Application of gene CsDMP in cucumber haploid breeding

Abstract

The invention discloses an application of a gene CsDMP in cucumber haploid breeding. According to the invention, the parthenogenesis haploid induction gene CsDMP is cloned from cucumber. CsDMP is mutated by using a CRISPR-Cas9 gene editing technology, and an obtained csdmp mutant is used as a male parent to be hybridized with other cucumber materials, so that parthenogenetic haploids can be generated. The parthenogenesis haploid induction line is developed on cucumbers for the first time, application of the haploid induction line in cucumber genetic breeding is achieved, the cucumber breeding process is accelerated, and the application value and the market prospect are huge.

Description

Technical Field

[0001] The invention relates to the fields of agricultural biotechnology and plant genetic breeding, and in particular to the application of gene CsDMP in cucumber haploid breeding. Background Art

[0002] Cucumber (Cucumis sativus L.) is an important horticultural crop of the Cucurbitaceae family that is widely planted worldwide and has rich nutritional and economic value. At the same time, cucumber is also one of the important vegetable crops in my country. According to FAO statistics, in 2021, the total area of ​​cucumber cultivation in my country was 19.357 million mu, and the total output was 75.548 million tons, accounting for 5.52% and 12.44% of the total area and total output of vegetables in my country, respectively. In view of the important position of cucumber in my country's agricultural production, the cultivation of high-yield, high-resistant and high-quality new cucumber varieties is the main goal of market demand. At present, cucumber breeding is still dominated by traditional methods, and it takes many generations to obtain stable genetic breeding materials, which seriously hinders the genetic breeding process of cucumber. Haploid breeding technology can obtain stable genetic homozygous materials in only two generations, which is one of the important technical means of modern plant breeding. Although cucumber haploid breeding technology has been adopted in small quantities, it is mainly based on in vitro haploid induction. This in vitro haploid induction method is easily affected by factors such as genotype and culture conditions, resulting in very low haploid induction efficiency. However, no haploid induced line for in vivo parthenogenetic haploid induction has been developed in cucumber. In addition, although gene editing technology has been successfully applied in cucumber, it has not yet been combined with haploid breeding technology in cucumber genetic breeding. Summary of the invention

[0003] The purpose of the present invention is to provide application of gene CsDMP in cucumber haploid breeding.

[0004] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides the use of the gene CsDMP in haploid breeding of cucumber.

[0005] In the present invention, the gene CsDMP is a gene encoding the following protein (a) or (b):

[0006] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2; or

[0007] (b) A protein derived from (a) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 2.

[0008] The CDS sequence of gene CsDMP is as follows:

[0009] i) the nucleotide sequence shown in SEQ ID NO: 1;

[0010] ii) a nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence expresses a protein with the same function;

[0011] iii) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO: 1 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS at 65°C, and the membrane is washed with the solution; or

[0012] iv) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses a protein with the same function.

[0013] Furthermore, the application includes: using genetic engineering means to transform the cucumber gene CsDMP so that the function of the gene is absent or weakened.

[0014] The method of gene modification can be selected from at least one of mutagenesis, site-directed mutagenesis, homologous recombination, etc.

[0015] In a second aspect, the present invention provides a method for constructing a cucumber parthenogenetic haploid induction line, which utilizes genetic engineering means to knock out the cucumber gene CsDMP, or silence or inhibit the expression of the cucumber gene CsDMP, to obtain positive transgenic plants, namely, the cucumber parthenogenetic haploid induction line.

[0016] Furthermore, the method of gene knockout, silencing or inhibition can be selected from at least one of CRISPR / Cas9, TALEN gene editing technology, EMS mutagenesis, T-DNA insertion, etc.

[0017] The knockout of the CsDMP gene is to reduce the expression level of CsDMP in the cucumber genome or to cause base insertion, deletion or substitution mutation in the CsDMP gene in the cucumber genome.

[0018] Preferably, the cucumber gene CsDMP is knocked out using CRISPR / Cas9 gene editing technology.

[0019] The method comprises: taking the gene CsDMP as a target, designing a sgRNA sequence based on CRISPR / Cas9, connecting a DNA fragment containing the encoding sgRNA sequence to a vector carrying CRISPR / Cas9 (such as a pKSE402 vector), and transforming cucumber.

