Fish circular RNA with antibacterial infection function, preparation method and application thereof

By preparing biological agents that combine circRNA-AntiB1 cyclic RNA with lipid nanocarriers, the problem of antibiotic abuse in fish farming is solved, effective prevention and control of Vibrio eel is achieved, the risk of bacterial diseases and drug residues are reduced, and sustainable aquaculture is promoted.

CN119709758BActive Publication Date: 2025-08-22SHANGHAI OCEAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510243799.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-03
Publication Date
2025-08-22
Estimated Expiration
2045-03-03

AI Technical Summary

Technical Problem

The use of antibiotics in fish farming has led to the abuse of antibiotics, making it difficult to effectively control the spread and infection of bacterial diseases.

Method used

CircRNA-AntiB1 cyclic RNA is used to combine with lipid nanocarriers to prepare cyclic RNA biological agents, antibacterial drugs and vaccine products for preventing fish bacterial infection.

Benefits of technology

circRNA-AntiB1 circular RNA significantly reduces the number of invading cells of Vibrio eel, reduces the use of fish antibiotics, improves the level of inflammatory factors, reduces the outbreak risk of fish bacterial diseases, protects the ecological environment, and reduces the risk of drug residues and drug-resistant strains.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119709758B_ABST
    Figure CN119709758B_ABST
Patent Text Reader

Abstract

The present invention relates to a fish circular RNA with antibacterial infection function, its preparation method, and application. The circular RNA is circRNA-AntiB1, whose nucleotide sequence is shown in SEQ ID NO:1. The circular RNA is prepared by cyclizing linear circRNA-AntiB1 with T4 RNA ligase 1 and then removing the residual linear RNA in the reaction system using RNase R. The circRNA-AntiB1 prepared by the present invention can effectively inhibit Vibrio infection and can be used in the preparation of Vibrio vaccines, antibacterial drugs, and other biological immune products in the field of aquaculture. It has good stability and good market application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a fish circular RNA with anti-bacterial infection function, and a preparation method and application thereof. Background Art

[0002] Fish pathogens primarily include Gram-negative bacteria that are widely distributed in aquatic environments. These bacteria are common in inland bays, coastal and offshore waters, sediments, and marine organisms. Diseases such as vibriosis cause significant economic losses to marine fisheries. These pathogens, such as Vibrio anguillarum, Vibrio harveyi, and Vibrio parahaemolyticus, have high transmission rates and mortality rates.

[0003] Vibrio anguillarum is a major opportunistic pathogen found widely in the marine environment, including inland bays, coastal and offshore waters, sediments, and marine organisms. This Gram-negative bacterium is well-known for its opportunistic nature and can infect a variety of aquaculture species, including salmon, rainbow trout, eels, sweetfish, sea bass, cod, turbot, flounder, and yellow croaker, posing a serious threat to the global marine aquaculture industry. Vibrio anguillarum has diverse routes of infection, primarily affecting the skin, gills, lateral line, and intestines, and can cause systemic tissue lesions. Different fish species exhibit varying symptoms of infection with Vibrio anguillarum, but the primary symptom is superficial bleeding. For example, the most obvious symptoms of infection in farmed flounder are severe bleeding in the fins and superficial ulcers.

[0004] To effectively control bacterial diseases, the fish farming industry currently utilizes a variety of prevention and control strategies, including antibiotic treatment, vaccination, and biological control. In recent years, circular RNA (circRNA), a novel non-coding RNA molecule, has demonstrated its importance in regulating gene expression and serving as a disease marker. CircRNAs possess a unique closed circular structure and exhibit greater stability and a longer half-life within cells compared to linear RNA. In research on the treatment of bacterial infections, the application of circular RNA technology offers new insights into the interaction between bacteria and hosts and may provide a potential tool for developing new therapeutic strategies. Summary of the Invention

[0005] The present invention provides a fish circular RNA with anti-bacterial infection function, a preparation method and application thereof, and solves the problem of antibiotic abuse caused by the widespread use of large amounts of antibiotics to control bacterial diseases in the fish farming industry.

