MiRNA simulant for regulating and controlling proliferation and differentiation of large yellow croaker lymphocytes and application of miRNA simulant

Abstract

The invention discloses a miRNA simulant for regulating and controlling proliferation and differentiation of large yellow croaker lymphocytes and application of the miRNA simulant, and belongs to the field of molecular biotechnology and genetic engineering. The miRNA is miR-146a, the miR-146a simulant provided by the invention is synthesized by a positive-sense strand and an antisense strand, the sequence of the positive-sense strand is 5 '-UGAGAACUGAUUCAUAGAUGG-3', and the sequence of the antisense strand is 5 '-AUCUAUGGAUUCAGUUCAU-3'; the miR-146a mimic can remarkably promote proliferation of T and B lymphocytes of the large yellow croaker in vivo and in vitro, promote differentiation of the T lymphocytes of the large yellow croaker to Th1 and Th2 type cells and inhibit differentiation of the T lymphocytes to Th17 type cells, so that the adaptive immune response of the large yellow croaker is enhanced. Therefore, the miR-146a simulant has a potential application value of being developed into a pseudosciaena crocea immunomodulator.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology and genetic engineering, and specifically relates to a miRNA mimic for regulating the proliferation and differentiation of large yellow croaker lymphocytes and an application thereof. Background Art

[0002] MicroRNA (miRNA) is a non-coding RNA of about 22 nt in length that is widely present in eukaryotes and plays a wide range of regulatory roles in various life processes of organisms. In mammals, it has been confirmed that microRNA can participate in regulating the proliferation and differentiation of lymphocytes, but no relevant reports have been seen in fish. Existing literature reports that miR-491 can directly target mouse CD8 + CDK4 (cyclin-dependent kinase 4) and TCF-1 (transcription factor T cell factor 1) in T lymphocytes induce apoptosis, thereby reducing CD8 + In addition, miR-181c, as a negative regulator, can directly control the translation of IL-2 in the body, thereby regulating the expression of human CD4 + miR-155 can promote the activity of CD4 + miR-21 can promote the proliferation of human CD4 + T lymphocytes differentiate into Treg cells.

[0003] MiR-146a is a type of microRNA with extensive regulatory functions, which can participate in regulating the body's inflammatory response, regulating the process of cell apoptosis, and regulating T cell differentiation. Overexpression of miR-146a in mice regulates the activity of NF-κB induced by sepsis, thereby controlling the formation of corresponding inflammatory factors in mice. Increased expression of miR-146a can effectively regulate the release of proinflammatory chemokine IL-8. MiR-146a can also regulate cell apoptosis in various ways. When T lymphocytes are stimulated by antigens, the expression of miR-146a in the cells increases, which can directly target FADD as an anti-apoptotic factor to inhibit cell apoptosis and enhance the activity of T lymphocytes. In the process of human monokines and dendritic cell differentiation, miR-146a expression is upregulated and promotes dendritic cell apoptosis. The expression of miR-146a is high in animal Th1 cells, but it is less expressed in the initial T lymphocytes of human Th2 cells and is expressed in large quantities in memory T lymphocytes. In addition, some researchers have also demonstrated that miR-146a can control the normal response to Th1 by controlling the abnormal activation of STAT1 in Treg cells.

[0004] There have also been many research reports on the function of miR-146a in fish. After Aeromonas hydrophila, Edwardsiella and Salmonella infected zebrafish, the expression of miR-146a in zebrafish increased. After grouper was infected with SGIV, the expression of miR-146a in the body was upregulated, which promoted the replication and growth of SGIV by inhibiting antiviral cell responses such as apoptosis and NF-κB activity. On the contrary, knocking out miR-146a could control the infection of SGIV. In cod in the Atlantic region, miR-146a showed different expressions at different developmental stages under different food feeding, which affected the nutritional effects of the intake of young fish. At present, no miRNA 146a mimics have been used to regulate the proliferation and differentiation of fish lymphocytes. Summary of the invention

[0005] The present invention aims at providing a miRNA mimic capable of regulating the proliferation and differentiation of large yellow croaker lymphocytes and application thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical solution: The present invention provides a miR-146a mimic. The sense strand sequence of the miR-146a mimic is 5'-UGAGAACUGAAUUCCAUAGAUGG-3', and the antisense strand sequence is 5'-AUCUUAUGGAAUUCAGUUCUCAUU -3'.

