Watermelon KNOX transcription factor ClSPR and application thereof in cold injury stress resistance

Abstract

The invention discloses a watermelon KNOX transcription factor ClSPR and application thereof in cold injury stress resistance, and belongs to the technical field of plant genetic engineering. According to the watermelon KNOX transcription factor ClSPR and the application of the watermelon KNOX transcription factor ClSPR in cold injury stress resistance, a CRISPR / Cas9 gene editing technology is adopted, fixed-point editing is conducted on the watermelon KNOX transcription factor ClSPR, and a new cold-resistant watermelon germplasm is obtained. Compared with a wild material, the novel cold-resistant watermelon germplasm created by the invention has the advantages that the growth vigor in the seedling stage is not changed, and meanwhile, other tissues such as female flowers, leaves, tendrils, stems and roots have no visible phenotypic change; by means of the technology, directional genetic improvement of cold stress resistance of excellent watermelon germplasm can be achieved, a new material is accumulated for breeding of new stress-resistant varieties, and important production and application potential is achieved.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and more particularly to a watermelon KNOX transcription factor ClSPR and an application thereof in tolerance to chilling stress. Background Art

[0002] Watermelon (Citrullus lanatus), a member of the Cucurbitaceae family, is an important Cucurbitaceae crop that is widely planted in the world, and is also a fruit-type cash crop. According to statistics, in 2022, the planting area of ​​watermelon in my country was 1.3919 million hectares, and the total output reached 60.5422 million tons, accounting for 47.73% and 60.57% of the world's total cultivated area and output, respectively (FAO, http: / / www.fao.org / ). Therefore, as one of the important melon crops cultivated in my country, watermelon plays an important role in agricultural structural adjustment and rural economic development.

[0003] Watermelon originated in the desert areas of Africa and is a warm-loving crop that is not cold-tolerant. With the rapid development of facility agriculture in my country, early spring cultivation and off-season planting of watermelon have become increasingly common, and have become one of the important ways for melon farmers to increase their income. However, with the frequent occurrence of low temperature and cold damage, especially extreme weather in late spring, low temperature stress often causes adverse effects or even death on watermelon seedlings planted in early spring, thereby affecting the yield and quality of watermelons. Based on this, it is of great significance to explore and create excellent low-temperature-resistant watermelon germplasm and then breed new stress-resistant varieties for the healthy development of the watermelon industry.

[0004] Therefore, providing a watermelon KNOX transcription factor ClSPR and its application in tolerance to cold stress is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides a watermelon KNOX transcription factor ClSPR and an application thereof in tolerance to chilling stress.

[0006] In the early stage of the present invention, RT-PCR technology was used to find that the watermelon KNOX transcription factor ClSPR significantly responded to cold stress; further, CRISPR / Cas9 technology was used to create functional materials of this gene, which can significantly improve tolerance to cold damage and provide material resources for the enrichment of new stress-resistant watermelon varieties.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] Watermelon KNOX transcription factor ClSPR, the CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1.

[0009] Furthermore, the watermelon KNOX transcription factor ClSPR is used in tolerance to cold stress.

[0010] Further, the use of biological materials knocked out of watermelon KNOX transcription factor ClSPR in tolerance to cold stress, wherein the CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1;

[0011] The biological material is any one of the following:

[0012] A: An expression cassette capable of silencing the watermelon KNOX transcription factor ClSPR;

[0013] B: a recombinant vector containing the expression cassette described in A;

[0014] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

[0015] Furthermore, the watermelon KNOX transcription factor ClSPR is used in watermelon breeding.

[0016] Furthermore, the watermelon KNOX transcription factor ClSPR is used in breeding cold-resistant watermelon germplasm.

[0017] Furthermore, a method for creating a new cold-resistant watermelon germplasm is provided, which uses CRISPR / Cas9 or other gene editing technologies to perform site-specific editing or knockout of the KNOX transcription factor ClSPR or its conserved domain sequence, thereby rendering the gene protein functionally deficient or mutated, producing a phenotype of resistance to cold stress; the CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1.

