Construction method and application of LDHA T95A mutant endothelial cell line

Abstract

The invention relates to the field of gene engineering, and discloses a construction method and application of an LDHA T95A mutant endothelial cell line. According to the invention, a gRNA carrier containing targeted LDHA is constructed by utilizing a CRISPR / Cas9 technology, threonine (T) of a 95th basic group of LDHA is subjected to targeted alanine (A) mutation by utilizing ssODN, and a stable LDHA T95A mutant endothelial cell line sensitive to ferroptosis is successfully constructed, so that a specific mechanism of endothelial cell ferroptosis is disclosed, and the application of the endothelial cell line in the field of endothelial cell ferroptosis is promoted. Useful clues are provided for treating cardiovascular diseases caused by endothelial cell ferroptosis, and important application value is achieved.

Description

Technical Field

[0001] The present application relates to the field of genetic engineering, and more specifically, to a method for constructing and applying a LDHA T95A mutant endothelial cell line. Background Art

[0002] After acute myocardial infarction (MI), the most effective treatment strategy is to relieve coronary artery blockage and reperfuse the myocardium through percutaneous coronary intervention (PCI), drug thrombolysis or surgical coronary artery bypass grafting. However, myocardial reperfusion therapy can cause endothelial cell damage, induce myocardial microvascular dysfunction, lead to myocardial no reflow and expansion of myocardial infarction area. Ferroptosis is a new type of programmed cell death, characterized by lipid peroxidation and iron ion accumulation. Myocardial infarction and myocardial reperfusion therapy can induce endothelial cell ferroptosis, which in turn promotes increased vascular permeability, inflammatory cell infiltration and endothelium-dependent vasodilation disorders. Therefore, inhibiting endothelial cell ferroptosis, maintaining endothelial cell function, and protecting the vascular endothelial barrier are crucial in the prevention and treatment of myocardial reperfusion injury.

[0003] Endothelial cells have a small proportion of mitochondria and use anaerobic glycolysis as the main energy supply mode. In hypoxic injury and reperfusion injury, lactate dehydrogenase A (LDHA) expression is upregulated to maintain endothelial cell energy metabolism and promote endothelial cell survival. LDHA is involved in the occurrence and development of various cardiovascular diseases such as atherosclerosis, heart failure, myocardial hypertrophy, and myocardial ischemia-reperfusion injury. In addition, LDHA has the function of inhibiting tumor cell ferroptosis in a micro-oxygen environment, thereby promoting tumors. However, the specific mechanism of LDHA in inhibiting endothelial cell ferroptosis and its role in ischemia-reperfusion injury are still unclear. It is necessary to use stable and effective gene editing tools to edit the endothelial cell LDHA gene, thereby promoting the research progress of LDHA in inhibiting ferroptosis in endothelial cells.

[0004] CRISPR (clustered, regμlarly interspaced, short palindromic repeats) is an immune mechanism from bacteria to degrade invading viral DNA or other exogenous DNA. In this mechanism, the Cas protein (CRISP-associated protein) contains two nuclease domains that can cut two DNA chains separately. Recognition RNA (gRNA) can be expressed through a vector or chemically synthesized and enter the cell together with the Cas9 protein to cut specific DNA sequences, thereby promoting gene deletion or homologous recombination in DNA to achieve gene knockout. If ssODN (single-stranded oligonucleotides) is introduced at the same time to replace the genomic DNA sequence targeted by the gRNA, site-directed mutation of the gene can be achieved.

[0005] Therefore, if CRISPR technology can be used to achieve a stable mutation of LDHA, it will help to further study the molecular mechanism between LDHA and endothelial cell ferroptosis, and provide a theoretical basis for the clinical treatment of myocardial microvascular dysfunction by intervening in endothelial cell ferroptosis. Summary of the invention

[0006] The present invention aims to construct a gRNA vector containing targeted LDHA using CRISPR / Cas9 technology, target the threonine (T) at the 95th base of LDHA to alanine (A) using ssODN, and construct a stable LDHAT95A mutant endothelial cell line that is sensitive to ferroptosis.