[0006] The present invention adopts the following technical solution: a fish circular RNA with anti-bacterial infection function, wherein the circular RNA is circRNA-AntiB1, and the nucleotide sequence is shown in SEQ ID NO:1.

[0007] A method for preparing fish circular RNA with anti-bacterial infection function comprises the following steps:

[0008] (1) We analyzed the differentially expressed circRNA sequences in the spleen tissue of croaker infected with Vibrio anguillarum. We designed primers circRNA-AntiB1-F and circRNA-AntiB1-R for PCR amplification to form a double-stranded DNA template. T7 RNA polymerase and the double-stranded DNA template were used for T7 RNA transcription to obtain linear RNA, which was then purified by ethanol precipitation.

[0009] (2) Circularization: Use T4 RNA ligase 1 to circularize the purified linear RNA and purify it;

[0010] (3) RNase R enzyme was used to remove the residual linear RNA, and the circularized RNA was purified again by ethanol precipitation to obtain circRNA-AntiB1.

[0011] Furthermore, the nucleotide sequence of the primer circRNA-AntiB1-F is shown in SEQ ID NO: 2.

[0012] Furthermore, the nucleotide sequence of the primer circRNA-AntiB1-R is shown in SEQ ID NO: 3.

[0013] The invention relates to an application of fish circular RNA with anti-bacterial infection function. The circular RNA is combined with a lipid nanocarrier, and the prepared circular RNA biological preparation can be used as an antibacterial drug and vaccine product to prevent bacterial infection in fish.

[0014] Furthermore, the mass ratio of the circular RNA to the lipid nanocarrier is 1:10.

[0015] Furthermore, the lipid nanocarrier is prepared by mixing MC3, DSPC, cholesterol and DMG-PEG2000 in an ethanol solution at a mass ratio of 5:1:3.8:0.2.

[0016] The present invention has the beneficial effects:

[0017] The circRNA-AntiB1 circular RNA prepared by the present invention has good stability and high purity. The circRNA-AntiB1 circular RNA can significantly reduce the number of Vibrio anguillarum invading cells, significantly reduce the number of Vibrio anguillarum colonizing in fish liver and spleen, and increase the level of inflammatory factors. It can be used in the application of Vibrio vaccines, antibacterial drugs and other biological immune products in the aquaculture industry, can reduce the use of antibiotics in fish, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a diagram of the expression level of circRNA in the spleen tissue of croaker after stimulation with Vibrio anguillarum of the present invention.

[0019] Figure 2 Schematic diagram of the cyclization process of circRNA-AntiB1 of the present invention.

[0020] Figure 3 This is a gel electrophoresis analysis diagram of circRNA-AntiB1 and linear RNA of the present invention.

[0021] Figure 4 This is the activation of the inflammatory factor reporter gene by the circRNA-AntiB1 circular RNA preparation of the present invention.

[0022] Figure 5 This is the effect of the circRNA-AntiB1 circular RNA preparation of the present invention on the expression level of cellular inflammatory factors under Vibrio anguillar infection conditions.

[0023] Figure 6 This is the effect of the circRNA-AntiB1 circular RNA preparation of the present invention on the ability of Vibrio anguillarum to invade cells.

[0024] Figure 7 This is the effect of the circRNA-AntiB1 circular RNA preparation of the present invention on the colonization of Vibrio anguillarum in zebrafish tissues.

[0025] Figure 8 This is a stability test of the preparation of the circRNA-AntiB1 circular RNA of the present invention. DETAILED DESCRIPTION

[0026] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of the present invention.

[0027] Microhyli spleen cells (MSpC cells) were grown adherently in cell culture medium in a constant temperature incubator at 28°C.

[0028] MSpC cells were cultured in L15 medium (HyClone) containing 15% fetal bovine serum, 100 U / ml penicillin, and 100 mg / ml streptomycin. L15 medium containing only 2% fetal bovine serum was used as the cell maintenance medium during bacterial culture. Carp epithelial cells (MSPCs) adhered to the culture medium and cultured in a 5% CO2, 28°C incubator. MSPC cells were cultured in medium 199 (Invitrogen) containing 10% fetal bovine serum, 100 U / ml penicillin, and 100 mg / ml streptomycin.