[0007] The present invention also provides the use of the miR-146a mimic in regulating the proliferation of large yellow croaker T lymphocytes in vivo and in vitro.

[0008] The present invention also provides the use of the miR-146a mimics in regulating the differentiation of T lymphocytes of large yellow croaker in vivo and in vitro.

[0009] Furthermore, the miR-146a mimic promotes the differentiation of large yellow croaker T lymphocytes into Th1 and Th2 cells, and inhibits their differentiation into Th17 cells.

[0010] The present invention also provides the use of the miR-146a mimic in regulating the proliferation of large yellow croaker B lymphocytes in vivo and in vitro.

[0011] The present invention also provides the use of the miR-146a mimic in the preparation of a large yellow croaker immunomodulator.

[0012] The beneficial effects of the present invention are: The present invention is the first to provide a miR-146a mimic that can regulate the proliferation and differentiation of T and B lymphocytes of large yellow croaker in vivo and in vitro. The miR-146a mimic can significantly promote the proliferation of T and B lymphocytes of large yellow croaker in vivo and in vitro, and promote the differentiation of T lymphocytes to Th1 and Th2 types and inhibit their differentiation to Th17, thereby enhancing the adaptive immune response. The miR-146a mimic has the potential application value of being developed into an immunomodulatory drug for large yellow croaker. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The results of miR-146a mimics promoting the proliferation of T lymphocytes in vitro, where * P <0.05,** P <0.01; NC represents negative control, 146a represents miR-146a mimics, NCi represents negative control inhibitor, 146i represents miR-146a specific inhibitor, 146a+NCi represents co-transfection of miR-146a mimics and negative control inhibitor, 146a+146i represents co-transfection of miR-146a mimics and miR-146a specific inhibitor; Figure (A) is the gating selection of cell populations for identifying newly proliferated T lymphocytes (Zap70 + cells); Figure (B) shows the expression of Zap70 in primary lymphocytes of large yellow croaker after transfection with miR-146a mimics and NC. + The proportion of newly proliferating cells; Figure (C) is a bar graph of the data in Figure B; Figure (D) is the expression of Zap70 in lymphocytes after co-transfection of miR-146a mimics with NCi and co-transfection of miR-146a mimics with 146i. + Figure (E) is a bar graph of the data in Figure (C); Figure (F) is the mRNA transcription levels of CD3ζ, TCRα and Zap70.

[0014] Figure 2represents the protein expression level of marker gene Zap70 in lymphocytes 24 h after transfection with NC, 146a, 146a+NCi, and 146a+146i; NC represents negative control, 146a represents miR-146a mimics, NCi represents negative control inhibitor, 146i represents miR-146a specific inhibitor, 146a+NCi represents co-transfection of miR-146a mimics and negative control inhibitor, and 146a+146i represents co-transfection of miR-146a mimics and miR-146aspecific inhibitor.

[0015] Figure 3 The result of miR-146a mimics promoting the proliferation of T lymphocytes in large yellow croaker in vivo; P <0.05,** P <0.01; NC represents NC agomir, 146a represents miR-146a agomir, 146a+NCi represents the simultaneous injection of miR-146a agomir and NC antagomir, and 146a+146i represents the simultaneous injection of miR-146a agomir and miR-146a specific antagomir; Figure (A) is the detection of Zap70 by flow cytometry + EdU in lymphocytes + Flow cytometry scatter plot of cell ratio; Figure (B) shows Zap70 in head kidney cells + EDU + The proportion of T lymphocytes; Figure (C) shows Zap70 in spleen cells + EDU + The proportion of T lymphocytes; Figure (D) shows the mRNA transcription levels of CD3ζ, TCRα and Zap70 in spleen and head kidney lymphocytes after transfection; (E) shows the protein expression level of Zap70 in head kidney cells; (F) shows the protein expression level of Zap70 in spleen cells.

[0016] Figure 4 The results of miR-146a mimics regulating T lymphocyte differentiation of large yellow croaker in vitro; (A) is the transcription level of Th1-related cytokines and transcription factors; (B) is the transcription level of Th2-related cytokines and transcription factors; (C) is the transcription level of Th17-related cytokines and transcription factors; where * P <0.05,** P<0.01; NC represents negative control, 146a represents miR-146a mimics, NCi represents negative control inhibitor, 146i represents miR-146a specific inhibitor, 146a+NCi represents co-transfection of miR-146a mimics and negative control inhibitor, and 146a+146i represents co-transfection of miR-146a mimics and miR-146a specific inhibitor.

