protoplasts. Filter the protoplasts using a 75µm nylon membrane, collect the filtrate in a 50ml round-bottom centrifuge tube, and rinse with W5 solution to minimize protoplast loss. Centrifuge at 100g for 3 minutes to precipitate the protoplasts. After centrifugation, aspirate the supernatant with a 5ml pipette and retain the precipitate. Add an appropriate amount of W5 solution to the precipitated protoplast cells for resuspending, place the centrifuge tube on ice, and incubate for 30 minutes. Centrifuge again, discard the supernatant, retain the precipitate, and resuspend the protoplasts with an appropriate amount of MMG solution.

[0057] The components of solution W5 are: NaCl 154 mM, CaCl2 125 mM, KCl 2 mM, and MES 2 mM. Adjust the pH to 5.7-5.8, and finally add ddH2O to 100 mL; sterilize by filtration through a 0.22 μm filter membrane and store at 4 °C.

[0058] The MMG solution consisted of: Mannitol 0.4M, MgCl2·6H2O 15mM, and MES 4mM. The pH was adjusted to 5.7-5.8, and ddH2O was added to a final volume of 10mL. The solution was then sterilized by filtration through a 0.22μm membrane and stored at 4℃.

[0059] IV. Transformation of Arabidopsis protoplasts and detection of dual-luciferase activity.

[0060] Arabidopsis protoplasts were transformed with plasmids using the polyethylene glycol (PEG) method. Half of the transformed Arabidopsis protoplasts were used for cell lysis to extract proteins, and the activities of FLUC and RLUC enzymes were detected using a microplate reader. The other half of the transformed Arabidopsis protoplasts were used to extract RNA, and the mRNA levels of FLUC and RLUC were detected using real-time quantitative PCR. The results are shown below. Figure 2 .

[0061] like Figure 2 As shown, the N50-high and Omega sequences significantly increased FLUC expression levels compared to the 5'UTR sequence of Arabidopsis thaliana's endogenous TBF1, with N50-high exhibiting stronger translational regulation than Omega. Furthermore, FLUC transcripts containing both N50-high and Omega sequences showed more stable mRNAs compared to the 5'UTR of Arabidopsis thaliana's endogenous TBF1. Similarly, N50-high mediated stronger mRNA stability than Omega.

[0062] V. Comparison of Expression in Different Plants

[0063] (1) Plant species

[0064] Various plant protoplasts were selected as experimental subjects, such as rice, corn, and tobacco. The above three dual-luciferase vectors were transformed into rice protoplasts, corn protoplasts, and tobacco protoplasts, respectively.

[0065] (2) Results of dual-luciferase assay and qPCR assay

[0066] Protoplasts of rice, corn, and tobacco were prepared according to step three. The protoplasts were then transformed according to step four, and dual-luciferase activity was measured. Results are shown in [Figure 1]. Figures 3-5 .

[0067] like Figures 3-4 The results showed that N50-high mediated FLUC translation ability was stronger than Omega and TBF1 in both rice and maize protoplasts. Furthermore, N50-high mRNA exhibited high stability in both rice and maize protoplasts. Figure 5As shown, in tobacco protoplasts, both N50-high and Omega exhibited stronger protein expression levels and mRNA stability compared to TBF1. This result is similar to that in Arabidopsis protoplasts, where N50-high promotes mRNA translation and enhances mRNA stability.

[0068] This invention provides a novel N50-high nucleotide sequence as a translation regulatory element that can significantly enhance gene expression levels in plants. N50-high not only excels in promoting translation but also significantly improves mRNA stability, even surpassing the effectiveness of the commonly used plant translation-enhancing element Omega. This discovery not only provides a new tool for plant genetic engineering but also offers important scientific evidence for understanding the mechanisms of plant translation regulation.

[0069] N50-high, as a translation regulatory element, offers the advantage of significantly enhancing target gene expression levels by optimizing ribosome binding and translation efficiency. Studies have shown that the structure and sequence of the 5'UTR have a significant impact on mRNA stability and translation efficiency. N50-high achieves highly efficient regulation of gene expression by enhancing mRNA stability and promoting efficient ribosome binding. Compared to the traditional translation enhancement element Omega, N50-high exhibits higher efficiency and wider applicability. These advantages make N50-high a promising candidate for broader applications in plant genetic engineering.

[0070] The significance of this invention lies in the fact that it not only provides a new tool to enhance the expression of exogenous genes in plants, but also offers a new perspective for studying plant translation regulation mechanisms. Through further research and application, N50-high is expected to have a wide-ranging impact on the fields of biotechnology and agriculture. For example, in the biotechnology field, it can be used to develop transgenic plants with high expression levels to meet the needs of biopharmaceuticals and agricultural improvement. In the agricultural field, by increasing the expression level of target genes in crops, it can enhance crop resistance and yield, thereby promoting the development of related industries.

[0071] In summary, N50-high, as a novel translation regulatory element, is not only scientifically innovative but also demonstrates broad applicability and significant environmental friendliness. With further research and application, this method is expected to have a profound impact on the fields of biotechnology and agriculture.

[0072] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A 5' UTR element, characterized in that: The nucleotide sequence of the 5'UTR is shown in SEQ ID NO.

1.

2. A nucleic acid molecule encoding a target protein, characterized in that: The nucleic acid molecule includes the 5'UTR element as described in claim 1.

3. An mRNA transcription vector, characterized in that: The carrier comprises the 5'UTR element of claim 1 or the nucleic acid molecule of claim 2.

4. The method for preparing an mRNA transcription vector as described in claim 3, characterized in that: The sequence shown in SEQ ID NO.1 was cloned into the 5'UTR position of FLUC in the plant dual-luciferase vector, and a dual-luciferase expression vector plasmid was constructed.

5. The application of the mRNA transcription vector according to claim 4 in the production of plant target proteins.

6. The application as described in claim 5, characterized in that: Plant protoplasts were transformed using a dual-luciferase expression vector plasmid as plasmid DNA via the PEG method, and then total protein, including the target protein, was extracted.

Images