Genetic modification method and application of bordetella pertussis

Abstract

The invention provides a method for genetically modifying bordetella pertussis and application of the method. The method comprises the following steps: knocking down or knocking out a first nutrition screening gene of bordetella pertussis to generate a first auxotrophic cell; replacing the first genetic element with a second nutrition screening gene through recombination treatment to obtain a second auxotroph cell; replacing the second nutritional screening gene with the genetically modified second genetic element through recombination treatment to obtain a third nutritional deficient cell; and restoring the first nutritional screening gene to the genome of the third nutritional deficient cell through recombination treatment. In the modification process, use of antibiotics is not involved, no redundant fragments are introduced except for target modification sites, and the method has the advantages that the genetic background purity is high, and no biological safety risk exists in the modification process.

Description

Technical Field

[0001] The present invention belongs to the field of gene engineering technology, and specifically relates to a method for genetically modifying Bordetella pertussis and its application. Background Art

[0002] Pertussis is an acute respiratory infection caused by Bordetella pertussis, which manifests as paroxysmal spasmodic coughs accompanied by deep "cock-crow"-like inspiratory roars. Although pertussis is considered a childhood disease, it can occur in all age groups. Pertussis remains an important cause of morbidity and mortality in infants. Before the promotion of the pertussis immunization program, pertussis was one of the most common infectious diseases causing morbidity and mortality. Due to the promotion and coverage of pertussis vaccines, the incidence of pertussis has decreased worldwide, but in recent years, the incidence of pertussis has shown a significant upward trend, and the incidence of pertussis in children has increased year by year, which is called the re-emergence of pertussis. Therefore, researching and producing safer and more effective pertussis vaccines, optimizing production processes, and reducing the cost of vaccines are important for protecting people's health.

[0003] Currently, pertussis-related vaccines can be divided into two categories: whole-cell pertussis vaccines and acellular pertussis vaccines. Among them, whole-cell pertussis vaccines, because they are whole-bacterial preparations, often cause local reactions or rare but serious systemic reactions after vaccination, which limits the application scenarios of this type of vaccine and gradually withdraws from the mainstream market. However, whole-cell pertussis vaccines have better immunogenicity because they contain whole-bacterial components.

[0004] Therefore, providing a method for genetic modification of Bordetella pertussis is essential for eliminating the toxicity of toxin antigens in whole-cell pertussis vaccines and / or reducing strong adverse reactions caused by non-protective antigens. In the past, when Bordetella pertussis was modified, it was mostly carried out by Escherichia coli conjugation, and antibiotics were mostly used for screening during genetic screening, which resulted in complex genetic backgrounds and high biosafety risks. The linear fragments obtained by in vitro construction used in this method are used for pertussis transformation and genome modification, and the recombinant transformants are screened by nutritional screening genes. It has the characteristics of clear genetic background and low biosafety risk. In addition, the combination of positive and negative screening simplifies the transformation process and reduces the demand for screening marker genes. Summary of the invention

[0005] The present disclosure provides a method for genetically modifying Bordetella pertussis and its application. The genetic modification described in the present disclosure is to perform directional genetic modification on Bordetella pertussis so that it obtains stable genetic traits. The modification process described in the present disclosure does not involve the use of antibiotics, and no redundant fragments are introduced except for the target modified sites. It has the advantages of high purity of genetic background and no biosafety risk in the modification process. The genetically engineered pertussis obtained by the modification scheme described in the present disclosure is very feasible for application in the research and production of pertussis vaccines.

[0006] A first aspect of the present disclosure provides a method for genetic modification of Bordetella pertussis, the method comprising:

[0007] 1) knocking down or knocking out the first nutritional selection gene of Bordetella pertussis to produce first nutritional deficiency cells;

[0008] 2) in the first auxotrophic cell obtained in step 1), replacing the first genetic element with a second nutrient screening gene by recombination treatment to obtain a second auxotrophic cell containing the second nutrient screening gene;

[0009] 3) genetically modifying the first genetic element in vitro to obtain a second genetic element;

[0010] 4) Recombining the second genetic element to replace the second nutritional screening gene in the second auxotrophic cell obtained in step 2) to obtain a third auxotrophic cell; and

[0011] 5) The first nutritional screening gene is restored to the genome of the third nutritional deficiency cell obtained in step 4) through recombination treatment to obtain genetically modified Bordetella pertussis.

[0012] In some embodiments, the first nutritional screening gene and the second nutritional screening gene are the same or different.

[0013] In some embodiments, the first nutritional screening gene and / or the second nutritional screening gene is an endogenous gene of Bordetella pertussis, and is further preferably a signal pathway gene.

[0014] In some embodiments, the first nutritional screening gene and / or the second nutritional screening gene include at least one of an orotate phosphoribosyltransferase gene, a thymidylate synthetase gene, or a galactokinase gene.

[0015] In some embodiments, in step 3), the genetic modification comprises at least one of deletion, replacement or directed modification of the first genetic element.

[0016] In some embodiments, the genetic modification includes one or more of genetic detoxification / attenuation of pertussis toxin, detoxification / knockout of adenylate cyclase, knockout of skin necrosis factor, genetic attenuation of tracheal cytotoxin synthesis genes, genetic attenuation of LPS, overexpression of pertussis adhesin, overexpression of filamentous hemagglutinin, reduction of peripheral membrane vesicle reactogenicity, or conditional reproduction editing.

[0017] In some embodiments, the method further comprises repeating steps 1) to 4) to achieve multiple genetic modifications.

[0018] In some embodiments, in step 1), the first auxotrophic cells are generated by a negative selection method.

[0019] In some embodiments, in step 2), a second auxotrophic cell containing the second nutrient screening gene is obtained by a positive screening method.

[0020] In some embodiments, in step 4), the third auxotrophic cell is obtained by a negative selection method.

[0021] In some embodiments, in step 5), the genetically modified Bordetella pertussis is obtained by a positive screening method.

[0022] In some embodiments, the negative selection is performed in a medium supplemented with a growth factor analog and a salvage growth factor.

[0023] In some embodiments, the growth factor analogs include at least one of 5-fluoroorotic acid, trimethoprim or 2-deoxy-galactose. In some embodiments, when the concentration of 5-fluoroorotic acid reaches 200 mg / L or the concentration of trimethoprim reaches 100 mg / L, the growth of wild-type Bordetella pertussis can be fully inhibited.

[0024] In some embodiments, the salvage growth factor comprises uracil and / or thymine.