[0017] Figure 5 Figure 2 shows that miR-146a mimics regulate the mRNA transcription levels of Th1-related cytokines and transcription factors in the head kidney (A) and spleen (B) of large yellow croaker in vivo; where * P <0.05,** P <0.01; NC represents NC agomir, 146a represents miR-146a agomir, 146a+NCi represents the simultaneous injection of miR-146a agomir and NC antagomir, and 146a+146i represents the simultaneous injection of miR-146a agomir and miR-146a specific antagomir.

[0018] Figure 6 Figure 2 shows that miR-146a mimics regulate the mRNA transcription levels of Th2-related cytokines and transcription factors in the head kidney (A) and spleen (B) of large yellow croaker in vivo; * P <0.05,** P <0.01; NC: NC agomir, 146a: miR-146aagomir, 146a+NCi: miR-146a agomir and NC antagomir were injected simultaneously, 146a+146i: miR-146aagomir and miR-146a specific antagomir were injected simultaneously.

[0019] Figure 7 miR-146a mimics regulate the mRNA transcription levels of Th17-related cytokines and transcription factors in the head kidney (A) and spleen (B) of large yellow croaker in vivo; where * P <0.05,** P<0.01; NC: NC agomir, 146a: miR-146aagomir, 146a+NCi: miR-146a agomir and NC antagomir were injected simultaneously, 146a+146i: miR-146aagomir and miR-146a specific antagomir were injected simultaneously.

[0020] Figure 8 The figure shows the result of miR-146a mimics promoting the proliferation of B lymphocytes in vitro, where * P <0.05,** P <0.01; NC represents negative control, 146a represents miR-146a mimics, NCi represents negative control inhibitor, 146i represents miR-146a specific inhibitor, 146a+NCi represents co-transfection of miR-146a mimics and negative control inhibitor, and 146a+146i represents co-transfection of miR-146a mimics and miR-146a specific inhibitor; Figure (A) shows the proliferation ratio of B lymphocytes after transfection of miR-146a and NC; Figure (B) is a bar graph of the data in Figure (A); Figure (C) shows the proliferation ratio of B lymphocytes after co-transfection of miR-146a mimics and NCi and co-transfection of miR-146a mimics and 146i; Figure (D) is a bar graph of the data in Figure (C); Figure (E) shows the mRNA transcription levels of CD79a, CD79b and IgM genes in lymphocytes.

[0021] Fig. 9 The figure shows the result of miR-146a mimics promoting the proliferation of B lymphocytes in large yellow croaker in vivo; where * P <0.05,** P <0.01; NC represents NC agomir, 146a represents miR-146a agomir, 146a+NCi represents the simultaneous injection of miR-146a agomir and NC antagomir, and 146a+146i represents the simultaneous injection of miR-146a agomir and miR-146a specific antagomir; Figure (A) is the flow cytometry analysis of large yellow croaker IgM + EdU in B cells + Flow cytometric scatter plot of cell ratio; Figure (B) shows IgM in the head kidney + EdU in cells + The proportion of cells; Figure (C) shows IgM in the spleen+ EdU in cells + Figure (D) shows the transcription levels of CD79a, CD79b and IgM after transfection. DETAILED DESCRIPTION

[0022] In order to make the technical solutions and advantages of the present invention more clear, the content of the present invention is described in detail through the following examples, but they should not be regarded as limiting the scope of the present invention.

[0023] The methods used in the implementation of the following cases are conventional methods unless otherwise specified, and the materials used are commercially available unless otherwise specified.

[0024] The sequence of miR-146a in the present invention is 5'-UGAGAACUGAAUUCCAUAGAUGG-3' (SEQ ID NO. 1) In the following example, the sense strand sequence of the miR-146a mimetic is: 5'-UGAGAACUGAAUUCCAUAGAUGG-3' (SEQ ID NO. 1), and the antisense strand sequence is: 5'-AUCUUAUGGAAUUCAGUUCUCAUU-3' (SEQ ID NO. 2).

[0025] In the following examples, the miR-146a agomir, miR-146a specific antagomir, NCagomir and NC antagomir involved, agomir has the same sequence as the miR-146 mimic, and antagomir has the same sequence as the inhibitor. The microRNAs used in this study were synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd.