[0018] The present invention is the first to use the watermelon KNOX transcription factor ClSPR identified by the gene family, and combined with CRISPR / Cas9 technology to create a new watermelon cold-resistant germplasm. The present invention can achieve the directional genetic improvement of the cold-resistance trait of excellent watermelon germplasm, accumulate new materials for the breeding of new stress-resistant varieties, and has important production application potential.

[0019] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses a watermelon KNOX transcription factor ClSPR and its application in cold stress tolerance. For the first time, CRISPR / Cas9 or other gene editing systems are used to perform gene editing and knockout of the KNOX transcription factor ClSPR or its conserved domain, so that the gene function is lost or mutated, thereby being more tolerant to cold stress. Compared with the wild-type material, the new cold-resistant watermelon germplasm created by the present invention has no change in its growth at the seedling stage, and other tissues such as female flowers, leaves, tendrils, stems, roots, etc. have no visible phenotypic changes; this technology can achieve the directional genetic improvement of excellent watermelon germplasm resistance to cold stress, accumulate new materials for the selection and breeding of new stress-resistant varieties, and has important production application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0021] Figure 1 The accompanying drawing shows the recombinant plasmid sgRNA expression element of the present invention; wherein U6-26p and U6-29p are promoters, U6-26t is a terminator, gRNA-Sc is a gRNA skeleton, and Target1 and Target2 are target sites;

[0022] Figure 2 The accompanying drawings are schematic diagrams of the target structure and phenotype diagrams of the present invention;

[0023] Among them, (a) schematic diagram of ClSPR gene structure; the location of Target1 and Target2 on the gene, and two gene-edited plants Clspr_1 and Clspr_2 were obtained, which had 4bp and 1bp deletions in Target1, respectively, and 7bp and 6bp deletions in Target2, respectively (- indicates deletion); (b) phenotypes of multiple unedited plants (CK) and edited plants after cold damage, among which CK leaves wilt significantly and some leaves dry up, while the wilting degree of edited plants Clspr_1 and Clspr_2 is significantly lighter;

[0024] Figure 3 The attached figure is a plant phenotype diagram after chilling stress and the determination of relative conductivity and malondialdehyde content of the present invention;

[0025] Among them, (a) the phenotype of individual plants after chilling stress, CK leaves wilt obviously, and some leaves dry up, while the wilting degree of edited plants Clspr_1 and Clspr_2 is significantly lighter; (b) relative conductivity REC determination; (c) malondialdehyde MDA determination; ** indicates significant at the p<0.01 level. DETAILED DESCRIPTION

[0026] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] The CDS sequence of ClSPR is shown in SEQ ID NO.1.

[0028] ATGGCGGATCTTTACGGACTCCATCCCCTCGCTGATAACTCTTACCAGTCATCTTCAGCGACGACGTTGGGTAGCTTTCCTTCTTGCTAATTCTCCAATGGCTTCTGCAGATTATTCTCATCTACTTCCTGCTTTTGAATCGGAATATTTGCGGACGGTT TCGTCGGCCGCCTGCGACACCGTTGCGGCGGCGGCTGAGATTGAAACAGCGCGAGCTAATTCCGAGTACTCCGCCGGTGTAATTCGAGCGAAAATTGCTTCTCATCCTCTTTACCCTAAACTCGTCGATGCGTTCGTGAACTGCCAAAAGGTCGGTGTACCG CCGGAGTTCGCTGATATTCCAGACCAAAACAACCGTGGAAGTGATATCGGCGAAGAAATTTCCGGCGTTTCAAATTGCTTGGGTGTCGATCCCGAACTCGATGAGTTCATGGAAACATACTACAGGATACTAGCCAAATACGAGTTAGATCTCTCCCAGTCCTTCATGGAAGCATCTTCCTTTCTCAACAACATGGGAATGCAGTTAAACGTGCTTTGCAATAAC GATGAAACTGCTCCGAAAGAGAATATAAGCGCCGGAGAAGTAGAATTACAAGACTCTCTTGTGGTTCCGGGAAATGAAGATCGCGAGCTGAAGGATCGACTTTTGCGGGAGTACGGTGGTCATATTAGTAGCTTAAAGCAGGAATTCTCAAAAACTAAAAAGAAGGCAAATCTGCCGAGAGAAGCCAAACAGATCCTGCTTCACTG GTGGAACAGCCATTCCCAG SEQ ID NO.1.