[0029] The Vibrio anguillarum in the present invention is stored in the National Aquatic Animal Pathogen Bank of the Ministry of Agriculture and Rural Affairs.

[0030] The total RNA extraction kit in the present invention was purchased from Kangwei Century.

[0031] The dual-luciferase reporter kit was purchased from Novozymes.

[0032] Full-length cDNA first-strand synthesis kit (Novozymes).

[0033] Example 1: Effect of Vibrio anguillarum stimulation on circRNA expression levels in spleen tissue of croaker:

[0034] Take a croaker weighing about 50g, inject 0.2ml of Vibrio anguillarum (OD600=0.5) into the abdominal cavity, set up a negative control at the same time, and culture it in a recirculating aquaculture system at a temperature of 28℃.

[0035] After 7 days of culture, the spleens of the intraperitoneally injected croaker were collected and placed in 1.5 ml centrifuge tubes with 1 mm diameter steel beads. 1 ml of Trizol lysis buffer was then added to each well and lysed at room temperature for 10 minutes with shaking. RNA was then extracted using a total RNA extraction kit. The extracted total RNA was used to construct a cDNA library, which was sequenced using the Illumina HiSeq 2500 platform. Clean reads were aligned to the croaker reference genome using TopHat2 software. Unmapped reads were extracted and further aligned to the croaker reference sequence using TopHat software. Junction reads with nonlinear alignment on the same chromosome were considered candidate back-splicing junction reads, and back-splicing junction reads were used to identify and analyze the expression levels of circular RNAs using CIRI software.

[0036] Depend on Figure 1It can be seen that the expression level of circRNA-AntiB1 in the spleen tissue of croaker infected with Vibrio anguillarum was significantly increased, so it can be seen that circRNA-AntiB1 may have the potential to inhibit Vibrio anguillarum infection.

[0037] Example 2: Preparation of circRNA-AntiB1 circular RNA:

[0038] The nucleotide sequence of circRNA-AntiB1 circular RNA is shown in SEQ ID NO: 1.

[0039] The specific steps include:

[0040] (1) First, PCR amplification was performed using primers circRNA-AntiB1-F, sequence SEQ ID NO: 2, and primers circRNA-AntiB1-R, sequence SEQ ID NO: 3 to form a double-stranded DNA template. The specific steps are as follows: circRNA-AntiB1-F 0.5 μL (10 μM), circRNA-AntiB1-R 0.5 μL (10 μM), Taq DNA polymerase Mix 5 μL (2×, Norvegian), and nuclease-free pure water was added to 10 μL. PCR amplification was performed according to the following procedure: pre-deformation at 95°C for 30 s, denaturation at 95°C for 10 s, annealing at 58°C for 10 s, extension at 72°C for 10 s, and complete extension at 72°C for 5 min. The denaturation to extension process was cycled 35 times and stored at 4°C. Transcription of linear RNA was performed using T7 RNA polymerase and the DNA template annealed above. The specific steps are as follows: DNA template 1 μg, T7 transcription buffer 2 μL, NTP 4 μL of the mixture (10 mM) and 0.1 μL of T7 RNA polymerase (1 kU / μl) were added, and the mixture was made up to 20 μL with nuclease-free water and incubated at 37°C for 120 min.

[0041] (2) After the reaction is completed, the transcribed linear RNA is purified using the ethanol precipitation method. The specific steps are as follows: first, add 160 μL of nuclease-free pure water to expand the reaction volume to 180 μL, then add 20 μL of 3M sodium acetate, pH 5.2 or 20 μL of 5M ammonium acetate, and mix thoroughly; add an equal volume of phenol / chloroform mixture with a volume ratio of 1:1 to extract once, vortex mix for 20-30 seconds, then centrifuge at 14000g for 5-10 minutes to obtain the supernatant, and then extract with chloroform 1-2 times, vortex mix for 20-30 seconds each time, then centrifuge at 14000g for 5-10 minutes to obtain the supernatant). Precipitate RNA with double volume of anhydrous ethanol and incubate at -20°C for at least 30 minutes. Centrifuge at 14,000 g for 5-10 minutes at 4°C to precipitate RNA. Discard the supernatant and wash the precipitate with 500 μL of pre-chilled 70% ethanol. Resuspend and dissolve the RNA in 20 μL of nuclease-free water.