[0020] Preferably, the nucleotide sequence of the sgRNA action site is 5'-GCTTCTGCCGTCGGTCTCC-3' and 5'-ACGGGATCGTGACGCCCAG-3'.

[0021] In a third aspect, the present invention provides the use of the transgenic plant obtained according to the method in cucumber breeding.

[0022] Breeding methods include, but are not limited to, transgenic, hybridization, backcrossing, selfing, or asexual reproduction.

[0023] In a fourth aspect, the present invention provides a method for preparing and identifying haploid cucumbers. The preparation method of a cucumber haploid induction line comprises: knocking out the cucumber CsDMP gene, and obtaining a positive transgenic plant, which is a cucumber haploid induction line. The cucumber haploid induction line obtained by the above method or its self-pollinated offspring is used as a male parent, hybridized with other cucumber materials, and the obtained hybrid offspring is subjected to haploid phenotype identification, fluorescent marker identification, or ploidy type identification, and the hybrid offspring plant identified as a haploid by at least one method is selected, which is the cucumber parthenogenetic haploid.

[0024] The present invention discloses for the first time the biological function of the gene CsDMP, which is a parthenogenetic haploid induction gene for cucumber, and uses gene editing technology to knock out the CsDMP gene to create a parthenogenetic haploid induction line for cucumber. Further, hybridization experiments successfully prove that the mutation of the CsDMP gene can induce the production of parthenogenetic haploids in cucumber. The present invention successfully develops a haploid induction line for cucumber for the first time, which is of great significance in improving the haploid breeding efficiency of cucumber and accelerating the breeding process of cucumber, and has great application value and market prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The fruit and seed phenotype diagram of the wild-type cucumber and csdmp mutant in the preferred embodiment of the present invention. Among them, A, C and D are mature cucumber fruits and seeds of wild-type diploid; B, E and F are mature cucumber fruits and seeds of csdmp mutant; G and H are statistics of the number of seeds of wild-type diploid and csdmp mutant. * and ** indicate that the differences between different treatment groups are statistically significant, * indicates P<0.05, and ** indicates P<0.01. Among them, aborted seeds refer to seeds that have not formed normal embryos, which is a normal phenotypic statistic.

[0026] Figure 2 This is a phenotype comparison diagram of diploid cucumber and haploid cucumber plants and organs.

[0027] Figure 3 This is the result of fluorescence screening of cucumber haploid seeds.

[0028] Figure 4This is the flow cytometry test result of cucumber diploid and haploid plants. DETAILED DESCRIPTION

[0029] The present invention provides a method for creating a cucumber parthenogenetic haploid induction line by utilizing gene editing technology, and particularly relates to the application of a mutated csdmp gene as a parthenogenetic haploid induction line in inducing cucumber to produce parthenogenetic haploids.

[0030] The present invention adopts the following technical solution:

[0031] The invention provides a method for preparing a cucumber parthenogenetic haploid induction line. The method comprises: knocking out a CsDMP gene or silencing or inhibiting the expression of CsDMP to obtain a positive transgenic plant, namely, the cucumber parthenogenetic haploid induction line.

[0032] In the method, the knockout is to cause base insertion, deletion or substitution mutation in the CsDMP gene in the cucumber genome, or the silencing or inhibition is to reduce the expression level of the CsDMP gene in the cucumber genome.

[0033] In the method, the method for knocking out CsDMP in the cucumber genome includes CRISPR / Cas9, EMS mutagenesis, T-DNA insertion or TALEN.

[0034] In the method, the manner of silencing or inhibiting the reduction of CsDMP expression level in the cucumber genome includes RNAi interference, promoter mutation or VIGS interference.

[0035] Furthermore, the method for causing base insertion, deletion or substitution of CsDMP in the cucumber genome is CRISPR / Cas9 gene editing technology.

[0036] Furthermore, the target sequence of the CRISPR / Cas9 is positions 201-219 and / or positions 344-362 of SEQ ID NO:1.

[0037] In a specific embodiment of the present invention, the method for causing base insertion, deletion or substitution mutation in the CsDMP gene in the cucumber genome comprises the following steps: introducing the CsDMP target sequence into a CRISPR / Cas9 vector, and then introducing the vector into the cucumber genome to obtain positive transgenic plants.

