Acremonium acremonium with efficient homologous recombination capacity and construction method and application of acremonium acremonium

Abstract

The invention discloses cephalosporium acremonium with efficient homologous recombination capacity as well as a construction method and application of the cephalosporium acremonium, and belongs to the technical field of microbial genetic engineering. A cephalosporium acremonium strain is used as a starting strain, the Ku70 gene is knocked out through a Spit-Marker method, the exogenous DNA homologous recombination probability of the strain is improved, the application efficiency of a gene targeting technology in the cephalosporium acremonium is greatly improved, the homologous recombination efficiency of the original strain of the cephalosporium acremonium is lower than 10%, and the homologous recombination efficiency is improved to 90% or above after the gene Ku70 is knocked out. And a basic support is provided for genetic modification by efficiently applying a gene targeting technology in the cephalosporium acremonium.

Description

Technical Field

[0001] The invention relates to a construction method of Cephalosporium acremonium with high-efficiency homologous recombination ability and its high-efficiency gene targeting application, belonging to the technical field of genetic engineering. Background Art

[0002] Cephalosporin C is an important precursor of cephalosporin antibiotics widely used in clinical practice. Its advantages include strong stability, broad-spectrum resistance and low toxicity. At present, cephalosporin C is produced by fermentation of the filamentous fungus Acremonium chrysogenum in the pharmaceutical industry. Due to the lack of a complete genetic manipulation system for Acremonium chrysogenum, the technology of genetically modifying Acremonium chrysogenum strains using modern genetic engineering and metabolic engineering methods such as gene knock-in, gene knock-out and genome editing technology urgently needs to be further developed and optimized. In view of the market prospects of cephalosporin antibiotics, the modification of Acremonium chrysogenum strains through synthetic biology technologies such as metabolic engineering will lay the foundation for improving the fermentation production level of cephalosporin C and reducing production costs.

[0003] Gene targeting technology is an important research method in modern molecular genetics, and plays a vital role in the research of microbial functional genomics and genetic engineering of functional strains. Gene targeting technology usually refers to the homologous recombination between DNA fragments containing known sequences and the target region of the genome of the recipient cell, integrating the donor DNA fragment into the cell recipient genome, adding exogenous DNA fragments at specific target sites or deleting DNA fragments between target sites. Gene targeting technology can achieve a variety of molecular genetic modification strategies such as site-directed overexpression of target genes, gene knockout, gene replacement and promoter replacement. Gene targeting technology causes DNA double-strand breaks in organisms, and cells mainly repair DNA double-strand breaks in two ways, namely homologous recombination and non-homologous end joining (NHEJ). The repair of DNA double-strand breaks in filamentous fungi mainly relies on the non-homologous end joining pathway, which leads to the integration of exogenous DNA into the genome mainly in the form of random insertion. The efficiency of homologous recombination is very low, which seriously limits the application of gene targeting technology. Therefore, inactivating the non-homologous end joining pathway of filamentous fungi by knocking out the Ku70 or Ku80 gene can significantly increase the probability of exogenous DNA integrating into the genome by homologous recombination, which is of great significance. Summary of the invention

[0004] In order to solve the technical bottleneck that the low homologous recombination ability of Cephalosporium acremonium limits the application of gene targeting technology in the field of genetic modification of Cephalosporium acremonium, the present invention provides a method for constructing Cephalosporium acremonium with efficient homologous recombination ability and its application, and the technical scheme adopted is as follows.

[0005] The purpose of the present invention is to provide a Cephalosporium acremonium with high-efficiency homologous recombination ability and a construction method and application thereof. The method uses Cephalosporium acremonium as a starting bacterium and improves the homologous recombination probability of exogenous DNA by knocking out the Ku70 gene.

[0006] In one embodiment, the present application provides a method for improving the application efficiency of Cephalosporium acremonium gene targeting technology, characterized in that it includes using a Split-Marker method to knock out the Ku70 gene in the Cephalosporium acremonium strain to increase the probability of homologous recombination of exogenous DNA in the strain.