[0029] Example 1 Selection of editing sites for gene C1SPR

[0030] According to the CDS sequence of ClSPR (as shown in SEQ ID NO.1) and the target site online design website CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / news.php, V2), the target site for gene editing was designed, and two editing sites (Target1 and Target2) were designed. Among them, the targets Target1 and Target2 are located on the second and fourth exons of the gene ClSPR, respectively.

[0031] Target1 sequence: CCGGAGTTCGCTGATATTC; SEQ ID NO.2;

[0032] Target2 sequence: GTGGAACAGCCATTCCCAG; SEQ ID NO.3.

[0033] Example 2 CRISPR / Cas9 editing vector construction

[0034] 1) PCR amplification:

[0035] According to the above two sets of target sequences, the adapter primers Target1F / Target2R were synthesized, and the intermediate vector pCBC-DT1T2 diluted 100 times was used as a template, and the high-fidelity enzyme PrimeStarMax Premix (TaKaRa) was used for PCR amplification. The PCR amplification system was: PrimeStarMax Premix (2×) 25μL, template 2.5μL, upstream and downstream primers 2.5μL each, ddH2O 17.5μL. The PCR reaction program was: 98℃10s, 58℃5s, 72℃15s, 38 cycles; 72℃5min.

[0036] The target sequence adapter primer (the underlined part is the target sequence) is as follows:

[0037] Target1 sequence primer: Target1F

[0038] ATATATGGTCTCGATTG GAATATCAGCGAACTCCGG GTTTTAGAGC TAGAAATAGC;SEQ IDNO.4;

[0039] Target2 sequence primer: Target2R

[0040] ATTATTGGTCTCGAAAC CTGGGAATGGCTGTTCCAC CAATCTCTTA GTCGACTCTAC; SEQ ID NO.5.

[0041] 2) Vector digestion:

[0042] The CRISPR / Cas9 vector PBSE402 was digested with restriction endonuclease BsaI (NEWENGLAND BioLabs). The digestion system was: PBSE402 2 μg, CutSmart buffer 5 μL, BsaI 1 μL, ddH2O to 50 μL. Digestion was performed at 37°C for 2 h, and gel recovery was performed after electrophoresis detection.

[0043] PCR product and vector connection: The PCR amplified product was connected to the vector PBSE402 after restriction digestion by homologous recombination. The connection system is: the molar ratio of vector to insert fragment is about 1:2; 5× reaction buffer 4μL; NovoRec Plus recombinase 1μL; ddH2O is made up to 20μL. 50℃, connection for 10min.

[0044] The recombinant plasmid backbone is shown in Figure 1 .

[0045] 3) Recombinant plasmid transformation:

[0046] Take 5 μl of the ligation product and heat-shock transform it into E. coli competent DH5a, apply it to LB solid culture plate containing 50 mg / L kanamycin, and culture it overnight at 37° C. Use primers U626-IDF / U629-IDR to detect the positive colony.

[0047] The specific primer sequences are as follows:

[0048] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC; SEQ ID NO.6;

[0049] U629-IDR: AGCCCTCTTTCTTTCGATCCATCAAC; SEQ ID NO.7.

[0050] After sequencing was correct, the recombinant plasmid was extracted and transformed into Agrobacterium competent cells EHA105. After PCR verification, it was used for watermelon genetic transformation. The steps of Agrobacterium transformation are as follows:

[0051] Take 1 μl of recombinant plasmid and add it to Agrobacterium EHA105 competent cells, insert it into an ice box for 5 minutes, then put it into liquid nitrogen for quick freezing for 5 minutes, put it into a 37℃ water bath for 5 minutes, add 400 μl of antibiotic-free medium to each tube for recovery, and transfer it to a shaker at 200 rpm and 28℃ for shaking. Take 100 μl of the recovered bacterial solution and spread it on LB solid medium containing antibiotics, dry it at room temperature, and after the bacterial solution is fully absorbed, turn the culture dish upside down and culture it in a 28℃ incubator for 2-3 days.