[0007] In order to achieve the above invention objectives, this application adopts the following technical solutions:

[0008] In a first aspect, the present application discloses a sgRNA targeting LDHA, comprising:

[0009] sgRNA1 as shown in SEQ ID NO:2 (ACAACTGTAATCTTATTCTG);

[0010] sgRNA2 as shown in SEQ ID NO:3 (TACCTTCATTAAGATACTGA);

[0011] sgRNA3 as shown in SEQ ID NO:4 (CCAAAGATTGTCTCTGGCAA).

[0012] In a second aspect, the present application discloses a method for constructing a gRNA recombinant plasmid, comprising the following steps:

[0013] S1, synthesizing the DNA sequence and complementary sequence of the sgRNA described in the first aspect, and annealing them into double-stranded DNA;

[0014] S2, enzyme digestion and recovery of sgRNA vector GM-24668;

[0015] S3, the DNA sequence and complementary sequence of the sgRNA described in the first aspect are connected to the sgRNA vector GM-24668, transformed, and sequenced.

[0016] Further, in step S1, the DNA sequence and complementary sequence of the sgRNA include:

[0017] The DNA sequence of sgRNA1 is SEQ ID NO: 7 (caccgACAACTGTAATCTTATTCTG) and the complementary sequence is SEQ ID NO: 8 (aaacCAGAATAAGATTACAGTTGTc);

[0018] The DNA sequence of sgRNA2 is SEQ ID NO: 9 (caccgTACCTTCATTAAGATACTGA) and the complementary sequence is SEQ ID NO: 10 (aaacTCAGTATCTTAATGAAGGTAc);

[0019] The DNA sequence of sgRNA3 is SEQ ID NO: 11 (caccgCCAAAGATTGTCTCTGGCAA) and the complementary sequence is SEQ ID NO: 12 (aaacTTGCCAGAGACAATCTTTGGc).

[0020] In a third aspect, the present application discloses a gRNA recombinant plasmid constructed by the construction method described in the second aspect.

[0021] In a fourth aspect, the present application discloses the use of the gRNA recombinant plasmid described in the third aspect in preparing an LDHA T95A mutant endothelial cell line.

[0022] In a fifth aspect, the present application discloses a method for constructing a LDHA T95A mutant endothelial cell line, comprising the following steps:

[0023] S1, transfecting HCMEC cells using the gRNA recombinant plasmid described in the third aspect;

[0024] S2, HCMEC cells were infected with Cas9-expressing lentivirus;

[0025] S3, use the antibiotic Blasticidin to screen positive cells and obtain Cas9 stably transfected cell lines;

[0026] S4, add LDHAgRNA virus and T95AssODN to the selected Cas9 stably transfected cell lines for infection;

[0027] The sequence of the ssODN is shown in SEQ ID NO: 13;

[0028] ATAATGTAACTGCAAACTCCAAGCTGGTCATTATCGCGGCTGGGGCACGTCAGCAAGAGGGAGAAAGCCGTC (SEQ ID NO: 13);

[0029] S5, positive cells were screened using antibiotic Puro to obtain LDHA T95A stable transfected cell line;

[0030] S6, the LDHA T95A stably transfected cell line was subjected to monoclonal processing and sequencing to obtain the LDHA T95A mutant endothelial cell line.

[0031] In a sixth aspect, the present application discloses a ssODN for constructing a LDHA T95A mutant endothelial cell line, wherein the sequence of the ssODN is shown in SEQ ID NO:13.

[0032] ATAATGTAACTGCAAACTCCAAGCTGGTCATTATCGCGGCTGGGGCACGTCAGCAAGAGGGAGAAAGCCGTC (SEQ ID NO: 13).

[0033] In a seventh aspect, the present application discloses a LDHA T95A mutant endothelial cell line constructed by the construction method described in the fifth aspect.

[0034] In an eighth aspect, the present application discloses the use of the LDHA T95A mutant endothelial cell line described in the seventh aspect in gene editing.

[0035] In a ninth aspect, the present application discloses a ferroptosis-sensitive model, wherein the ferroptosis-sensitive model is a LDHA T95A mutant endothelial cell line sensitive to ferroptosis obtained by screening the LDHA T95A mutant endothelial cell line described in the seventh aspect using a ferroptosis inducer.