[0007] In another embodiment, the step of knocking out the Ku70 gene includes: (1) using the genome of Cephalosporium acremonium as a template, amplifying the upstream sequence Up-border and the downstream sequence Down-border of the Ku70 gene by PCR, and using the plasmid pHyg as a template to amplify the 5' end partial sequence and the 3' end partial sequence of the selection marker hygromycin phosphotransferase gene hph expression cassette by PCR, wherein the overlapping portion of the 5' end partial sequence and the 3' end partial sequence of the hph gene expression cassette is 300-900 bp in length; (2) using the fusion PCR technology, the upstream sequence Up-border obtained in step (1) is fused with the 5' end partial sequence of the hph gene expression cassette to obtain a fusion product and use it as the targeting element AcKu70-A, and the downstream sequence Down-border obtained in step (1) is fused with the 3' end partial sequence of the selection marker hph gene expression cassette to obtain a fusion product and use it as the targeting element AcKu70-B; the overlapping portion of AcKu70-A and AcKu70-B is the 300-900 bp overlapping sequence obtained in step (1). In Cephalosporium acremonium, two incomplete selection marker hph gene expression cassette fragments can be combined into a complete hph gene expression cassette by homologous recombination at the overlapping parts.

[0008] In another embodiment, the step of knocking out the Ku70 gene also includes: (3) preparing Cephalosporium acremonium protoplasts, and then simultaneously transforming the targeting element AcKu70-A and the targeting element AcKu70-B obtained in step (2) into the Cephalosporium acremonium protoplasts for cultivation to obtain transformants; (4) screening the transformants in which the Ku70 gene was knocked out in step (3) to obtain recombinant Cephalosporium acremonium with improved homologous recombination ability.

[0009] In another embodiment, the step of knocking out the Ku70 gene further includes: (5) the primer sequence for amplifying the Up-border is shown in SEQ ID N0.1-SEQ ID N0.2; the primer sequence for amplifying the Down-border is shown in SEQ ID N0.3-SEQ ID N0.4, the primer sequence for amplifying the 5' end partial sequence of the screening marker hph gene expression cassette is shown in SEQ ID N0.5-SEQ ID N0.6; the primer sequence for amplifying the 3' end partial sequence of the screening marker hph gene expression cassette is shown in SEQ ID N0.7-SEQ ID N0.8. The sequence of the targeting element AcKu70-A is shown in SEQ ID N0.9, and the sequence of the targeting element AcKu70-B is shown in SEQ ID N0.10.

[0010] In another embodiment, the screening of Ku70 gene knockout transformants is performed by screening transformants through hygromycin resistance, then verifying the transformation of the Ku70 gene knockout through genomic PCR, and obtaining the pure recombinant bacteria Ac-△Ku70 through continuous subculture and hygromycin resistance screening.

[0011] In one embodiment, the present application provides a recombinant strain of Cephalosporium acremonium with efficient homologous recombination ability, which is prepared by any of the methods described above.

[0012] In another embodiment, the exogenous DNA homologous recombination efficiency of the recombinant bacteria is greatly improved compared with that of the Cephalosporium acremonium strain, which is the Ku70 gene deleted strain Ac-△Ku70.

[0013] In one embodiment, the present application also includes the use of recombinant Cephalosporium acremonium in microbial genetic engineering for genetic modification related to gene targeting technology.

[0014] In another embodiment, the genetic modification associated with the gene targeting technology is gene knockout, gene knock-in, gene replacement or promoter replacement.

[0015] In another embodiment, the genetic modification associated with the gene targeting technology is long-segment deletion of the genome.

[0016] Beneficial effects achieved by the present invention:

[0017] The recombinant strain of Cephalosporium acremonium provided by the present invention has the advantage of high efficiency of homologous recombination of exogenous DNA, so that the application efficiency of gene targeting technology in Cephalosporium acremonium is improved, and research method support is provided for efficiently applying gene targeting technology in Cephalosporium acremonium for genetic transformation and improving the production efficiency of cephalosporin C.