[0038] The present invention also provides a method for preparing cucumber parthenogenetic haploids, the steps of which are as follows: the cucumber parthenogenetic haploid induced line obtained by the above method is used as a male parent and hybridized with other cucumber materials to obtain hybrid offspring, which is the cucumber parthenogenetic haploid.

[0039] Furthermore, the step of identifying the parthenogenetic haploid cucumber obtained above includes: performing haploid phenotype identification, fluorescent marker identification or ploidy identification on the hybrid offspring individual plants, and selecting the hybrid offspring plants identified as haploid by at least one method, which is the parthenogenetic haploid cucumber.

[0040] The haploid phenotype identification method refers to the following method: if the individual plant of the hybrid offspring shows characteristics such as dwarfism, smaller leaves and flower organs, and male sterility, then the individual plant is a candidate or haploid plant; if the hybrid offspring has normal plant height, normal development of leaves and flower organs, and normal pollen activity, then it is considered a normal diploid plant.

[0041] The haploid fluorescent marker identification method comprises the following steps: a fluorescent protein EGFP expression frame is included in the CRISPR / Cas9 vector containing the CsDMP target sequence, and the newly harvested hybrid offspring seeds are further subjected to haploid screening by fluorescent irradiation. If the seeds to be tested have no green fluorescence, they are considered candidate haploids; if the seeds to be tested show green fluorescence, they are heterozygous diploids.

[0042] The haploid ploidy identification method can be performed as follows: extract the nucleus from the young leaves of the hybrid offspring to be tested, and detect the ploidy signal using a flow cytometer. Take the diploid plant as a reference and detect its nuclear signal, set the diploid nuclear signal peak value at 100, if the nuclear signal peak value of the plant to be tested is at 50, it indicates that the plant is a haploid plant; if the nuclear signal value of the plant to be tested is at 100, the plant is a diploid plant.

[0043] The present invention further provides an expression cassette containing the cucumber CsDMP gene.

[0044] The present invention further provides a recombinant expression vector containing the cucumber CsDMP gene.

[0045] The present invention further provides an engineering bacterium or a transgenic cell containing the cucumber CsDMP gene or a recombinant expression vector.

[0046] The present invention provides the use of the cucumber CsDMP gene or the protein encoded by the gene in creating a cucumber parthenogenetic haploid induction line.

[0047] The present invention further provides the use of the cucumber CsDMP gene or a mutant of a protein encoded by the gene in inducing haploid parthenogenesis in cucumber.

[0048] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions.

[0049] The cucumber materials used in the following examples are Xintai Michelia, Changchun Michelia and 3407, which are from the cucumber genetic improvement research group of China Agricultural University, see Plant Physiology (Chen et al., 2016, 171: 1156-1168 and Feng et al., 2023, doi.org / 10.1093 / plphys / kiad236), and are publicly available to the public (for scientific research and teaching purposes only).

[0050] The pKSE402 vector was donated by Professor Huang Sanwen from the Shenzhen Agricultural Genomics Institute of the Chinese Academy of Agricultural Sciences.

[0051] Example 1 Preparation of Cucumber CsDMP Gene Knockout Mutant

[0052] 1. Selection of gRNA target site sequence

[0053] Two specific target site sequences were designed on the exons of cucumber CsDMP gene, and the length of each target site sequence was 19 bp.

[0054] The first target site sequence is located at positions 201-219 of SEQ ID NO: 1, and the sequence of the sgRNA1 target site is 5'-GCTTCTGCCGTCGGTCTCC-3'.

[0055] The second target site sequence is located at positions 344-362 of SEQ ID NO: 1, and the sequence of the sgRNA2 target site is 5'-ACGGGATCGTGACGCCCAG-3'.

[0056] 2. Construction of CRISPR / Cas9 vector

[0057] The CRISPR / Cas9 vector is a recombinant vector obtained by connecting the first target site sgRNA1 sequence and the second target site sgRNA2 sequence to the pKSE402 vector.