[0052] Example 3

[0053] 1) Genetic transformation of watermelon:

[0054] Take full watermelon germplasm 'TC' seeds, soak them in 50-55℃ distilled water for about 30 minutes, and then peel off the seed shells. Wash the peeled kernels with 75% alcohol for about 30 seconds in a clean bench, wash them twice with sterile water, and then soak them in 3% sodium hypochlorite for 15 minutes for disinfection. After washing with sterile water for 5-7 times, dry them, sow them in MS solid culture medium, and culture them in the dark at 25℃ for 3 days.

[0055] After the seeds germinate, remove them, cut off the two ends of the cotyledons, and divide the remaining cotyledons into 8 pieces for easy infection. During this period, the EHA105 single colony containing the recombinant plasmid verified by PCR was picked into LB liquid medium containing 50 mg / L kanamycin and 20 mg / L rifampicin, and the bacterial solution was shaken to an OD of 600=0.8, resuspend the bacterial solution in MS culture medium (MS5194.43g / L, sucrose 30g / L, 6-BA 1.5mg / L) to a final concentration of OD 600 = 0.2 to obtain a bacterial suspension. The cut cotyledons were soaked in the bacterial suspension for 15 min, taken out and dried, and then co-cultivated in a co-cultivation medium (CM: MS519 4.43 g / L, sucrose 30 g / L, G3251 (PhytoTechLabs) 3 g / L, 6-BA 1.5 mg / L) padded with filter paper and cultured at 25°C in the dark for 3 days.

[0056] After 3 days of co-cultivation, the cotyledon blocks were removed and washed with sterile water to remove excess Agrobacterium liquid on the surface (washed about 5-7 times) until the sterile water was clear. After being taken out and dried, they were placed on recovery medium (RM: MS5194.43g / L, sucrose 30g / L, G32513g / L, 6-BA 1.5mg / L, Timentin 200mg / L) for recovery culture at 28°C for 7 days.

[0057] After 7 days, the cotyledons of the recovery culture were transferred to MS medium (selective medium SM) containing 1.5 mg / L 6-BA, 200 mg / L Timentin and 1.4 mg / L Basta for selection culture, and subcultured at 28°C for 3-4 weeks, with subculture every 7 days. After that, the explants with obvious buds were transferred to the bud elongation medium (containing 4.43 g / L MS524, 30 g / L sucrose, 3 g / LG3251, 1 g / L inositol, 500 μL / L SH organic solution, 0.01 mg / L NAA, 0.1 mg / L 6-BA, 200 mg / L Timentin and 1.4 mg / L Basta), and the culture conditions were 28°C, 8 h / d in the dark, 16 h / d in the light, and the light intensity was 8000 Lx. The selected buds were cut off (note that the incision should not contain callus), and transferred to MS medium containing 0.5 mg / L IBA and 200 mg / L Timentin for rooting culture at 28°C until rooting.

[0058] SH organic solution contains 10g / L nicotinic acid, 10g / L VB1, and 1g / L VB6.

[0059] When the regenerated seedlings have roots and grow to 4-5 true leaves, take them out of the culture bottle, slowly rinse off the culture medium at the roots with clean water, transplant them to the substrate that has been sterilized at high temperature and high pressure in advance, water them thoroughly and keep them warm and moist. After 3-4 days, you will see water droplets on the cover of the hole tray, and gradually open the cover to harden the seedlings.