[0018] Using Cephalosporium acremonium as the starting strain, the Ku70 gene was knocked out to construct the recombinant strain Ac-△Ku70 with improved exogenous DNA homologous recombination efficiency. Before the transformation, the exogenous DNA homologous recombination efficiency in Cephalosporium acremonium CGMCC 3.3795 strain was less than 10%, while the exogenous DNA homologous recombination efficiency in the recombinant strain Ac-△Ku70 was increased to more than 90%. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the knockout principle of the cefR gene in Cephalosporium acremonium.

[0020] Figure 2 This is a diagram showing the genomic PCR verification results of the transformants obtained by knocking out the cefR gene of Cephalosporium acremonium; the upper figure is the verification result of primers hph-F / hph-R, the lower figure is the verification result of primers UpcefR-F / hph-R, and lanes 1-17 are the PCR verification results of 17 transformants.

[0021] Figure 3 Schematic diagram of the targeting element for knocking out the Ku70 gene and its homologous recombination to knock out the Ku70 gene; F1 is primer Up-check-F1, F2 is primer Up-check-F2, F3 is primer UpKu70-F, F4 is primer Ku70-F, F5 is primer hyg-F, R1 is primer Dw-check-R1, R2 is primer Dw-check-R2, R3 is primer hyg-R, and R4 is primer Ku70-R.

[0022] Figure 4 The results of PCR verification of the genome of the transformants obtained by knocking out the Ku70 gene; 1-3 are three transformants, and A of each transformant is Figure 3 The results of the primer UpKu70-F / hph-R (F3 / R3) were verified. Figure 3 The results of primers hyg-F / hyg-R (F5 / R3) were verified; C is Figure 3 The results of the primer Up-check-F1 / hyg-R (F1 / R3) verification; D is Figure 3 The results of the primer Up-check-F2 / hyg-R (F2 / R3) verification are shown in Figure 2. Figure 3 The results of the validation of the primers Ku70-F / Ku70-R (F4 / R4), F is Figure 3 The results of primer hyg-F / Dw-check-R2 (F5 / R2) were verified; G is Figure 3 The results were verified using the middle primers hyg-F / Dw-check-R1 (F5 / R1).

[0023] Figure 5Schematic diagram of cefR gene knockout in recombinant strain Ac-△Ku70 and genomic PCR verification results of the transformants obtained; the upper figure is a schematic diagram of the cefR gene knockout principle, the lower figure is the verification result of primer UpcefR-F / bar-check-R, and lanes 1-16 are the PCR verification results of 16 transformants. DETAILED DESCRIPTION

[0024] The present invention is further described below in conjunction with specific embodiments, but the present invention is not limited by the embodiments.

[0025] Unless otherwise specified, the experimental materials, reagents, instruments and methods used in the following examples are conventional experimental materials, reagents, instruments and methods in the art and can be purchased through commercial channels.

[0026] In the present invention, the plasmid extraction adopts the Trans EasyPure Plasmid Mini Prep Kit of Quanshijin Company, the DNA fragment recovery adopts the Cycle-Pure Kit (D6492-01) of OMEGA Company, and the gel recovery adopts the Quick Gel Extraction Kit (EG101-01) of Quanshijin Company.

[0027] Osmotic pressure buffer: 0.6 M KCl, 25 mM CaCl2, 10 mM MgCl2.

[0028] CSL culture medium: corn slurry 30 g / L, soluble starch 30 g / L, glucose 10 g / L, CaCO3 5 g / L, pH 6.8 before sterilization (add 20 g / L agar powder to the solid culture medium).

[0029] YPS medium: sucrose 20 g / L, yeast powder 5 g / L, polypeptone 20 g / L, K2HPO4 1 g / L, MgSO4·7H2O1 g / L, pH 7.0 before sterilization.

[0030] Upper soft agar medium: 0.6M KCl, 25mM CaCl2, 10mM MgCl2, agar powder 7g / L.

[0031] Regeneration medium: malt extract 100 (v / v), maltose 40 g / L, polypeptone 20 g / L, sucrose 20 g / L, 0.6M KCl, 25mM CaCl2, 10mM MgCl2, agar powder 20 g / L, pH 7.0 before sterilization.