[0026] Example 1 miR-146a mimics promote the proliferation of T lymphocytes in large yellow croaker After the head kidney of yellow croaker was isolated in vitro, lymphocytes were isolated from it by discontinuous density gradient method. After CFSE staining (which marks the cell nucleus and is halved during cell division), the number of lymphocytes per well was calculated at 2×10 6 The cells were inoculated into six-well plates and transfected with miR-146a mimics after standing for 2 h. The cells were cultured in a 28°C, 5% CO2 incubator for 6 days and then harvested. The total T cells were labeled with a commercial monoclonal antibody against the T lymphocyte marker gene Zap70 (Cell Signal Technology). The expression of Zap70 was then detected by flow cytometry. +The proportion of newly proliferating cells in T lymphocytes was determined to determine the effect of miR-146a on the proliferation of T lymphocytes in vitro. Total RNA was extracted from lymphocytes 24 hours after transfection and reverse transcribed into cDNA for Real-time PCR to detect the changes in mRNA transcription levels of T lymphocyte marker genes CD3ζ, TCRα and Zap70. Total cell protein was extracted from lymphocytes 48 hours after transfection and anti-Zap70 monoclonal antibody was used to detect the expression changes of Zap70 at the protein level. Lymphocytes transfected with Negative Control (NC) were used as the control group, and miR-146a+NCinhibitor and miR-146a+miR-146a specific inhibitor co-transfection groups were set up (detailed sequences are shown in Table 1). The final concentrations of the transfected microRNA and inhibitor were both 80 nM. The results showed that after transfection of miR-146a mimics, Zap70 in primary lymphocytes of large yellow croaker cultured in vitro was significantly increased. + The proportion of newly proliferating cells was 59.8 ± 2.23%, which was significantly higher than that of the lymphocytes in the NC control group transfected with Zap70. + The proportion of newly proliferating cells (47.9 ± 3.14%, P <0.05, Figure 1 BC); After co-transfection of miR-146a mimics and NC inhibitor, Zap70 in lymphocytes + The proliferation rate of Zap70 in lymphocytes of the group co-transfected with miR-146a mimics and miR-146a specific inhibitor was 54.4 ± 2.76%, which was significantly higher than that of Zap70 in lymphocytes of the group co-transfected with miR-146a mimics and miR-146a specific inhibitor. + The proportion of newly proliferating cells (44.4 ± 4.58%, P <0.05, Figure 1 DE); Real-time PCR results showed that 24 h after transfection with miR-146a mimics, the mRNA transcription levels of intracellular T lymphocyte marker genes CD3ζ, TCRα and Zap70 were significantly higher than those in the control group ( P <0.05, Figure 1 F); Western-blot results showed that 24 h after transfection with miR-146a mimics, the expression of the marker gene Zap70 in lymphocytes at the protein level was also higher than that in the control group ( Figure 2 ). These results indicate that miR-146a can promote the proliferation of T lymphocytes in vitro.

[0027] To study the effect of miR-146 on T lymphocyte proliferation in large yellow croaker, miR-146a agomir, miR-146a specific antagomir, NC agomir and NC antagomir (1-2 OD per 100 g of large yellow croaker) were injected intraperitoneally into large yellow croaker, and EdU was injected into large yellow croaker 40 h after injection (250 μg EdU per 100 g of large yellow croaker). After continuing to feed for 8 h, the spleen and head kidney were obtained, and lymphocytes were separated by discontinuous density gradient method. Total T lymphocytes were labeled with anti-Zap70 monoclonal antibody, and intracellular EdU was labeled by Click iT reaction. Finally, flow cytometry was used to detect Zap70. + EdU in T lymphocytes + The ratio of newly proliferated T lymphocytes was the ratio of newly proliferated T lymphocytes. At the same time, part of the lymphocytes were extracted for total RNA reverse transcription into cDNA for Real-time PCR to detect the mRNA transcription changes of T lymphocyte marker genes CD3ζ, TCRα and Zap70. Another part of the lymphocytes were extracted for total cell protein and anti-Zap70 monoclonal antibody was used to detect the expression changes of Zap70 at the protein level. The results showed that after miR-146a agomir stimulation, Zap70 in the head kidney (HK) and spleen (SP) of large yellow croaker was significantly increased. + EDU + The proportions of T lymphocytes were 30.71 ± 2.71% and 31.73 ± 1.76%, respectively, which were significantly higher than those of Zap70 in spleen and head kidney of NC agomir injection control group. + EDU + The proportion of T lymphocytes (18.53 ± 2.34% and 19.65 ± 1.98%, respectively, P < 0.001, Figure 3 BC). Zap70 in the head kidney and spleen of yellow croaker injected with miR-146a agomir and NC antagomir + EDU + The proportions of T lymphocytes were 25.45 ± 2.97% and 31.09 ± 1.70%, respectively, which were significantly higher than those of Zap70 in spleen and head kidney of the group co-injected with miR-146a agomir and miR-146a specific antagomir. + EDU + The proportion of T lymphocytes (18.23 ± 1.77% and 17.41 ± 2.46%, respectively, P < 0.001, Figure 3BC). Real-time PCR results showed that the mRNA transcription levels of CD3ζ, TCRα and Zap70 in spleen and head kidney lymphocytes were significantly higher than those in the NC agomir injection control group after miR-146a agomir stimulation for 48 hours ( Figure 3 D). Western-blot results showed that after miR-146a agomir stimulation, the protein level of Zap70 in head kidney and spleen lymphocytes was also significantly higher than that in the NC agomir injection control group ( Figure 3 EF). These results indicate that miR-146a can significantly promote the proliferation of T lymphocytes in the head kidney and spleen of large yellow croaker at the in vivo level.