[0060] 2) Detection of genetically modified watermelon plants:

[0061] The PBSE402 vector carries a GFP fluorescent tag, and the CTAB method is used to extract the DNA of the watermelon regenerated seedlings with GFP fluorescence. The steps are as follows: take a small part of the young leaves, quickly grind them into powder in liquid nitrogen, and put them in a 1.5 ml centrifuge tube; add preheated 800 μl CTAB extraction buffer, and water bath at 65°C for 30 minutes; add an equal volume of chloroform and isoamyl alcohol, wherein the volume ratio of chloroform to isoamyl alcohol is 24:1, and centrifuge at 8000r / min for 10 minutes after mixing; transfer the supernatant to a new centrifuge tube, add 2 / 3 volume of isopropanol, and gently mix by turning upside down; centrifuge at 10000r / min for 10 minutes; pour out the supernatant, rinse the precipitate twice with 75% volume ethanol, and then drain the remaining liquid after pouring it out. After drying for 3 minutes, dissolve it with 100μl ddH2O (containing 0.1% RNase), and store it at 4°C for later use.

[0062] Using the extracted DNA as template, the sequences of the two target sites were amplified by PCR using target 1 primer ClSPR-CRJC-F1 / R1 and target 2 primer ClSPR-CRJC-F2 / R2, respectively. The positive control was the recombinant plasmid, and the negative control was the non-transgenic plant DNA.

[0063] The specific primer sequences are as follows:

[0064] ClSPR-CRJC-F1:

[0065] ATTATTCTCATCTACTTCCTGCTT;SEQ ID NO.8;

[0066] ClSPR-CRJC-R1:

[0067] TTTTCTTTTTCTTTTATCTACCGT;SEQ ID NO.9;

[0068] ClSPR-CRJC-F2:

[0069] GGAGGGTTGATAGATTGGGGTTT;SEQ ID NO.10;

[0070] ClSPR-CRJC-R2:

[0071] TAGGAGTAAGTTAGCATGTTTGGT; SEQ ID NO. 11.

[0072] The amplification system was: 2×Taq PCR StarMix with loading Dye 10μL, template 1μL, upstream and downstream primers 1μL each, ddH2O 7μL. The PCR reaction program was: 94℃3min; 94℃30s, 58℃30s, 72℃1min, 30 cycles; 72℃5min. The PCR products were recovered according to the band size and TA cloned. After the bacterial solution PCR was positive, the clones were selected for testing to confirm the editing event. The results are shown in Figure 2 A total of two gene-edited plants, Clspr_1 and Clspr_2, were obtained, with 4bp and 1bp missing in Target1, respectively, and 7bp and 6bp missing in the Target2 target region, respectively.

[0073] 3) Phenotypic observation of transgenic watermelon plants under chilling stress:

[0074] The CK wild type (WT), edited plants Clspr_1 and Clspr_2 were planted in a solar greenhouse and managed normally. After the seedlings grew to about four leaves and one heart, the phenotype was observed and photographed (before treatment), and then low-temperature treatment was carried out in an artificial climate incubator. The phenotype was observed and photographed for three days in an incubator with 12h light / 12h dark (after treatment). The leaves were taken for conductivity and MDA determination. The data were repeated three times and Student's t-test significance analysis was performed.

[0075] (1) Relative conductivity (REC)

[0076] 1. Remove the fourth true leaf from the treated watermelon plant (counting from bottom to top in order of growth). Rinse the leaf twice with distilled water and blot dry with clean filter paper. Use a hole puncher to punch holes between the veins, avoiding the veins.

[0077] 2. Place the treated leaves into a labeled 50 mL large test tube and accurately add 20 mL of distilled water to the test tube to completely immerse the leaves.

[0078] 3. Place the prepared material in a vacuum desiccator and use a vacuum pump to remove air from the intercellular spaces for about 15 minutes. Then slowly re-inject air to press water into the tissue, causing the leaves to sink (either leave at room temperature for 1 day or shake on a shaker for 1 hour).

[0079] 4. Take out the evacuated material and place it on the laboratory table for 20 minutes. Then gently stir the leaves with a glass rod and use a conductivity meter to measure the conductivity C1 of the solution at a constant temperature of 20-25℃.