[0036] In summary, compared with the prior art, the present invention has at least one of the following beneficial effects:

[0037] 1. The CRISPR / Cas9 vector used has higher specificity, higher efficiency, more stable expression efficiency and lower off-target effect than the siRNA and shRNA technologies on the market;

[0038] 2. With the help of CRISPR / Cas9 vector, the constructed gRNA and ssODN targeting LDHA can stably edit, delete and mutate the LDHA gene in human cells in vitro. Once the construction is completed, it can be applied to a variety of cells and experimental models;

[0039] 3. The constructed LDHA T95A gene mutant endothelial cell line has stable genetic characteristics, and its offspring can continue to be used in related research, avoiding repeated cell culture and gene editing, and saving experimental costs;

[0040] 4. The constructed LDHA T95A gene mutant endothelial cell line has been screened by ferroptosis inducers and can be directly used in ferroptosis-related research, which is easy to use;

[0041] 5. The stable LDHA T95A mutant endothelial cell model finally constructed by this invention can improve the reliability of experimental results, help to reveal the specific mechanism of endothelial cell ferroptosis, and provide useful clues for the treatment of cardiovascular diseases caused by endothelial cell ferroptosis, which has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 : Carrier information GM-24668;

[0043] Figure 2 : Figure 2 The top is the endothelial cell monoclonal population, the first generation sequencing result of LDHA wild type, the 95th base is threonine (T); Figure 2 The following is the first generation sequencing result of the endothelial cell monoclonal population and the LDHA T95A mutant, where the 95th base is threonine (T) replaced by alanine (A);

[0044] Figure 3 : After Cas9, LDHA, and ssODN transfection and screening, endothelial cells were monoclonally amplified, and a total of 30 cell groups were selected for Sanger sequencing to detect the amino acid at position 95 of LDHA. The 3, 6, 15, 21, 25, and 29 endothelial cell monoclonal groups were homozygous for the LDHA T95A mutation;

[0045] Figure 4 : LDHA wild type and LDHAT95A mutant (monoclonal strains 3, 6, 15, 21, and 25) were cultured with Erastin (10 μM) for 6 hours, and the cell viability was detected using the CCK8 cell activity detection kit. The results showed that the cell viability of groups 6 and 21 decreased most significantly;

[0046] Figure 5 : LDHA wild type and LDHA T95A mutant (3, 6, 15, 21, 25 monoclonal strains) were cultured with Erastin (10 μM) for 6 hours, and the MDA lipid peroxidation level of cells was detected using the MDA Elisa kit. The results showed that lipid peroxidation damage was most obvious in cells of group 6 and group 25. DETAILED DESCRIPTION

[0047] The scheme and effects of the present application are further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the invention, rather than to limit the invention.

[0048] Example 1: Construction of sgRNA vector targeting LDHA

[0049] Experimental process: First, synthesize the single-stranded DNA oligo of the gRNA sequence, then anneal and pair it to produce a double-stranded DNA oligo, and then directly connect it to the gRNA vector after restriction digestion through the restriction sites contained at both ends; transfer the ligation product into the prepared bacterial competent cells, and send the grown monoclonal colonies to the sequencing company for sequencing identification. The correct clone is the successfully constructed gRNA vector.

[0050] Material: Carrier information GM-24668 ( Figure 1 )

[0051] The vector is linearized by restriction endonuclease and connected to the target gRNA sequence to construct a vector with the target gRNA sequence.

[0052] Reagents:

[0053]

[0054]

[0055] instrument:

[0056] Instrument Name Instrument source Stabilized voltage electrophoresis apparatus Bio-Rad Gel Imager Haimen Qilin Bell Instrument Manufacturing Co., Ltd. Bacteria Shaker Shanghai Yiheng Scientific Instrument Co., Ltd. Bacterial incubator Shanghai Yiheng Scientific Instrument Co., Ltd. PCR instrument Eppendorf High-speed centrifuge Thermo Disposable flat dishes Shanghai Qianchen Biological 1L flask Sichuan Beef 50ml polypropylene tube Corning Pipette Gilson

[0057] method:

[0058] Selection of gRNA target sites:

[0059] For the target gene sequence of the target gene, we used the gRNA sequence design principles provided on the public website (http: / / www.genome-engineering.org) to design multiple target site sequences, and based on our design experience and design software, we evaluated and determined the target with the best kinetic parameters to enter the subsequent experimental process. The target sites are designed as follows:

[0060]

[0061]

[0062] Design of gRNA primers:

[0063] According to the gene sequence, 3 pairs of gRNA oligo single-stranded DNA were designed and synthesized. The oligo sequences are shown in the table below:

[0064] oligo name Oligomeric single-stranded DNA sequence 5' to 3' Primer-NC-T caccgACGGAGGCTAAGCGTCGCAA (SEQ ID NO: 5) Primer-NC-B aaacTTGCGACGCTTAGCCTCCGTc (SEQ ID NO: 6) Primer-T1 caccgACAACTGTAATCTTATTCTG (SEQ ID NO: 7) Primer-B1 aaacCAGAATAAGATTACAGTTGTc (SEQ ID NO: 8) Primer-T2 caccgTACCTTCATTAAGATACTGA(SEQ ID NO: 9) Primer-B2 aaacTCAGTATCTTAATGAAGGTAc (SEQ ID NO: 10) Primer-T3 caccgCCAAAGATTGTCTCTGGCAA (SEQ ID NO: 11) Primer-B3 aaacTTGCCAGAGACAATCTTTGGc (SEQ ID NO: 12)

[0065] Construction of gRNA recombinant plasmid:

[0066] The oligo single-stranded DNA was annealed into double-stranded DNA, and the double-stranded gRNA oligo was inserted into the vector respectively to construct the gRNA recombinant plasmid, which was then transformed into the competent cell Stbl3.

[0067] 1) Annealing of gRNA

[0068] Dilute the primers with sterile TE buffer to a final concentration of 100 μMol. Pipette 10 μl of the upstream and downstream primers, mix them, pipette evenly, and place them in a PCR tube for annealing. The procedure is as follows:

[0069] 95℃ 30s 72℃ 2min 37℃ 2min 25℃ 2min

[0070] After completion, place on ice for a few minutes and connect directly or store in a freezer at -20°C.

[0071] 2) Enzyme digestion and recovery of sgRNA vector

[0072] The enzyme digestion system is as follows:

[0073] CRISPR / Cas9 vector 5μg 10*Buffer 5μl BbI 4μl <![CDATA[ddH2O]]> Make up to 50 μl

[0074] Digest at 37℃ for about 30min. During this period, 0.8% agarose gel can be prepared, and nucleic acid electrophoresis can be performed after the digestion is completed. After the electrophoresis is completed, cut the gel strip containing the target fragment. Use a balance to weigh the total weight and subtract the weight of the empty tube to calculate the weight of the gel. Calculate the volume of the gel based on 100mg being approximately 100μl, and add 3 times the volume of the gel to QG buffer and place it in a 50℃ water bath to melt the gel completely. Shake the EP tube appropriately during this period to accelerate the dissolution of the gel. After the gel is completely melted, add isopropanol equal to the volume of the gel and mix well. Transfer all the above liquids to the filter column and centrifuge at 13000rpm for 30s. Discard the liquid in the tube, add 750μl of PE buffer to the column, and centrifuge for 1min. Discard the liquid in the tube and empty it again for 1min. Change to a new 1.5ml EP tube, add 50μl of EB buffer to the column, centrifuge for 1min, and the centrifuge tube is the recovered vector.

[0075] 3) Connection between sgRNA vector and primer

[0076] The connection system is as follows:

[0077] Recycling carrier 3μl(50ng) Oligo Primers 1μl(0.5μM) T4 DNA ligase buffer 1.5μl T4 DNA Ligase 1μl <![CDATA[ddH2O]]> Make up to 15 μl

[0078] Incubate in a 25°C water bath for 30 min.

[0079] 4) Conversion

[0080] Place the competent cells on ice and wait for them to thaw naturally. Add all the ligation products to the competent cells, place them on ice for 20 minutes, and then heat shock them in a 42℃ water bath for 90 seconds. Then quickly place them on ice for 2-3 minutes. Add 1000μl of LB culture medium without antibiotics and culture them at 37℃, 150rpm and shake for 45 minutes. Centrifuge at 3000rpm for 2 minutes, discard about 850μl of supernatant, blow and disperse the bacterial liquid at the bottom of the tube, add it to the culture dish containing the corresponding resistance, spread it evenly with a sterilized applicator, and invert it in a 37℃ constant temperature incubator for overnight culture.