[0025] In some embodiments, the positive selection is performed in a culture medium containing essential growth factors associated with the first nutritional screening gene and / or the second nutritional screening gene. In some specific embodiments, the essential growth factors include at least one of histidine, leucine, glutamine, etc.

[0026] In the present disclosure, the first nutritional screening gene and the second nutritional screening gene are related to the essential growth factors for the growth of available Bordetella pertussis, and the lack of essential growth factors causes Bordetella pertussis to fail to grow normally. Growth factor analogs are similar in structure to growth factors, but can cause bacterial death after being used by Bordetella pertussis. Bordetella pertussis has a salvage pathway gene, and when the essential growth factor or nutritional screening gene is lacking, the normal growth of Bordetella pertussis can be maintained by adding salvage growth factors.

[0027] In some embodiments, the Bordetella pertussis includes Bordetella pertussis or Bordetella parapertussis.

[0028] In some embodiments, the screening disclosed herein comprises alternating between auxotrophic high-efficiency screening (positive screening) and growth factor analog pressure screening (negative screening).

[0029] In some embodiments, the transformation method involved in the genetic modification method of the present disclosure may specifically be chemical heat shock transformation, electrical transformation, conjugation transformation, etc.

[0030] In some embodiments, the recombination treatment involved in the genetic modification method of the present disclosure may specifically be homologous recombination, site-directed editing, etc., and homologous recombination is preferably used.

[0031] In some specific embodiments, step 1) includes: synthesizing the upstream sequence and downstream sequence of the first nutritional screening gene coding sequence of Bordetella pertussis into DNA fragments, connecting them into a cloning plasmid, and constructing a recombinant plasmid with the first nutritional screening gene knocked out; and transforming the linearized fragment of the recombinant plasmid with the first nutritional screening gene knocked out into Bordetella pertussis, and obtaining the first nutritionally deficient cells through negative selection.

[0032] In some specific embodiments, in step 1), the first nutritional screening gene includes at least one of an orotate phosphoribosyltransferase gene, a thymidylate synthetase gene or a galactokinase gene.

[0033] In some specific embodiments, in step 2), the first genetic element is a target gene, more specifically a gene encoding pertussis toxin (PT).

[0034] In some specific embodiments, in step 2), the second nutritional screening gene includes at least one of an orotate phosphoribosyltransferase gene, a thymidylate synthetase gene or a galactokinase gene.

[0035] In some specific embodiments, the first nutritional screening gene and the second nutritional screening gene are both orotate phosphoribosyltransferase (pyrE) genes.

[0036] In some specific embodiments, step 2) includes: in the first nutrient-deficient cell obtained in step 1), synthesizing the upstream sequence of the first genetic element coding sequence, the second nutritional screening gene coding sequence, and the downstream sequence of the first genetic element coding sequence into DNA, integrating them into a recombinant plasmid, and constructing a targeting plasmid containing the second nutritional screening gene; and transforming the targeting plasmid containing the second nutritional screening gene into the first nutrient-deficient cell obtained in step 1), and obtaining a second nutrient-deficient cell containing the second nutritional screening gene through positive screening.

[0037] In some specific embodiments, step 3) includes: synthesizing DNA fragments of the upstream sequence of the first genetic element coding sequence, the first genetic element coding sequence and the downstream sequence of the first genetic element coding sequence, and integrating them into a homologous recombination plasmid to construct a homologous recombination plasmid of the PT encoding gene; then obtaining the second genetic element through point mutation; more specifically, preparing a homologous recombination plasmid of a PT mutation (second genetic element) containing Arg9-Lys9 and Glu129-Gly129 mutations through point mutation.

[0038] In some specific embodiments, step 5) includes: synthesizing the upstream sequence of the first nutritional screening gene coding sequence, the first nutritional screening gene coding sequence and the downstream sequence of the first nutritional screening gene coding sequence into DNA, integrating them into a recombinant plasmid, and constructing a recombinant plasmid that complements the first nutritional screening gene; and transforming the recombinant plasmid that complements the first nutritional screening gene into the third nutritionally deficient cell obtained in step 4), and obtaining genetically modified Bordetella pertussis through positive screening.

[0039] The second aspect of the present disclosure provides a recombinant Bordetella pertussis cell or an antigen thereof obtained by the genetic modification method.

[0040] The recombinant Bordetella pertussis obtained in the present disclosure has the following characteristics:

[0041] (1) The final edited DNA sequence is integrated into the genome, and the resulting genetic traits are stable and persistent;

[0042] (2) Neither the final product nor the intermediates contain any antibiotic genes;

[0043] (3) The final strain does not contain any other scars.

[0044] In some embodiments, the pertussis toxin (PT) gene of the recombinant Bordetella pertussis has mutations at amino acids 9 and 129. In some specific embodiments, the PT gene of the recombinant Bordetella pertussis has mutations of R9K and E129G, and preferably, the PT gene of the recombinant Bordetella pertussis does not have other mutation sites. Further preferably, the recombinant Bordetella pertussis has the nucleotide sequence shown in SEQ ID NO: 2.

[0045] The third aspect of the present disclosure provides an immune preparation, comprising the recombinant Bordetella pertussis bacteria and / or its antigens obtained according to the genetic modification method.

[0046] The fourth aspect of the present disclosure provides the use of the recombinant Bordetella pertussis bacteria or its antigen or the immune preparation in the preparation of a vaccine for preventing pertussis disease and / or a drug for treating pertussis disease.

[0047] The fifth aspect of the present disclosure provides a vaccine for the prevention of pertussis and / or a drug for the treatment of pertussis, comprising an active ingredient and a pharmaceutically acceptable buffer, excipient and / or adjuvant, wherein the active ingredient comprises the recombinant pertussis Bordetella bacteria and / or its antigens obtained by the genetic modification method described in the first aspect.

[0048] The technical method for genetically engineering wild pertussis strains used in the present disclosure has the following advantages: the transformed strains do not contain any antibiotic genes, do not retain any nucleic acid of exogenous species, and do not contain any redundant modifications except the target mutation.

[0049] The method disclosed herein knocks out specific antigen genes or increases the copy number, or replaces toxic genes in Bordetella pertussis, thereby constructing a genetically engineered strain of Bordetella pertussis for the production of specific antigens. On the one hand, antibiotics are not used as screening markers during the transformation process, and there is no risk of artificially creating an antibiotic-resistant Bordetella pertussis; on the other hand, genetic transformation is carried out using endogenous sequences and homologous recombination, and no redundant fragments are introduced. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 The growth inhibition of B. pertussis by different 5-fluoroorotic acid concentrations is shown.