[0080] 5. After measuring the conductivity, boil the material in a 100°C boiling water bath for 15 minutes to kill the plant tissue. Take it out and cool it in tap water for 10 minutes, and measure its conductivity C2 after boiling at a constant temperature of 20-25°C.

[0081] 6. Calculation results: REC = C1 / C2 × 100%.

[0082] (2) Malondialdehyde (MDA) determination

[0083] 1. 0.15 g leaf sample + 2.5 mL 10% trichloroacetic acid, centrifuge at 8000 g for 15 min;

[0084] 2.1 mL supernatant + 1 mL 0.6% thiobarbituric acid reaction solution;

[0085] 3. Boil for 15 minutes, take out and immediately put into ice to stop the reaction;

[0086] 4. After centrifugation at 10,000 g for 10 min, measure the absorbance of the supernatant at 450 nm and 532 nm.

[0087] Calculation formula: MDA (nmol g -1 Fw)=(6.45×A532-0.56×A450)×VT / (Vs×Fw)

[0088] Wherein: VT: extraction volume 2.5mL;

[0089] Vs: sample volume for measurement 1 mL;

[0090] Fw: fresh weight.

[0091] After three days of low temperature treatment, the leaves of CK (unedited plants WT) wilted significantly, and some leaves dried up, while the wilting degree of the leaves of edited plants Clspr_1 and Clspr_2 was significantly lighter than that of the control, and the growth was normal ( Figure 2 ), indicating that the edited plants have strong cold tolerance.

[0092] The relative conductivity of plant leaves is a commonly used physiological indicator to evaluate the integrity and permeability of cell membranes under plant stress. When plants are affected by environmental stress (such as drought, salinity, high temperature, etc.), the cell membrane may be damaged, causing electrolytes (such as electrolyte leakage) to leak from the cells to the external environment, thereby increasing the conductivity of the leaves. Further, through the determination of relative conductivity REC, it was found that under cold stress, the relative conductivity of CK plants was 55.40%, which was significantly higher than the relative conductivity of edited plants (38.28%). Figure 3 ), indicating that ClSPR-edited plants are more resistant to cold stress.

[0093] Malondialdehyde (MDA) content is a commonly used indicator. When plant organs age or are damaged under adverse conditions, membrane lipid peroxidation usually occurs. MDA, as the final product of membrane lipid peroxidation, its content can reflect the degree of damage to the plant caused by adverse conditions. By measuring the malondialdehyde content in plant leaves, the adaptability of plants under stress can be indirectly reflected. By measuring the malondialdehyde content in the leaves of CK and edited plants, it was found that under cold stress, the malondialdehyde content in CK leaves was also significantly higher than that in edited plants, further indicating that ClSPR edited plants are more resistant to low temperature stress ( Figure 3 ).

[0094] In summary, the present invention provides a method for creating cold-tolerant watermelon germplasm through gene editing technology. By sequence editing the KNOX transcription factor ClSPR, cold-tolerant watermelon materials can be quickly obtained, which can provide technical support for the targeted improvement of the low-temperature resistance traits of excellent watermelon germplasm.

[0095] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Watermelon KNOX transcription factor ClSPR, characterized in that The CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.

1.

2. Use of the watermelon KNOX transcription factor ClSPR according to claim 1 in tolerance to chilling stress.

3. Application of biological materials with knockout of watermelon KNOX transcription factor ClSPR in cold stress tolerance, characterized in that: The CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1; The biological material is any one of the following: A: An expression cassette capable of silencing the watermelon KNOX transcription factor ClSPR; B: a recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

4. Application of the watermelon KNOX transcription factor ClSPR according to claim 1 in watermelon breeding.

5. Use of the watermelon KNOX transcription factor ClSPR according to claim 1 in breeding cold-resistant watermelon germplasm.

6. A method for creating a new cold-resistant watermelon germplasm, characterized in that: CRISPR / Cas9 gene editing technology was used to perform site-specific editing on the watermelon KNOX transcription factor ClSPR; the CDS sequence of the watermelon KNOX transcription factor ClSPR was shown in SEQ ID NO.1.

Images