[0028] Example 2 miR-146a mimics regulate T lymphocyte differentiation in large yellow croaker The cDNA of each transfection group of in vitro cultured lymphocytes prepared in Example 1 was taken and Real-time PCR was used to detect the expression changes of each T lymphocyte subtype-related gene at the mRNA transcription level to indicate the differentiation of T lymphocytes (the primer sequences used are shown in Table 2). The results showed that 24 hours after transfection with miR146a mimics, Th1-related cytokine IFN-γ and transcription factor T-bet ( Figure 4 A), Th2-related cytokine genes IL-4 / 13A, IL-4 / 13B and transcription factor GATA-3 ( Figure 4 In contrast, the mRNA transcription levels of Th17-related cytokines IL-17A / F2, IL-17A / F3 and transcription factor ROR-γ were significantly downregulated after transfection with miR-146a mimics ( Figure 4 C). This indicates that miR146a can participate in regulating the differentiation of large yellow croaker T lymphocytes in vitro, promoting the differentiation of activated T lymphocytes into Th1 and Th2 cells, while inhibiting their differentiation into Th17 cells.

[0029] To study the effect of miR-146a on T lymphocyte differentiation in vivo in large yellow croaker, each group of microRNA was intraperitoneally injected into healthy large yellow croaker according to the method in Example 1. The head kidney and spleen were taken to isolate lymphocytes at 6 h, 12 h, 24 h and 48 h after injection, and the total RNA was extracted and reverse transcribed into cDNA as a template. The expression of genes related to T lymphocyte subsets such as Th1, Th2, and Th17 was detected to determine the effect of miR-146a on T lymphocyte differentiation at the in vivo level. The results showed that miR-146a can significantly induce the expression of Th1-related cytokine IFN-γ and transcription factor T-bet ( Figure 5The mRNA transcription levels of genes such as Th2-related cytokines IL-4 / 13A, IL-4 / 13B and transcription factor GATA3 were upregulated 6-48 h after stimulation ( Figure 6 However, the mRNA transcription levels of Th17-related cytokines IL-17A / F2, IL-17A / F3 and transcription factor ROR-γ in the head kidney and spleen were significantly decreased after miR-146a stimulation ( Figure 7 These results indicate that miR-146a can promote the differentiation of large yellow croaker T lymphocytes into Th1 and Th2 cells and inhibit their differentiation into Th17 cells in vivo.