[0081] 5) Preparation of recombinant plasmid

[0082] Pick several single colonies and perform small-scale shaking culture.

[0083] 6) Sequencing to identify positive clones

[0084] Example 2: Construction of ssODN by ivTRT for LDHA T95A mutation

[0085] 1. The ssODN sequence required for this embodiment is as follows:

[0086] ATAATGTAACTGCAAACTCCAAGCTGGTCATTATCGCGGCTGGGGCACGTCAGCAAGAGGGAGAAAGCCGTC (SEQ ID NO: 13).

[0087] 2. Experimental process:

[0088] Step 1: Amplification of DNA sequence containing T7 promoter;

[0089] Step 2: The process of RNA being transcribed by T7 transcriptase;

[0090] Step 3: Reverse transcription

[0091] Reagent volume ssRNA 1000ng Gene Specific RT Primer x dNTP 1 <![CDATA[RNase free H2O]]> Make up 10ul

[0092] Heat at 65°C for 5 min and cool on ice for at least 2 min;

[0093] Template RNA / Primer mixture 10ul 5*PrimerScript II Buffer 4ul RNase inhibitor 0.5ul RTase 1ul <![CDATA[RNase free H2O]]> Make up 20ul

[0094] Step 4: Digest RNA chains using the RNase H method. Ribonuclease H (RNase H) can specifically degrade RNA chains in RNA-DNA hybrids, and the enzyme will not hydrolyze phosphodiester bonds in single-stranded and double-stranded DNA and RNA.

[0095] Step 5: Product sequencing to determine the quality and purity of the target ssODN sequence.

[0096] Example 3: Construction of a stable LDHA mutant endothelial cell line

[0097] Human micromyocardial endothelial cells HCMECs (Lonza, Sweden) were infected with CRISPR / Cas9 lentivirus, the sgRNA vector prepared in the above examples, and ssODN. The specific steps are as follows:

[0098] (1) The HCMEC cells used were of the P7 generation. HCMECs cells were seeded in a 24-well plate and cultured in an incubator at 37°C and 5% CO2 with ECM microvascular endothelial cell culture medium containing 10% fetal bovine serum, 1% double antibody (streptomycin and penicillin), and endothelial growth factor. Transfection was performed after the cell density reached 70-80%.

[0099] (2) Take out the Cas9 expression lentivirus (Jiman Bio, China), melt it at 4°C, add 25 μl to 100 μml of virus solution / well, add complete cell culture medium to 250 μml / well, and add Polybrene to a final concentration of 5 ug / ml.

[0100] (3) HCMEC cells were infected with the virus solution for 16-24 hours, and the virus infection solution was replaced with fresh culture medium.

[0101] (4) 48 hours after virus infection, the antibiotic Blasticidin (5-50 μg / ml) can be added to screen positive cells. The screening process is to maintain the antibiotic concentration until the cells no longer die and the remaining cells grow normally. During the screening process, in order to maintain the appropriate concentration of Blasticidin antibiotics and cell nutrition, the medium should be changed every 2-3 days to remove dead cells and add antibiotics.

[0102] (5) The blasticidin screening time is 4-7 days, and the surviving cells are Cas9 stably transfected cell lines.

[0103] (6) Add 1-30 MOI of LDHA gRNA virus and T95A ssODN to the selected Cas9 cell line. After 24 hours of virus infection, replace the medium with virus-free ECM medium and continue to culture the cells for 72 hours. Then add antibiotic Puro (1-10 μg / ml) to screen positive cells. During the screening process, in order to maintain the appropriate concentration of Puro antibiotics and cell nutrition, the medium should be changed every 2-3 days to remove dead cells and add antibiotics.

[0104] (7) The Puro screening time is 4-7 days, and the surviving cells are stable cell lines. The above cells are selected and cultured for monoclonal selection, and at least 30 cell clones are screened to extract DNA for PCR amplification. The genotype of LDHA in the monoclonal cell population is detected by first-generation sequencing, and the monoclonal cell population homozygous for the LDHA T95A mutation is screened for subsequent research.