[0042] (3) Use T4 RNA ligase 1 to circularize the purified linear RNA. The specific steps are as follows: take 20 μM linear RNA, 2 μL T4 RNA ligase buffer, 1 μL 1 mM ATP, and 1 μL T4 RNA ligase 1, add nuclease-free pure water to 20 μL, incubate at 37°C for 1 hour, and purify the circularized RNA according to the above-mentioned ethanol precipitation method;

[0043] (4) Use RNase R enzyme to remove the residual linear RNA in the above reaction system. Take 20 μL of the above purified RNA and 3 μL of RNase R enzyme buffer, add nuclease-free pure water to 30 μL, incubate at 37°C for 30 minutes, and then purify the circularized RNA according to the above ethanol precipitation method to finally obtain the purified circRNA-AntiB1.

[0044] The process of circRNA-AntiB1 from linear to circular Figure 2 As shown by Figure 2 It can be seen that the linear RNA is formed by reverse splicing of the linker sequence 1 (UUACCACAUUAAAUAUGACGA) and the linker sequence 2 (AUGGAAGA). During the preparation process, the residual linear RNA in the reaction system was removed by RNase R enzyme. Figure 3 As can be seen from the gel electrophoresis diagram, after the linear RNA is treated with RNase R, the RNA band disappears, while the circular RNA band still exists after RNase R treatment, and the concentration is similar to the RNA concentration before RNase R treatment, indicating that circular RNA has been successfully synthesized in the present invention.

[0045] The results are as follows Figure 2 and Figure 3 shown.

[0046] (5) Preparation of circular RNA preparation: MC3, DSPC, cholesterol, and DMG-PEG2000 were mixed in an ethanol solution at a ratio of 5:1:3.8:0.2 to prepare a lipid carrier. The lipid carrier and the circular RNA solution were mixed in a volume ratio of 1:4 through a microfluidic chip to prepare a circular RNA-LNP solution. The mass ratio of circular RNA to nanolipid material was 1:10. Then, ethanol was removed through a tangential flow system to obtain a circular RNA lipid nanoparticle preparation, i.e., a preparation of circRNA-AntiB1 circular RNA.

[0047] Example 3: Effects on the expression levels of inflammatory factors under Vibrio anguillar infection conditions:

[0048] 1. Activation of inflammatory factor reporter genes by circRNA-AntiB1 circular RNA preparation. MSPC cells in the logarithmic growth phase were obtained and digested with trypsin solution. The cells were then diluted with cell culture medium to a cell density of 2.5×10 5 cells / ml to form a cell suspension, which was added to a 12-well cell culture plate at 1 ml / well and cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.

[0049] After culturing the above cells for 24 hours, discard the supernatant in the above 12-well cell culture plate, rinse once with sterile PBS, and then add cell culture medium at 1 ml / well. Add the prepared circRNA-AntiB1 circular RNA preparation into the above MSPC cells. After 24 hours of transfection, discard the supernatant in the above cell culture plate, rinse once with sterile PBS, and then add cell culture medium at 1 ml / well. IL-1β, TNFα and NF-κB inflammatory factor reporter gene plasmids were transfected into the above MSPC cells using Lipofectamine™ 3000 transfection reagent (Thermo Fisher). After culturing the above cells for 48 hours, the fluorescence value in each cell culture well was detected and recorded using a dual luciferase reporter kit. The results are as follows. Figure 4 shown.

[0050] Depend on Figure 4 It can be seen that the circRNA-AntiB1 circular RNA preparation significantly promoted the activation of IL-1β, TNFα and NF-κB inflammatory factor reporter genes. The expression levels of IL-1β, TNFα and NF-κB inflammatory factor reporter genes in cells transfected with the circRNA-AntiB1 circular RNA preparation increased by about 2 times compared with the control group.