[0030] Example 3 miR-146a mimics promote the proliferation of B lymphocytes in large yellow croaker After the head kidney of yellow croaker was isolated in vitro, total lymphocytes were isolated from the head kidney using the discontinuous density gradient method, and then the IgM monoclonal antibody (Huang et al , Fish&Shellfish Immunology, 2019, 91: 216-222) B lymphocytes were sorted by immunomagnetic bead method and CFSE staining was performed at 1-2×10 5 The cells were seeded into 96-well plates, and then transfected with miR-146a mimics after standing for 2 h. After being cultured in a 28°C, 5% CO2 incubator for 6 days, the cells were harvested and washed twice. The proportion of newly proliferated cells in B lymphocytes was detected by flow cytometry to determine the effect of miR-146a on the proliferation of B lymphocytes of large yellow croaker in vitro. Real-time PCR was used to detect the changes in the mRNA transcription levels of B lymphocyte marker genes CD79a, CD79b and IgM 24 h after transfection with miR-146a mimics. Lymphocytes transfected with Negative Control (NC) were used as the control group, and miR-146a+NC inhibitor and miR-146a+miR-146a specific inhibitor co-transfection groups were set up at the same time. The results showed that after transfection with miR-146a mimics, the new proliferation rate of B lymphocytes in vitro cultured for 6 days was 14.93 ± 2.10%, which was significantly higher than the new proliferation rate of B lymphocytes in the transfection NC control group (8.67 ± 0.89%). P <0.05, Figure 8AB); After co-transfection of miR-146a and Negative Control inhibitor, the new proliferation rate of B lymphocytes was 12.18 ± 0.87%, which was significantly higher than that of the co-transfection group of miR-146a and miR-146a specific inhibitor (7.29 ± 0.74%, P <0.05, Figure 8 CD); Real-time PCR results showed that 24 h after transfection with miR-146a mimics, the mRNA transcription levels of CD79a, CD79b and IgM genes in lymphocytes were significantly increased ( P <0.05) was higher than that of the control group ( Figure 8 E, sequence is shown in Table 2). These results indicate that miR-146a can induce the proliferation of B lymphocytes in vitro.

[0031] According to the method in Example 1, miR-146a agomir, miR-146a specific antagomir, NCagomir, NC antagomir and EdU were injected into large yellow croaker, lymphocytes were isolated from the head kidney and spleen, and the IgM in the lymphocytes was detected by using the monoclonal antibody against large yellow croaker IgM. + B lymphocytes were labeled and EdU was simultaneously labeled, and IgM was detected by flow cytometry + EdU in B lymphocytes + The results showed that the spleen and head kidney IgM + EdU in B lymphocytes + The proportions of IgM in spleen and head kidney of miR-146a agomir injection group were 4.35 ± 0.50% and 4.53 ± 1.10%, respectively. + EdU in cells + The proportions of cells in the NC agomir group were significantly higher than those in the NC agomir group, which were 8.46 ± 0.79% and 9.70 ± 2.20%, respectively. Fig. 9 BC); at the same time, spleen and head kidney IgM in the group co-injected with miR-146a agomir and NC antagomir + EdU in B lymphocytes + The proportions of cells were 10.06 ± 1.52% and 6.79 ± 0.99%, respectively, which were significantly higher than those in the co-injection of miR-146a agomir and miR-146a specific antagomir groups (5.48 ± 0.79 and 4.46 ± 0.72%,P <0.01, Fig. 9 BC). Real-time PCR results showed that the transcription levels of B lymphocyte-related genes such as CD79a, CD79b and IgM in spleen and head kidney lymphocytes after miR-146a agomir stimulation were significantly higher than those in other groups ( Fig. 9 D, the primer sequences used are shown in Table 2). These results indicate that miR-146a can significantly promote the expression of IgM in spleen and head kidney of large yellow croaker. + Proliferation of B lymphocytes.

[0032] Table 1 Sequences of miRNA mimics and inhibitors Table 2 Real-time PCR primer sequences The above contents are merely examples and explanations of the present invention. Any modification or supplement made to the described specific embodiments or replacement by similar methods by technicians in the field without creative work still falls within the scope of protection of this patent.

Claims

1. A miR-146a mimic, characterized in that: The sense strand sequence of the miR-146a mimic is 5'-UGAGAACUGAAUUCCAUAGAUGG-3', and the antisense strand sequence is 5'- AUCUAUGGAAUUCAGUUCUCAUU -3'.

2. Use of the miR-146a mimic as described in claim 1 in regulating the proliferation of T lymphocytes of large yellow croaker in vivo and in vitro.

3. Use of the miR-146a mimics as described in claim 1 in regulating the differentiation of T lymphocytes of large yellow croaker in vivo and in vitro.

4. Use of the miR-146a mimics as described in claim 1 in regulating the proliferation of B lymphocytes of large yellow croaker in vivo and in vitro.

5. The use according to claim 3, characterized in that: The miR-146a mimic promotes the differentiation of large yellow croaker T lymphocytes into Th1 and Th2 cells, and inhibits their differentiation into Th17 cells.

6. Use of the miR-146a mimic as claimed in claim 1 in the preparation of a large yellow croaker immunomodulator.

Images