[0105] (8) Experimental results: Figure 2 This is a representative picture of the first generation sequencing of LDHA wild type and LDHA T95A mutant. Figure 3 The results are statistical diagrams of the homozygous group of LDHA T95A mutant cell clones. The results show that 6 cell clones are homozygous group cell lines of LDHA T95A.

[0106] Example 4: Screening for monoclonal endothelial cell lines homozygous for the LDHA T95A mutation that are sensitive to ferroptosis

[0107] (1) continuing to culture and amplify the clone group homozygous for the LDHA T95A mutation in the first generation sequencing;

[0108] (2) The above cells were seeded in a 96-well plate. When the cell density reached 90%, the ECM medium was replaced and Erastin (10 μM, MCE) was added and cultured for 6 hours.

[0109] (3) Erastin-induced ferroptosis was detected using the CCK8 cell viability detection kit (Yazyme, China). 100uL of CCK8 working solution was added to each well and incubated in a cell culture incubator at 37°C for 2 hours. The OD value at 450nm was read by a microplate reader for subsequent statistical calculations.

[0110] (4) Erastin-induced lipid peroxidation was detected using the MDAelisa kit (Wuhan Tri-Tek, China).

[0111] (5) Experimental results: Figure 4 The results showed that clones 6 and 21 were the most sensitive to erastin-induced cell death. Figure 5 The results showed that clones 6 and 25 were the most sensitive to lipid peroxidation induced by Erastin. In summary, clone 6 was the most sensitive endothelial cell line to ferroptosis among the monoclonal clones homozygous for the LDHA T95 mutation.

[0112] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

Claims

1. A sgRNA targeting LDHA, characterized in that: include: sgRNA1 as shown in SEQ ID NO:2; sgRNA2 as shown in SEQ ID NO:3; sgRNA3 as shown in SEQ ID NO:

4.

2. A method for constructing a gRNA recombinant plasmid, characterized in that: The following steps are involved: S1, synthesizing the DNA sequence and complementary sequence of the sgRNA according to claim 1, and annealing them into double-stranded DNA; S2, enzyme digestion and recovery of sgRNA vector GM-24668; S3, the DNA sequence and complementary sequence of the sgRNA of claim 1 are connected to the sgRNA vector GM-24668, transformed, and sequenced.

3. The construction method according to claim 2, characterized in that: In step S1, the DNA sequence and complementary sequence of the sgRNA include: The DNA sequence of sgRNA1 is SEQ ID NO: 7 and the complementary sequence is SEQ ID NO: 8; The DNA sequence of sgRNA2 is SEQ ID NO:9 and the complementary sequence is SEQ ID NO:10; The DNA sequence of sgRNA3 is SEQ ID NO:11 and the complementary sequence is SEQ ID NO:

12.

4. The gRNA recombinant plasmid obtained by the construction method according to claim 2 or 3.

5. Use of the gRNA recombinant plasmid according to claim 4 in preparing an LDHAT95A mutant endothelial cell line.

6. A method for constructing a LDHAT95A mutant endothelial cell line, characterized in that: The following steps are involved: S1, transfecting HCMEC cells using the gRNA recombinant plasmid described in claim 4; S2, HCMEC cells were infected with Cas9-expressing lentivirus; S3, use the antibiotic Blasticidin to screen positive cells and obtain Cas9 stably transfected cell lines; S4, adding LDHA gRNA virus and T95A ssODN to the selected Cas9 stably transfected cell lines for infection; The sequence of the ssODN is shown in SEQ ID NO: 13; S5, positive cells were screened using antibiotic Puro to obtain LDHAT95A stable transfected cell line; S6, the LDHAT95A stable transfected cell line was monocloned and sequenced to obtain the LDHAT95A mutant endothelial cell line.

7. ssODN for constructing LDHAT95A mutant endothelial cell line, characterized in that: The sequence of the ssODN is shown in SEQ ID NO:

13.

8. The LDHAT95A mutant endothelial cell line constructed by the construction method according to claim 6.

9. Use of the LDHAT95A mutant endothelial cell line according to claim 8 in gene editing.

10. Ferroptosis-sensitive model, characterized in that The ferroptosis-sensitive model is a LDHAT95A mutant endothelial cell line sensitive to ferroptosis obtained by screening the LDHAT95A mutant endothelial cell line described in claim 8 using a ferroptosis inducer.

Images