[0051] 2. Effect of circRNA-AntiB1 circular RNA preparation on the expression level of cellular inflammatory factors under Vibrio anguillarum infection: MSpC cells in the logarithmic growth phase were digested with trypsin and then diluted with cell culture medium to a cell density of 2.5×10 5 cells / ml to form a cell suspension, which was added into a 12-well cell culture plate at 1 ml / well and cultured in a cell culture incubator at 28°C.

[0052] After 24 hours of cell culture, the supernatant from the 12-well cell culture plate was discarded, the cells were rinsed with sterile PBS, and 1 ml of cell culture medium was added per well. The prepared circRNA-AntiB1 circular RNA preparation was added to the MSPC cells. 24 hours after transfection, the supernatant from the cell culture plate was discarded, the cells were rinsed with sterile PBS, and 1 ml of cell maintenance medium was added per well. 20 μl / well of Vibrio anguillarum (OD600 = 0.5) was added to the cell culture plate containing MSPC cells. A negative control was also set up and the cells were cultured in a cell incubator at 28°C. After 48 hours of culture, the supernatant from the cell culture plate was discarded, and 1 ml of Trizol lysis buffer was added to each well for lysis at room temperature for 10 minutes. RNA was then extracted using a total RNA extraction kit. Total RNA was reverse transcribed using a high-efficiency second-generation full-length cDNA single-strand synthesis kit.

[0053] Then, a universal high-sensitivity dye-based quantitative PCR detection kit and primers were used to detect the mRNA levels of inflammatory factors IL-1β and TNFα.

[0054] IL-1β-RT-1F: 5′-TACGATGGCTAATAACTCC-3′, the nucleotide sequence of which is shown in SEQ ID NO: 5;

[0055] IL-1β-RT-1R: 5'-CATTGACAAAGTGCTCCA-3'; the nucleotide sequence is shown in SEQ ID NO: 6;

[0056] TNFα-RT-1F: 5′-GTTTGCTTGGTACTGGAATGG-3′, the nucleotide sequence of which is shown in SEQ ID NO: 7;

[0057] TNFα-RT-1R: 5'-TGTGGGATGATGATCTGGTTG-3'; the nucleotide sequence is shown in SEQ ID NO: 8;

[0058] The results are as follows Figure 5 shown.

[0059] To verify the effect of circRNA-AntiB1 circular RNA preparation in inhibiting Vibrio anguillarum infection, we first detected the activation of IL-1β, TNFα and NF-κB inflammatory factor reporter genes by circRNA-AntiB1 circular RNA preparation. Figure 4It can be seen that compared with the control group, the IL-1β, TNFα and NF-κB inflammatory factor reporter genes in cells transfected with circRNA-AntiB1 circular RNA preparation were significantly activated. In addition, the effect of circRNA-AntiB1 circular RNA preparation on cellular inflammatory factors after Vibrio anguillarum infection was detected. Figure 5 It can be seen that compared with the control group, the expression levels of inflammatory factors in cells transfected with circRNA-AntiB1 circular RNA preparation increased significantly, with IL-1β increasing to about 2 times the original level and TNFα increasing to about 1.8 times the original level.

[0060] In summary, the circRNA-AntiB1 circular RNA preparation is suitable for the treatment of Vibrio anguillarum infection in fish, can significantly promote the expression of cellular inflammatory factors, and is conducive to the elimination of bacteria.

[0061] Example 4: Effect on the ability of Vibrio anguillarum to invade cells:

[0062] V. anguillarum cells in the logarithmic growth phase were washed three times with sterile LB medium, centrifuged, and diluted with fresh LB medium containing 100 μM FITC-D-Lys. After incubation at 37°C for 30 minutes, the cells were centrifuged, washed three times with sterile PBS, and then resuspended in PBS.

[0063] MSpC cells in the logarithmic growth phase were obtained and digested with trypsin solution. The cells were then diluted with cell culture medium to a cell density of 2.5 × 10 5 cells / ml to form a cell suspension, which was added to a 12-well cell culture plate at 1 ml / well and cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.