[0051] Figure 2 The growth inhibition of B. pertussis by different trimethoprim concentrations is shown.

[0052] Figure 3 The process of positive and negative screening of genetic modifications of Bordetella pertussis is shown.

[0053] Figure 4The results show the genetic modification of Bacillus pertussis - directed mutagenesis followed by sequencing and identification of the genetically detoxified PT toxin.

[0054] Figure 5 The genetic modification of B. pertussis - complementation of the pyrE gene is shown.

[0055] Figure 6 The results of SDS-PAGE identification of genetically modified and detoxified PT toxin of Bacillus pertussis are shown.

[0056] Figure 7 The results of immunoblotting (WB-anti S1) identification of genetically modified and detoxified PT toxin of B. pertussis are shown.

[0057] Figure 8 The results of the identification of the pertussis toxin toxicity (CHO cell clustering method) of the genetically modified and detoxified PT toxin of Bacillus pertussis are shown. DETAILED DESCRIPTION

[0058] In order to make the purpose, technical scheme and advantages of the present disclosure clearer, the present disclosure is further described in detail below in conjunction with the embodiments. The specific embodiments described herein are only used to explain the present disclosure and are not intended to constitute any limitation to the present disclosure. In addition, in the following description, the description of the well-known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0059] definition

[0060] Unless otherwise defined, all technical and scientific terms used in this disclosure have the same meaning as commonly used in the field to which this disclosure belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0061] Unless the context clearly dictates otherwise, the expressions "a", "an" and "an" as used herein include plural references. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.

[0062] As used herein, the term "about" refers to a range of ±20% of the value that follows. In some embodiments, the term "about" refers to a range of ±10% of the value that follows. In some embodiments, the term "about" refers to a range of ±5% of the value that follows.

[0063] Pertussis is a respiratory infectious disease with cough as the main symptom, which is caused by infection with Bordetella pertussis or Bordetella parapertussis. The main pathogenic factor of Bordetella pertussis is pertussis toxin (PT). Studies have shown that its toxicity comes from the ADP-ribosyltransferase activity of the S1 subunit. By introducing point mutations in the S1 subunit of PT, the toxicity can be greatly reduced while retaining its immunogenicity. Mutating the 9th Arg of the S1 subunit to Lys may interfere with the hydrogen bond structure within the subunit, and mutating the 129th Glu to Gly may cause the N-glycoside to be unable to bind to nicotinamide purine dinucleotide (NAD). The genetically detoxified strain 9K / 129G greatly reduced the enzyme activity of S1, resulting in a very significant decrease in toxicity, but it did not affect the recognition ability of its protective monoclonal antibodies.

[0064] As used herein, the term "overexpression" refers to the expression of a target protein in a microorganism or bacterium at a level higher than that expressed in a reference microorganism or reference bacterium, respectively, which reference microorganism or reference bacterium is optionally a comparable wild-type microorganism or bacterium that generally belongs to the same strain or species. Overexpression may include, but is not limited to, constitutive or inducible expression. In some embodiments, the microorganism or bacterium does not endogenously express the target protein, and for the purposes of this disclosure, any level of expression of the protein in the microorganism or bacterial cell is considered to be "overexpression" of the protein.

[0065] The term "endogenous / endogenous" refers to a polynucleotide or protein that occurs naturally in a host cell. The term "heterologous / heterologous" refers to a polynucleotide or protein that does not occur naturally in a host cell.

[0066] The term "recombinant" means that an object has been modified from its native state. Thus, for example, a recombinant cell expresses genes not found in the native (non-recombinant) form of the cell, or expresses native genes at different levels or under different conditions than those found in nature. Recombinant nucleic acids differ from native sequences in that one or more nucleotides and / or are operably linked to a heterologous sequence (e.g., a heterologous promoter in an expression vector). Recombinant proteins differ from native sequences in that one or more amino acids and / or are fused to a heterologous sequence. Transformed microorganisms or bacteria may be considered recombinant microorganisms or bacteria. In one embodiment, a microorganism or bacterial cell is genetically modified by introducing an expression cassette or vector into the cell, wherein the expression cassette or vector comprises an exogenous nucleic acid sequence encoding a gene of interest.

[0067] The term "adjuvant" is defined as one or more substances that can stimulate the immune system. In this article, adjuvants can be used to enhance the immune response to one or more vaccine antigens / isolates. The adjuvant can be administered to the target animal before, at the same time, or after the vaccine is administered. The adjuvants disclosed herein can be obtained from any of many sources, including natural sources, recombinant sources, and / or chemically synthesized, etc. Examples of chemical compounds used as adjuvants include, but are not limited to, aluminum-containing compounds; metabolizable and non-metabolizable oils; block polymers; ISCOMs (immunostimulatory complexes); vitamins and minerals (including, but not limited to, vitamin E, vitamin A, selenium, and vitamin B12); Quil A (saponin); cross-linked acrylic acid-based polymers (e.g., prop-2-enoic acid polymers) cross-linked with polyalkenyl polyesters at different levels; and / or emulsions of micron-sized oil droplets uniformly distributed in water.

[0068] The present invention selects at least one of orotate phosphoribosyltransferase gene, thymidylate synthetase gene and galactokinase gene as a nutritional screening gene. The selected nutritional screening gene is an endogenous gene, which is relatively pure; and the above genes can be used for both positive screening and negative screening, and one gene can meet the needs of Bordetella pertussis genome modification.

[0069] Specifically, the present disclosure provides a method for genetically modifying Bordetella pertussis by genetic engineering means, and the specific method is as follows:

[0070] (1) Select an available essential growth factor for the growth of pertussis strains, such as histidine, leucine, glutamine, etc.; determine the relevant signal pathway genes (first nutritional screening genes and second nutritional screening genes, such as orotate phosphoribosyltransferase gene and / or thymidylate synthetase gene and / or galactokinase gene, etc.) and their salvage pathway genes and growth factor analogs (5-fluoroorotic acid and / or trimethoprim and / or 2-deoxy-galactose). The growth factor analogs must be similar in structure to the essential growth factors, but will cause bacterial death after being used by Bordetella pertussis; at this time, salvage pathway growth factors (such as uracil / thymine, etc.) need to be added to maintain the normal growth of Bordetella pertussis;

[0071] (2) synthesizing DNA fragments of the upstream and downstream sequences of the selected signal pathway gene coding sequence and ligating them into the cloning plasmid to construct a homologous recombination plasmid for knocking out the signal pathway gene;