[0058] 3. Obtaining CsDMP transgenic plants

[0059] The successfully constructed CRISPR / Cas9 vector plasmid was delivered to Agrobacterium competent cells GV3101 by chemical transformation to obtain the recombinant strain GV3101 (CRISPR / Cas9). The recombinant Agrobacterium was then used to infect cucumber cotyledons and delivered to cucumbers. The positive transgenic cucumber plants were initially screened by green fluorescent marker screening in the new shoots cultured after differentiation.

[0060] 4. Targeting identification of transgenic plants

[0061] The primers for targeting identification cloning and sequencing of CsDMP transgenic were designed: CsDMP-CR-F: AACGAAGAAACCCCCCTCCTCC and CsDMP-CR-R: CCATTACAGACATAATGGCGTGAAC. Subsequently, the T0 transgenic plants obtained by this pair of primers were cloned, the products were purified and connected to the pToPo vector, and single clones were picked for Sanger sequencing, and the sequencing results were compared with the wild-type CsDMP gene sequence. The genotype of CsDMP transgenic plants was identified according to the following principles: if the sequencing results only showed wild-type sequences, it was considered that there was no targeting editing; if the sequencing results showed both wild-type sequences and sequences with mutations, the strain was a heterozygous mutant plant; if the sequencing results showed only mutant sequences but no wild-type sequences, the strain was a homozygous mutant plant.

[0062] The identification results are shown in Table 1. Among the five T0-generation cucumber transgenic plants, one plant did not undergo mutation, three plants underwent heterozygous mutations, and one plant underwent biallelic mutations.

[0063] Table 1 Targeting identification results of cucumber CsDMP transgenic plants T0 generation

[0064]

[0065]

[0066] Among the T0 generation transgenic plants obtained, there is a T0-2 mutant strain, whose specific mutations are as follows: Sequencing results show that compared with the wild-type CsDMP gene sequence in the cucumber genome, in the CsDMP gene of the T0-2 strain, one base A is inserted on one chromosome, and the position of base A insertion is between positions 359 and 360 of SEQ ID NO: 1, and the other chromosome has not mutated.

[0067] In addition, another transgenic T0-5 mutant strain has the following mutation type: according to the sequencing results, compared with the wild-type CsDMP gene sequence in the cucumber genome, in the CsDMP gene of the T0-5 strain, one base A is inserted on one chromosome, and the position of base A insertion is between positions 359 and 360 of SEQ ID NO:1; another chromosome has a 142-base deletion mutation, and its position is between positions 217 and 358 of SEQ ID NO:1.

[0068] 5. Genotype identification of T2 cucumber CsDMP transgenic

[0069] The T0 generation mutant plants T0-2 and T0-5 in step 4 were self-pollinated, and after harvesting the T1 generation seeds, the seeds with green fluorescence were screened and sown for targeting identification (the identification method was the same as that in step 4). The targeted plants were further self-pollinated and T2 generation seeds were harvested, and the lines with all green fluorescence and homozygous mutations were selected (the green fluorescence was used for subsequent haploid screening, and the target mutation identification method was the same as that in step 4) as the cucumber parthenogenetic haploid induced lines.

[0070] After identification, it was finally determined that strains T1-2-2, T1-2-10, T1-2-11 and T1-5-2 were strains with green fluorescent markers and homozygous mutations. The mutation types of each strain are as follows:

[0071] Sequencing identification and analysis showed that compared with the wild-type cucumber CsDMP gene sequence, the homozygous mutant strains of T1-2-2, T1-2-10, and T1-2-11 had one base A inserted in the gene encoding the CsDMP protein, and the insertion site was located between positions 359 and 360 of SEQ ID NO:1.

[0072] Sequencing analysis revealed that compared with the wild-type cucumber CsDMP gene sequence, the homozygous mutant strains of T1-5-2 had a 142-base deletion in the gene encoding the CsDMP protein, and the deletion site was located between positions 217 and 358 of SEQ ID NO:1.

[0073] Example 2 Application of CsDMP gene knockout mutant in haploid induction of cucumber parthenogenesis

[0074] 1. Fruit seed setting rate and development of cucumber CsDMP knockout mutants

[0075] Compared with the wild-type cucumber material Xintai Mici, the number of fruit seeds of CsDMP knockout plants was significantly reduced, and the proportion of undeveloped seeds in the fruits of knockout plants was significantly higher than that of the corresponding wild-type ( Figure 1 ). This indicates that CsDMP mutation will reduce the seed setting rate of cucumber seeds and prevent the seeds from developing normally.