[0064] After culturing the cells for 24 hours, the supernatant in the 12-well cell culture plate was discarded, the cells were rinsed with sterile PBS, and then 1 ml / well of cell culture medium was added. The prepared circRNA-AntiB1 circular RNA preparation was added to the MSPC cells. After 24 hours of transfection, the supernatant in the cell culture plate was discarded, the cells were rinsed with sterile PBS, and then 1 ml / well of cell maintenance medium was added. FITC-labeled Vibrio anguillarum OD600 = 0.5 was added to the cell culture plate with MSPC cells at 20 ul / well. A negative control was also set up and the cells were cultured in a CO2 incubator with a CO2 volume content of 5% and a temperature of 28°C. After culturing the cells for 48 hours, the infected cells were washed three times with PBS and fixed by incubation with 0.2% Triton X-100 in 4% paraformaldehyde for 30 minutes at room temperature. After DAPI staining (Beyotime), the number of cells invaded by Vibrio anguillarum was photographed and counted under a Leica DMiL8 fluorescence microscope. The results are shown in Figure 2. Figure 6 shown.

[0065] Depend on Figure 6 It can be seen that after infection with Vibrio anguillarum, the circRNA-AntiB1 circular RNA preparation significantly reduced the number of Vibrio anguillarum-invaded cells. The number of Vibrio anguillarum in cells transfected with the circRNA-AntiB1 circular RNA preparation was reduced by about 90% compared with the control group.

[0066] Example 5: Effect of circRNA-AntiB1 circular RNA preparation on the colonization of Vibrio anguillarum in zebrafish tissues:

[0067] Approximately 4-month-old zebrafish were injected intraperitoneally with the prepared circRNA-AntiB1 circular RNA preparation. A negative control was also set up and cultured in a recirculating aquaculture system at 28°C. After 24 hours of culture, the zebrafish were intraperitoneally injected with 20 μl of Vibrio anguillarum (OD600 = 0.5) and cultured in a recirculating aquaculture system at 28°C.

[0068] After the zebrafish were cultured for 48 hours, liver and spleen tissue samples were collected and placed in different 1.5 ml centrifuge tubes. Sterile 1 mm diameter stainless steel beads were added. 1 ml of sterile PBS solution was added to each tube and then shaken. 1 , 10 2 , 10 3 and 10 4The tissue fragments obtained in the previous step were serially diluted to obtain tissue sample solutions of different concentrations. 10 μl of each dilution gradient sample was dropped onto LB solid medium and inverted and cultured at 37°C. After 16 hours of bacterial culture, the number of Vibrio anguillarum colonies growing on the LB solid medium was observed and recorded to assess the colonization level of Vibrio anguillarum in zebrafish tissues. The results are shown in Figure 2. Figure 7 shown.

[0069] Depend on Figure 7 It can be seen that compared with the control group, the number of Vibrio anguillarum colonizing in the liver and spleen of zebrafish transfected with circRNA-AntiB1 circular RNA preparation was significantly reduced, with the number of Vibrio anguillarum colonizing in the liver reduced by about 80% and the number of Vibrio anguillarum colonizing in the spleen reduced by about 90%.

[0070] In summary, the circRNA-AntiB1 circular RNA preparation is very effective in the treatment of Vibrio anguillarum infection, and can significantly reduce the ability of Vibrio anguillarum to invade cells and colonize tissues, further confirming the therapeutic potential of the circRNA-AntiB1 circular RNA preparation in eliminating Vibrio anguillarum infection.

[0071] Therefore, the circRNA-AntiB1 circular RNA preparation of the present invention can be used in the preparation of fish bacterial vaccines, antibacterial drugs, and other biological immune products in the aquaculture industry. The circRNA-AntiB1 circular RNA preparation can significantly increase the expression level of inflammatory factors in fish, inhibit the invasion and colonization of Vibrio anguillarum, effectively blocking the spread of Vibrio anguillarum in a variety of economically farmed fish, greatly reducing the risk of outbreaks of fish bacterial diseases caused by Vibrio anguillarum infection, effectively protecting the healthy breeding of a variety of economically farmed fish, and thus significantly improving the yield and economic benefits of fish farming.