[0072] (3) electroporation transformation: the homologous recombination plasmid targeting fragment of the knockout signal pathway gene is transferred into Bordetella pertussis, and negative selection substances (growth factor analogs) are added to the culture medium for negative selection to obtain a pertussis auxotrophic strain;

[0073] (4) synthesizing DNA of the upstream sequence of the target gene (first genetic element), the signal pathway gene (second nutritional screening gene), and the downstream sequence of the target gene (first genetic element), and integrating them into the homologous recombination plasmid to construct the homologous recombination plasmid of the targeting gene;

[0074] (5) electroporation transformation: introducing the homologous recombination plasmid targeting fragment in (4) into the nutritionally deficient strain in (3), and using a basic culture medium for positive screening to obtain a pertussis strain with the target gene knocked out;

[0075] (6) synthesizing DNA fragments of the target gene (first genetic element) coding sequence upstream, the target gene and the downstream sequence, and connecting them to the cloning plasmid to construct a homologous recombination plasmid for knocking out / replacing the signal pathway gene at the target position; preferably, step (6) further comprises: preparing a homologous recombination plasmid containing a target gene mutation (second genetic element) with Arg9-Lys9 and Glu129-Gly129 mutations by point mutation;

[0076] (7) electroporation transformation: the homologous recombination plasmid targeting fragment of the knockout / replacement signal pathway gene at the target position is transferred into Bordetella pertussis, and negative selection is performed by adding negative selection substances (growth factor analogs) to the culture medium to obtain a pertussis auxotrophic strain;

[0077] (8) Repeating steps (3)-(7) can achieve deletion / replacement / directed modification of multiple target genes;

[0078] (9) Synthesize DNA of the upstream sequence of the signal pathway gene (the first nutritional screening gene), the signal pathway gene, and the downstream sequence of the signal pathway gene coding sequence, and integrate them into the homologous recombination plasmid to construct a complemented signal pathway gene homologous recombination plasmid, and introduce the homologous recombination plasmid targeting fragment into the pertussis process strain in (6) by electroporation, and use the basic culture medium for positive screening to obtain a precisely directed modified pertussis strain without redundant sequences.

[0079] The technical method for genetically engineering wild pertussis strains used in the present disclosure does not contain any antibiotic genes, retains no nucleic acid of any exogenous species, and does not contain any redundant modifications other than the target mutation.

[0080] Examples and drawings are provided below to help understand the present disclosure. However, it should be understood that these examples and drawings are only used to illustrate the present disclosure and do not constitute any limitation. The actual scope of protection of the present disclosure is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present disclosure.

[0081] Example

[0082] The sources of the wild-type pertussis strains involved in the present disclosure are: Bordetella pertussis Cs strain (CMCC 58003) and Bordetella pertussis CMCC 58030 (18323) strain.

[0083] Example 1. Effective concentration of negative screening additives

[0084] The specific method is as follows:

[0085] (1) A basal medium containing different concentrations of negative screening substances was prepared. The composition of the basal medium is shown in Table 1. Then, Bordetella pertussis Cs strain (CMCC 58003) was spread on the basal medium containing different concentrations of negative screening substances. The appropriate concentration of negative screening substances was determined. See Table 2 below.

[0086] Table 1 Basic culture medium composition

[0087] Reagent name Basic formula g / L Sodium chloride 2.50 Potassium chloride 0.20 Potassium dihydrogen phosphate 0.50 Sodium L-Glutamate 10.00 L-Proline 0.24 Tris(hydroxymethyl)aminomethane 1.50 Amino Acid Stock Solution (100×) 10.00 Bordetella pertussis growth factor (333×) 3.00 Soluble starch 5 Agar 15 Uracil 0.1 Inject water to 1000ml

[0088] Table 2 Negative screening drug types and experimental concentrations

[0089]

[0090] (2) Place the above plates in an incubator at 35±2°C for incubation to determine the effective concentration of the negative screening drug.

[0091] The results of the inhibition of the growth of pertussis bacteria by 5-fluoroorotic acid and trimethoprim are as follows: Figure 1 and Figure 2 As shown, the experimental results show that with the increase of the concentration of the negative screening drug, the growth state of the wild-type pertussis bacteria is significantly inhibited. When the concentration of the negative screening drug 5-fluoroorotic acid reaches 200 mg / L, the growth of the wild-type pertussis bacteria can be fully inhibited. When the concentration of the negative screening drug trimethoprim reaches 100 mg / L, the growth of the wild-type pertussis bacteria can be fully inhibited.

[0092] Example 2. Genetic modification of pertussis bacteria

[0093] In this example, an endogenous screening marker is used in combination with a negative screening drug to achieve positive and negative screening during the transformation process, thereby achieving the effects of gene editing and efficient screening. The flow chart of the experiment is shown in the figure. Figure 3 shown.

[0094] In this embodiment, the operation steps are as follows:

[0095] (1) Using the pyrE gene (Gene ID: 69603377) as a screening tag (the first nutritional screening gene), synthesizing DNA from the upstream and downstream sequences of the pyrE gene coding sequence, constructing a targeting fragment with pyrE gene deletion, and connecting the targeting fragment to a plasmid to construct a homologous recombination plasmid containing the targeting fragment;

[0096] (2) 2 μg of the target fragment DNA was electroporated into 200 μL of Bordetella pertussis Cs strain (CMCC58003) at a voltage of 1000 V / mm, and negative selection was performed by adding 200 mg / L of the growth factor analog 5-fluoroorotic acid to the basal culture medium (formula see Table 1) to obtain a pertussis auxotrophic strain;

[0097] (3) synthesizing DNA of the upstream sequence of the coding sequence of the PT gene (target gene, first genetic element) (NCBI Reference Sequence: NC002929.23987858-3992567), the coding sequence of the pyrE gene (second nutritional screening gene), and the downstream sequence of the PT coding sequence, and integrating them into the homologous recombination plasmid to construct a homologous recombination plasmid in which the pyrE gene replaces the PT gene;

[0098] (4) introducing the homologous recombination targeting fragment in (3) into the auxotrophic strain in (2) using the conditions in (2) and performing positive screening using a culture medium (the formula of which is shown in Table 1, which does not contain the remedial growth factor uracil) to obtain a pertussis strain with a PT gene knockout;