[0076] 2. Identification of the ability of CsDMP gene knockout mutants to induce haploid production in cucumber

[0077] The CsDMP homozygous knockout lines T1-2-2, T1-2-10, T1-2-11 and T1-5-2 were used as male parents to cross with different cucumber materials Changchun Mici and 3407, and the haploid phenotypes of the obtained hybrid offspring were identified:

[0078] (1) Green fluorescent labeling identification

[0079] Since the CRISPR / Cas vector carries an independently expressed EGFP green fluorescent protein tag, the ploidy of the harvested first-generation hybrid seeds is identified by using green fluorescence. Since the chromosomes from the father carry the green fluorescent protein tag, if the hybrid offspring has fluorescence, it is a heterozygous diploid, and if the hybrid offspring does not have fluorescence, it is a haploid ( Figure 3 ).

[0080] (2) Flow cytometry ploidy identification

[0081] After sowing the seeds without green fluorescence obtained in step (1), young leaves were taken to extract cell nuclei, and cell nuclei extracted from diploid cucumber leaves were used as controls. The cell nucleus signal peak of the diploid cucumber was first detected by flow cytometry, and its diploid signal peak was set to 100; then the cell nucleus signal peak of the plant to be tested was detected. If the peak value appeared near 50, the plant to be tested was a haploid plant. If the peak value appeared around 100, the plant to be tested was a diploid plant ( Figure 4 ).

[0082] (3) Plant phenotypic identification

[0083] Phenotypic observations were performed on the haploid plants identified in steps (1) and (2). The haploid plants were generally short, with smaller leaves and flower organs, and male sterility. The corresponding diploid plants were normal in size, with normal leaves, flower organs, and male flower fertility ( Figure 2 ).

[0084] (4) Statistical results of haploid induction rate

[0085] According to the above identification results, the haploid induction rate of CsDMP knockout plants was statistically analyzed (Table 2):

[0086] Haploid induction rate (%) = (haploid number / total number of hybrid seeds) × 100

[0087] Table 2 Statistics of csdmp haploid induction rate

[0088] Hybrid parent Total number of seeds Haploid number Haploid induction rate Changchun Mici 1169 3 0.26 3407 189 1 0.53

[0089] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. Application of gene CsDMP in cucumber haploid breeding, wherein: The gene CsDMP is a gene encoding the following protein (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2; or (b) A protein derived from (a) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO:

2.

2. The use according to claim 1, characterized in that: The application includes: using genetic engineering means to transform the cucumber gene CsDMP so that the function of the gene is lost or weakened.

3. The use according to claim 2, characterized in that: The method of gene modification is selected from at least one of mutagenesis, site-directed mutagenesis, and homologous recombination.

4. A method for constructing a cucumber parthenogenetic haploid induction line, characterized in that: By using genetic engineering methods, the cucumber gene CsDMP is knocked out, or the expression of the cucumber gene CsDMP is silenced or inhibited, to obtain positive transgenic plants, which are the cucumber parthenogenetic haploid induced lines.

5. The method according to claim 4, characterized in that The method of gene knockout, silencing or inhibition is selected from at least one of CRISPR / Cas9, TALEN gene editing technology, EMS mutagenesis, and T-DNA insertion.

6. The method according to claim 5, characterized in that The cucumber gene CsDMP was knocked out using CRISPR / Cas9 gene editing technology.

7. The method according to claim 6, characterized in that The method comprises: taking the gene CsDMP as a target, designing a sgRNA sequence based on CRISPR / Cas9, connecting a DNA fragment containing the encoding sgRNA sequence to a vector carrying CRISPR / Cas9, and transforming cucumber.

8. The method according to claim 7, characterized in that The nucleotide sequences of the sgRNA action site are 5′-GCTTCTGCCGTCGGTCTCC-3′ and 5′-ACGGGATCGTGACGCCCAG-3′.

9. Use of the transgenic plant obtained by the method according to any one of claims 4 to 8 in cucumber breeding.

10. The use according to claim 9, characterized in that: Breeding methods include transgenic, hybridization, backcrossing, selfing or asexual reproduction.

Images