[0072] Furthermore, in traditional aquaculture, the treatment of bacterial diseases often relies on the extensive use of antibiotics, which not only pollutes the environment but can also lead to drug residues and the emergence of drug-resistant strains. Therefore, the introduction of circRNA-AntiB1 circular RNA agents not only reduces antibiotic usage but also has important practical implications for protecting the ecological environment, reducing drug residues, and lowering the risk of drug-resistant strains. The application of this innovative technology offers new possibilities for achieving sustainable aquaculture.

[0073] Example 6: Stability test of circRNA-AntiB1 circular RNA preparation:

[0074] Assay method: MSpC cells in the logarithmic growth phase were taken and digested with the corresponding digestion solution, and then diluted with cell culture medium to a cell density of 2.5×10 5The cell suspension was added to a 12-well cell culture plate at 1 ml / well and cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.

[0075] After 24 hours of cell culture, the supernatant in the 12-well cell culture plate was discarded, the cells were rinsed with sterile PBS, and then 1 ml of cell culture medium was added per well. The prepared circRNA-AntiB1 circular RNA preparation was transfected into the above-mentioned MSpC cells, and 5 replicate wells were transfected. After 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, and 96 hours of transfection, cells from each well were selected, the supernatant in the well was discarded, the cells were rinsed with sterile PBS, and then 1 ml of Trizol lysis buffer was added for lysis at room temperature for 10 minutes, and then RNA was extracted using a total RNA extraction kit.

[0076] Total RNA was reverse transcribed using a full-length cDNA single-strand synthesis kit. CircRNA-AntiB1 levels were then detected using a universal high-sensitivity dye-based quantitative PCR detection kit and primers. The results are shown in Figure 2. Figure 8 As shown:

[0077] circRNA-AntiB1-RT-1F: 5'-ACCACATTAAATATGACGAATG-3', the nucleotide sequence is shown in SEQ ID NO: 9;

[0078] circRNA-AntiB1-RT-1R: 5'-GCTGAACTACAAGAAACACCG-3', the nucleotide sequence is shown in SEQ ID NO: 10.

[0079] Depend on Figure 8 The results showed that the relative levels of the synthesized circRNA-AntiB1 circular RNA preparation were tested 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, and 96 hours after transfection into MSpC cells. The circRNA-AntiB1 circular RNA preparation showed almost no degradation within 48 hours of transfection, began to degrade after 60 hours of transfection, and was approximately 40%-50% degraded after 96 hours of transfection. Therefore, it can be seen that the half-life of the circRNA-AntiB1 circular RNA preparation in MSpC cells is approximately 96 hours, showing good stability.

[0080] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. Such changes and modifications are intended to fall within the scope of the present invention. The scope of protection claimed in the present invention is defined by the appended claims and their equivalents.

Claims

1. A fish circular RNA with antibacterial infection function, characterized by: The circular RNA is circRNA-AntiB1, and the nucleotide sequence is shown in SEQ ID NO:

1.

2. A method for preparing fish circular RNA with antibacterial infection function according to claim 1, characterized in that: The steps include: (1) The differentially expressed circRNA sequences in the spleen tissue of croaker infected with Vibrio anguillarum were analyzed, and primers circRNA-AntiB1-F and circRNA-AntiB1-R were designed for PCR amplification to form a double-stranded DNA template. T7 RNA polymerase and the double-stranded DNA template were used for T7 RNA transcription to obtain linear RNA, which was purified by ethanol precipitation. The nucleotide sequence of the primer circRNA-AntiB1-F is shown in SEQ ID NO: 2, and the nucleotide sequence of the primer circRNA-AntiB1-R is shown in SEQ ID NO: 3; (2) Circularization: Use T4 RNA ligase 1 to circularize the purified linear RNA and purify it; (3) RNase R enzyme was used to remove the residual linear RNA, and the circularized RNA was purified again by ethanol precipitation to obtain circRNA-AntiB1.

Citation Information

Patent Citations

  • Novel circular RNA, preparation method thereof and circular RNA medicine for treating phenylketonuria

    CN118813649A

  • Fish circRNA and application thereof

    CN119432846A