[0099] (5) synthesizing DNA of the upstream sequence of the PT coding sequence (target gene, the first genetic element), the PT coding gene, and the downstream sequence of the PT coding sequence, and integrating them into the homologous recombination plasmid by restriction endonuclease digestion to construct a homologous recombination plasmid of the PT coding gene;

[0100] (6) preparing a PT mutant (second genetic element) homologous recombination plasmid containing Arg9-Lys9 and Glu129-Gly129 mutations by point mutation, introducing the homologous recombination plasmid targeting fragment into the recombinant zygosaccharomyces by electroporation under the conditions described in (2), and performing negative screening using the culture medium described in (2) to obtain a pertussis auxotrophic strain with gene mutation and detoxification of PT;

[0101] (7) Synthesize DNA of the upstream sequence of the pyrE gene (first nutritional screening gene) coding sequence, the pyrE gene coding sequence and the downstream sequence of the pyrE gene coding sequence, and integrate them into the homologous recombination plasmid through restriction endonuclease digestion to construct a homologous recombination plasmid that complements the pyrE gene. The homologous recombination plasmid is introduced into the detoxified PT antigen pertussis nutritional deficiency strain in (6) by electroporation, and the basic culture medium in (4) is used for positive screening to obtain the gene-edited gene-detoxified pertussis strain.

[0102] Example 3. Molecular Biological Assay of Genetically Recombinant Bordetella Pertussis

[0103] The genetically recombinant Bordetella pertussis obtained by the transformation was cultured in a basic culture medium at 37°C to the logarithmic phase. After the genetic material of the bacteria was extracted, PCR was used to specifically amplify the original edited during the transformation process. The amplified fragments were sequenced and analyzed by Sanger sequencing to confirm that the modified target sequence was accurate and the removal and complementation of the screening markers were complete.

[0104] In this example, the gene-edited gene-free pertussis strain obtained in Example 2 was cultured, and the genetic material of the strain was extracted and then amplified by PCR for sequencing analysis. The wild-type PTx S1 sequence is shown in SEQ ID NO: 1, and the PTx S1-R9K-E129G sequence of the gene-edited gene-free pertussis strain is shown in SEQ ID NO: 2. Figure 4 , Figure 5 The results show that the genetically engineered pertussis strain obtained by the construction scheme described in Example 2 is modified strictly according to the established design, wherein there are only two base substitutions, which will result in the 9th R being replaced by K and the 129th E being replaced by G in the pertussis toxin S1 subunit. At the same time, the complementation of the marker gene pyrE used in the screening process is complete, and there are no other redundant mutations.

[0105] Example 4. Virulence reduction test of gene-detoxified pertussis bacteria

[0106] At least three groups of mice weighing 16 to 18 g were used, with 10 mice in each group. 0.05 ml of bacterial solution (wild-type CS-WT (CMCC 58003) and gene-free pertussis strain CS-PTg (PT-9K129G) obtained in Example 2) diluted with PBS and cultured for 24 hours were dripped into the nasal cavity under anesthesia. The mice were observed for 14 days, and the life and death of the mice were recorded. The LD50 was calculated according to the Reed-Muench method. The bacterial count of 1 LD50 should not be higher than 1.2×10 8 The results are shown in Table 3 below.

[0107] Table 3 Virulence detection of gene-free pertussis bacteria

[0108]

[0109]

[0110] According to the data analysis of the above toxicity tests, compared with the wild-type pertussis bacteria, the LD50 concentration of the genetically detoxified (PT-9K129G) pertussis bacteria increased significantly, indicating that the toxicity of the pertussis bacteria after genetic engineering modification of the detoxified pertussis toxin decreased.

[0111] In addition, the virulence test results of the gene-detoxified (PT-9K129G) pertussis bacteria showed that it still had a certain degree of toxicity. Analysis showed that this was due to the fact that it also contained virulence factors such as ACT, TCT, LPS and skin necrosis factor.

[0112] Example 5. Characterization of Genetically Detoxified Pertussis Toxin Antigen after Purification

[0113] The gene-free pertussis strain CS-PTg obtained in Example 2 was fermented and purified by ammonium sulfate precipitation and column chromatography to a purity of 95%, and the PT-R9K-E129G protein and wild-type PT toxin standard (purchased from China Food and Drug Inspection Institute) were tested according to the following method:

[0114] 1. Separate samples using 10%-20% SDS-PAGE precast gel;

[0115] 2. Transfer the samples on the SDS-PAGE gel to the PVDF membrane;

[0116] 3. Block the PVDF membrane with the target protein transferred with 5% milk blocking solution for 1 hour at room temperature;

[0117] 4. Transfer to 5% milk and dilute the primary antibody (Anti PTx S1 subunit) at a dilution of 1:2000 and incubate for 2 hours;

[0118] 5. Wash with PBST for 5 min, 5 times;

[0119] 6. Transfer to 5% milk and dilute the secondary antibody (goat anti-rabbit IgG (H+L) X-Adsorbed-HRP) at a dilution of 1:10000 and incubate for 1 hour;

[0120] 7. Wash with PBST for 5 min, 5 times;

[0121] 8. Add Pro-light HRP Chemiluminescent Kit and develop color. Record the results.

[0122] The results of quality evaluation of SDS-PAGE identification and immunoblotting (WB-anti S1) identification were as follows: Figure 6 , Figure 7 As shown, from the data analysis of the above tests, the results showed that the PT-R9K-E129G (rPTg) antigen maintained a multi-subunit configuration of five subunits like the wild-type PT antigen; at the same time, immunoblotting analysis was performed using a specific antibody against the PTx-S1 subunit, and the results showed that the gene-detoxified (PT-9K129G, rPTg) antigen, like the wild-type antigen, could be recognized by the specific antibody against the PTx-S1 subunit.

[0123] Example 6. Activity test of genetically detoxified pertussis toxin antigen - CHO cell cluster method

[0124] The fermented and finely purified PT-R9K-E129G (rPTg) and wild-type PT toxin standards were diluted 2-fold in a 96-well cell culture plate. The volume after dilution was 120 μL. Then 100 μL was transferred to a CHO cell culture plate that had been cultured overnight (cell inoculation volume was 100 μL / well, 2×10 4 Cell suspension (cells / ml) was added and cultured in a 37°C, 5% CO2 incubator for 48 hours. After the culture was completed, the cell clustering was directly observed under a microscope or the 96-well cell plate was directly taken out for staining observation (remove the cell culture medium and add PBS, 200 μL per well, rinse twice, pat dry and air dry in a ventilated place for 10 minutes. Add methanol, 100 μL per well, and fix at room temperature for 10 minutes. Discard the methanol and pat dry, add Giemsa stain, 100 μL per well, and stain at room temperature for 10 minutes. Discard the stain and wash off the background color with purified water). Record the results.

[0125] Test establishment conditions and result judgment criteria:

[0126] Test establishment conditions: the cell control should not produce cell clustering reaction; the PT standard causes cell clustering reaction at a concentration of 0.2-1.2 ng / ml.

[0127] The test result judgment criteria: if the cells are not clustered, it is judged as "-"; if the cells are clustered, it is judged as "+".

[0128] The experimental results are as follows Figure 8 As shown, the experimental results indicate that the pertussis toxin with two amino acid residues replaced by gene editing achieved the goal of reducing toxicity. The evaluation indicators of the CHO cell clustering method showed that the pertussis toxin was perfectly removed by gene detoxification, allowing CHO cells to produce clustering activity.

[0129] Example 7. Activity test of genetically detoxified pertussis toxin antigen - mouse histamine sensitization method

[0130] The toxicity reference substance (wild-type PT toxin standard substance, purchased from the China Food and Drug Inspection Institute) was diluted according to the label of each batch, and the finely purified PT-R9K-E129G was diluted to a concentration of 50μg / ml. NIH mice weighing 14-16g (female or half male and half female) were used, and each dilution of the toxicity reference substance and the test substance were used in one group, with at least 10 mice in each group. Each mouse was intraperitoneally injected with 0.5ml, and tests a to b were performed respectively.

[0131] a) Mouse leukocytosis test

[0132] Three days after the injection, peripheral blood samples were collected from the mice for white blood cell count. After the test results were processed by statistical methods, the activity of leukocytosis toxicity in mice injected with the test sample should not be higher than 0.5LPU / ml.

[0133] b) Histamine sensitization test in mice

[0134] Four days after the injection, each mouse was intraperitoneally injected with 0.5 ml of solution (containing 4 mg of histamine dihydrochloride or 2 mg of histamine diphosphate), and the rectal temperature of the mice was measured 30 minutes later. After the test results were processed by statistical methods, the activity of the test product in mouse histamine sensitization toxicity should not be higher than 0.8 HSU / ml, and no animals died.

[0135] Table 4 PT-R9K-E129G residual toxicity test - mouse histamine sensitization method

[0136]

[0137] The experimental results are shown in Table 4. The experimental results indicate that the pertussis toxin with two amino acid residues replaced by gene editing achieved the goal of reducing toxicity. The evaluation indicators of the mouse histamine sensitization method showed that the pertussis toxin was perfectly removed by gene detoxification, causing the mice to produce toxicity such as hypothermia and / or animal death under fixed histamine challenge conditions.

[0138] Example 8. Immunogenicity test of genetically detoxified pertussis toxin Bacillus pertussis

[0139] 1. Test materials

[0140] 1.1 Animals

[0141] NIH mice of the same sex or half male and half female weighing 10-12 g.

[0142] 1.2 Pertussis reference vaccine

[0143] Distributed by the National Drug Control Agency. Dilute the reference vaccine according to the labeled amount.

[0144] 1.3 Test products

[0145] After sterilization with 0.08% formaldehyde, dilute the test sample to an appropriate concentration. The half effective dose (ED 50) should be within the dilution concentration range used.

[0146] 1.4 Attack bacteria and attack bacterial solution

[0147] The challenge bacteria was Bordetella pertussis CMCC 58030 (18323) strain, and the culture was carried out using Bao-Jiang medium (containing 20% ​​to 30% sheep blood, the formula is shown in Table 5).

[0148] Table 5 Composition of Jiang's medium

[0149] Reagent name Basic formula (1L) glycerin 10ml Bao-Jiang medium 30g Defibrinated sheep blood 300ml Water for injection Make up to 1000ml

[0150] The first generation of bacteria can be stored at 2-8°C for 2 weeks. The culture time of the bacteria during the attack is 20-24 hours.

[0151] After the bacterial moss cultured for 20 to 24 hours was visually examined to be pure, it was scraped into 0.85% to 0.90% sodium chloride or PBS (7.2 to 7.4) solution, filtered with sterile absorbent cotton, and the concentration was determined. Then, it was diluted with diluent to a concentration of 8.0×10 bacteria per 0.03 ml. 4 , as the attack bacterial solution of the test group. Then it was diluted continuously so that each 0.03 ml contained 8000 bacteria, 800 bacteria, 80 bacteria and 8 bacteria respectively. The above 5 different dilutions of bacterial solution were used as the attack bacterial solution of the control group to determine the LD50 of the attack bacterial solution.

[0152] 2. Experimental steps

[0153] 2.1 Immunity

[0154] Use three dilutions of the reference vaccine and the test article to immunize mice (the difference between each dilution should not exceed 5 times), immunize 20 mice (same sex or half male and half female) for each dilution, and inject 0.5 ml into each mouse intraperitoneally. At the same time, raise 55-60 mice as controls.

[0155] 2.2 Attack

[0156] 14-16 days after the mice were immunized, the survival rate of mice immunized with each dilution of the reference vaccine and the test article should be at least 94%. Each mouse was injected with 0.03 ml of bacterial solution (containing 8.0×10 4 ). The experiment was carried out according to the requirements of 1.4. A control group was set up to determine the LD50 of the challenge bacteria. Five dilutions were set for each group, and 10 mice were challenged for each dilution of the control group.

[0157] 3. Observation of results

[0158] The mice were observed for 14 days after the attack. On the third day after the attack, the experimental groups had 16 animals in each group. The animals were observed daily and the number of deaths was recorded. Animals that died in the first three days were not counted. Animals with paralysis, head swelling, hunched back, and obvious hair ruffling on the 14th day were also counted as dead.

[0159] 4. Result calculation and judgment

[0160] The titer of the test article was calculated by the mass-reaction parallel line method.

[0161] After the test sample is diluted according to the concentration of the finished vaccine, the immune titer of each human dose should not be less than 4.0 IU, and the lower limit of the 95% confidence limit should not be less than 2.0 IU. If the above requirements are not met, a retest can be conducted, but the results of all valid tests must be calculated using the geometric mean (if the probability analysis method is used, the weighted geometric mean should be used). If the above requirements are met, it will be considered qualified.

[0162] 5. Conditions for the test to be established:

[0163] The ED50 of the reference vaccine and the test article should be between the maximum and minimum immunizing doses.

[0164] The dose-response curves of the reference vaccine and the test article have no significant deviation in parallelism and linearity. The LD 50 of the challenge bacteria should be calculated by the Reed-Muench method, and the LD 50 of the challenge bacteria should be in the range of 100 to 1000. The time from the preparation of the challenge bacteria (starting to scrape the bacteria) to the injection of the last mouse should not exceed 2.5 hours.

[0165] Table 6. Back titration of challenge bacteria

[0166]

[0167] Table 7. Protection of animals after immunization with gene-detoxified pertussis fluid (sterilized)

[0168]

[0169]

[0170] The experimental results are shown in Tables 6 and 7. The experimental results show that the back titer of the challenge bacteria is 298.21, which meets the experimental requirements and the challenge experiment results are reliable. The immunogenicity of the inactivated gene-detoxified pertussis bacteria was evaluated by the brain cavity attack method, and the results showed that the pertussis efficacy was 13.360 IU / ml, indicating that the gene-detoxified pertussis bacteria still have good immune protection effects and have the potential to develop new vaccine products.

[0171] Example 9. Immunogenicity testing of genetically detoxified pertussis toxin antigen

[0172] 1. Test materials

[0173] 1.1 Animals

[0174] NIH mice of the same sex or half male and half female weighing 10-12 g.

[0175] 1.2 Test products

[0176] Aluminum adsorbed products with different formulation amounts; the aluminum adjuvant dosage is 0.5 mg / dose, and the antigen addition amounts are 0.5 μg, 1 μg, 2.5 μg, 5 μg, 15 μg, and 25 μg, respectively.

[0177] 1.3 Attacking bacteria and attacking bacterial solution

[0178] The challenge bacteria was Bordetella pertussis CMCC 58030 (18323) strain, and the culture was carried out using Bao-Jiang medium (containing 20% ​​to 30% sheep blood, the formula is shown in Table 5).

[0179] The first generation of bacteria can be stored at 2-8°C for 2 weeks. The culture time of the bacteria during the attack is 20-24 hours.

[0180] After the bacterial moss cultured for 20 to 24 hours was visually examined to be pure, it was scraped into 0.85% to 0.90% sodium chloride or PBS (7.2 to 7.4) solution, filtered with sterile cotton wool, and the concentration was determined. Then, it was diluted with an appropriate diluent to a concentration of 8.0 × 10 bacteria per 0.03 ml. 4 , as the attack bacterial solution of the test group. Then it was diluted continuously so that each 0.03 ml contained 8000 bacteria, 800 bacteria, 80 bacteria and 8 bacteria respectively. The above 5 different dilutions of bacterial solution were used as the attack bacterial solution of the control group to determine the LD50 of the attack bacterial solution.

[0181] 2. Experimental steps

[0182] 2.1 Immunity

[0183] The above adsorption products with different immunization doses were used to immunize mice, 20 mice (same sex or half male and half female) were immunized for each dilution, and each mouse was intraperitoneally injected with 0.5 ml. At the same time, 55 to 60 mice were raised as controls.

[0184] 2.2 Attack

[0185] 21 days after the mice were immunized, the survival rate of the mice immunized with the reference vaccine and the test sample at each dilution should be at least 94%. Each mouse was injected with 0.03 ml of bacterial solution (containing 8.0×10 4). The experiment was carried out according to the requirements in 1.3, and a control group was set up to determine the LD50 of the challenge bacteria. Five dilutions were set for each group, and 10 mice were challenged for each dilution of the control group.

[0186] 3. Observation of results

[0187] The mice were observed for 14 days after the attack. On the third day after the attack, the experimental groups had 16 animals in each group. The animals were observed daily and the number of deaths was recorded. Animals that died in the first three days were not counted. Animals with paralysis, head swelling, hunched back, and obvious hair ruffling on the 14th day were also counted as dead.

[0188] 4. Calculation of results

[0189] The ED50 of the antigen after gene detoxification was calculated according to the Reed-Muench method.

[0190] 5. Conditions for the test to be established

[0191] Calculate LD50 using the Reed-Muench method; the LD50 of the attacking bacteria should be in the range of 100 to 1000.

[0192] The time from preparation of challenge bacteria (start of scraping bacteria) to injection of the last mouse should not exceed 2.5 hours.

[0193] Table 8. Animal protection status of PT-R9K-E129G test article

[0194]

[0195] Table 9. Back-tick situation of attack bacteria

[0196]

[0197]

[0198] The experimental results are shown in Tables 8 and 9. The experimental results show that the back titer of the challenge bacteria is 316.8, which meets the experimental requirements and the challenge experiment results are reliable; PT-R9K-E129G will not cause animal death at a dose of 25 μg / dose, indicating that PT-R9K-E129G has excellent safety compared with the wild-type PT, and 50% animal protection can be achieved at an extremely low dose of 0.683 μg / dose, indicating that PT-R9K-E129G has good immune protection effect and is very suitable for the research and development of new vaccines for the prevention of pertussis disease.

[0199] Sequence 1: Wild-type PTx S1 sequence (SEQ ID NO.: 1)

[0200] ATGCGTTGCACTCGGGCAATTCGCCAAACCGCAAGAACAGGCTGGCTGACGTGGCTGGCGATTCTTGCCGTCACGGCGCCCGTGACTTCGCCGGCATGGGCCGACGATCCTCCCGCCACCGTATAC CGC TATGACTCCCGCCCGCCGGAGGACGTTTTCCAGAACGGATTCACGGCGTGGGGAAACAACGACAATGTGCTCGACCATCTGACCGGACGTTCCTGCCAGGTCGGCAGCAGCAACAGCGCTTTCGTCTCCACCAGCAGCAGCCGGCGCTATACCGAGGTCTATCTCGAACATCGCATGCAGGAAGCGGTCGAGGCCGAACGCGCCGGCAGGGGCACCGGCCACTTCATCGGCTACATCTACGAAGTCCGCGCCGACAACAATTTCTACGGCGCCGCCAGCTCGTACTTCGAATACGTCGACACTTATGGCGACAATGCCGGCCGTATCCTCGCCGGCGCGCTGGCCACCTACCAGAGC GAA TATCTGGCACACCGGCGCATTCCGCCCGAAAACATCCGCAGGGTAACGCGGGTCTATCACAACGGCATCACCGGCGAGACCACGACCACGGAGTATTCCAACGCTCGCTACGTCAGCCAGCAGACTCGCGCCAATCCCAACCCCTACACATCGCGAAGGTCCGTAGCGTCGATCGTCGGCACATTGGTGCGCATGGCGCCGGTGATAGGCGCTTGCATGGCGCGGCAGGCCGAAAGCTCCGAGGCCATGGCAGCCTGGTCCGAACGCGCCGGCGAGGCGATGGTTCTCGTGTACTACGAAAGCATCGCGTATTCGTTCTAG

[0201] Sequence 2: PTx S1-R9K-E129G (SEQ ID NO.:2)

[0202] ATGCGTTGCACTCGGGCAATTCGCCAAACCGCAAGAACAGGCTGGCTGACGTGGCTGGCGATTCTTGCCGTCACGGCGCCCGTGACTTCGCCGGCATGGGCCGACGATCCTCCCGCCACCGTATAC AAA TATGACTCCCGCCCGCCGGAGGACGTTTTCCAGAACGGATTCACGGCGTGGGGAAACAACGACAATGTGCTCGACATCTGACCGGACGTTCCTGCCAGGTCGGCAGCAGCAACAGCGCTTTCGTCTCCACCAGCAGCAGCCGGCGCTATACCGAGGTCTATCTCGAACATCGCATGC AGGAAGCGGTCGAGGCCGAACGCGCCGGCAGGGGCACCGGCCACTTCATCGGCTACATCTACGAAGTCCGCGCCGACAACAATTTCTACGGCGCCGCCAGCTCGTACTTCGAATACGTCGACACTTATGGCGACAATGCCGGCCGTATCCTCGCCGGCGCGCTGGCCACCTACCAGAGC GGA TATCTGGCACACCGGCGCATTCCGCCCGAAAACATCCGCAGGGTAACGCGGTCTATCACAACGGCATCACCGGCGAGACCACGACCACGGAGTATTCCAACGCTCGCTACGTCAGCCAGCAGACTCGCGCCAATCCCAACCCCTACACATCGCGAAGGT CCGTAGCGTCGATCGTCGGCACATTGGTGCGCATGGCGCCGGTGATAGGCGCTTGCATGGCGCGGCAGGCCGAAAGCTCCGAGGCCATGGCAGCCTGGTCCGAACGCGCCGGCGAGGCGATGGTTCTCGTGTACTACGAAAGCATCGCGTATTCGTTCTAG

[0203] The technical solution of the present disclosure is not limited to the above-mentioned specific embodiments, and all technical variations made according to the technical solution of the present disclosure fall within the protection scope of the present disclosure.

Claims

1. A method for genetic modification of Bordetella pertussis, comprising: 1) knocking down or knocking out the first nutritional screening gene of Bordetella pertussis to produce a first nutritional deficiency cell; 2) in the first auxotrophic cell obtained in step 1), replacing the first genetic element with a second nutrient screening gene by recombination treatment to obtain a second auxotrophic cell containing the second nutrient screening gene; 3) genetically modifying the first genetic element in vitro to obtain a second genetic element; 4) Recombining the second genetic element to replace the second nutritional screening gene in the second auxotrophic cell obtained in step 2) to obtain a third auxotrophic cell; and 5) The first nutritional screening gene is restored to the genome of the third nutritional deficiency cell obtained in step 4) through recombination treatment to obtain genetically modified Bordetella pertussis.

2. The genetic modification method according to claim 1, characterized in that The first nutritional screening gene and the second nutritional screening gene are the same or different; Preferably, the first nutritional screening gene and / or the second nutritional screening gene are selected from endogenous genes of Bordetella pertussis; Preferably, the first nutritional screening gene and / or the second nutritional screening gene include at least one of an orotate phosphoribosyltransferase gene, a thymidylate synthetase gene or a galactokinase gene.

3. The genetic modification method according to claim 1, characterized in that In step 3), the genetic modification comprises at least one of deletion, replacement or directed modification of the first genetic element; Preferably, the genetic modification comprises one or more of genetic detoxification / attenuation of pertussis toxin, detoxification / knockout of adenylate cyclase, knockout of skin necrosis factor, genetic attenuation of tracheal cytotoxin synthesis genes, genetic attenuation of LPS, overexpression of pertussis adhesin, overexpression of filamentous hemagglutinin, reduction of peripheral membrane vesicle reactogenicity or conditional reproduction editing.

4. The genetic modification method according to claim 1, characterized in that The method further comprises repeating step 1) to step 4) to achieve multiple genetic modifications.

5. The genetic modification method according to claim 1, characterized in that In step 1), a first auxotrophic cell is produced by a negative selection method; and / or In step 2), a second auxotrophic cell containing the second nutrient screening gene is obtained by a positive screening method; and / or In step 4), a third auxotrophic cell is obtained by a negative screening method; and / or In step 5), genetically modified Bordetella pertussis is obtained by positive screening method; Preferably, the negative screening is performed in a culture medium supplemented with a growth factor analog and a salvage growth factor; more preferably, the growth factor analog includes at least one of 5-fluoroorotic acid, trimethoprim or 2-deoxy-galactose; more preferably, the salvage growth factor includes at least one of uracil or thymine; Preferably, the positive screening is performed in a culture medium containing essential growth factors associated with the first nutritional screening gene and / or the second nutritional screening gene; more preferably, the essential growth factors include at least one of histidine, leucine and glutamine; Preferably, the Bordetella pertussis includes Bordetella pertussis or Bordetella parapertussis.

6. The recombinant Bordetella pertussis cell or antigen thereof obtained by the genetic modification method according to any one of claims 1 to 5.

7. The bacterial cell or antigen thereof according to claim 6, characterized in that: The pertussis toxin (PT) gene of the recombinant Bordetella pertussis has mutations at amino acids 9 and 129, Preferably, the PT gene of the recombinant Bordetella pertussis has mutations R9K and E129G, Further preferably, the recombinant Bordetella pertussis has the nucleotide sequence shown in SEQ ID NO:

2.

8. An immune preparation comprising the recombinant Bordetella pertussis bacteria and / or its antigens obtained by the genetic modification method according to any one of claims 1 to 5.

9. Use of the recombinant Bordetella pertussis bacteria or antigens thereof according to claim 6 or 7 or the immune preparation according to claim 8 in the preparation of a vaccine for preventing pertussis and / or a drug for treating pertussis.

10. A vaccine for the prevention of pertussis and / or a drug for the treatment of pertussis, comprising an active ingredient and a pharmaceutically acceptable buffer, excipient and / or adjuvant, wherein the active ingredient comprises the recombinant pertussis bacteria and / or its antigen obtained by the genetic modification method according to any one of claims 1 to 5.

Images