[0032] Example 1: Analysis of the homologous recombination integration efficiency of exogenous DNA in the starting strain of Cephalosporium acremonium

[0033] 1.1 Construction of targeting elements for the regulatory gene cefR (HM230824.1) of the cephalosporin C biosynthesis gene cluster of Cephalosporium acremonium

[0034] Primers UpcefR-F, UpcefR-R, DwcefR-F and DwcefR-R were designed according to the information published in the genome database of Cephalosporium acremonium CGMCC 3.3795. The genome of Cephalosporium acremonium strain CGMCC 3.3795 was used as a template and PCR amplification was performed using pfuDNA polymerase (Novozymes 2×Phanta Max Master Mix, Catalog No.P515-01). Primers UpcefR-F / UpcefR-R were used to amplify the upstream sequence Up-border of the cefR gene with a size of 1.5 kb, and primers DwcefR-F / DwcefR-R were used to amplify the downstream sequence Down-border of the cefR gene with a size of 1.5 kb. The filamentous fungus plasmid pHyg (Skatrud, P. L. et al.. Efficient integrative transformation of Cephalosporium acremonium [J]. Current Genetics, 1987, 12 (5): 337-348.) was used as a template and primers hph-F (5'-tcgacagaagatgatattgaaggagc-3') and hph-R (5'-aagaaggattacctctaaacaagtgtac-3') were used for PCR amplification to obtain a hygromycin resistance selection marker hph gene expression cassette with a size of 2.13 kb. The above PCR product was detected by 1.0% agarose gel electrophoresis and purified by gel excision recovery. The Up-border fragment, the Down-border fragment and the hph gene expression cassette fragment were fused by fusion PCR technology, and the fusion PCR product was used as a template, and UpcefR-F and DwcefR-R were used as primers to amplify the cefR gene targeting element cefR-KO1 fragment of 5.13 kb (such as Figure 1 , where hph is the selection marker hygromycin resistance gene expression cassette, cefR is the gene to be knocked out, Up-border is the upstream homology arm, and Down-border is the downstream homology arm).

[0035] 1.2 Protoplast preparation

[0036] The cells of Cephalosporium acremonium CGMCC 3.3795 were inoculated into CSL liquid fermentation medium; the culture was shaken at 220 rpm and 28°C for 4 days. The culture in CSL medium was inoculated into YPS liquid medium at a volume ratio of 10%, and the culture was shaken at 28°C and 220 rpm for 16-20 hours. The mycelia were collected by centrifugation at 7000 rpm for 5 minutes, washed 2-3 times with osmotic pressure buffer, and the cells were collected by centrifugation, resuspended in osmotic pressure buffer containing 10 mM DTT, and incubated at 100 rpm and 28°C for 1 hour. The cells were collected by centrifugation at 7000rpm for 5min, washed 2-3 times with osmotic pressure buffer (centrifugation at 7000rpm for 5min each time), and 10mL of enzymatic solution (the enzymatic solution composition is: 0.3% cellulase, 0.3% lysing enzyme and 0.4% compound enzyme Yatalase, which were sterilized by filtration through a 0.22μm sterile microporous filter membrane), and enzymatic solution was performed at 30℃ and 100rpm for 2-3h, and the protoplasts were examined under a microscope until the mycelium released a large number of protoplasts. Five volumes of osmotic pressure buffer were added to the enzymatic solution to terminate the reaction, and the mycelium was removed by filtration with 4-6 layers of sterilized lens paper. The filtrate was centrifuged at 2000rpm for 5min to collect the protoplasts, and the protoplasts were washed with osmotic pressure buffer to remove the residual enzymatic solution, and then the protoplasts were resuspended with an appropriate amount of osmotic pressure buffer, and the protoplasts were divided into 100uL / tube for polyethylene glycol mediated genetic transformation of exogenous DNA protoplasts.

[0037] 1.3 Protoplast transformation and screening verification

[0038] Add 10 μL of cefR-KO1 fragment (about 5 μg) to 100 μL of the above protoplast suspension, place on ice for 30 min, then add 900 μL of PEG buffer (30% PEG6000, 25 mM CaCl2, 25 mMTris-HCl, pH 8.0), mix gently and place at room temperature for 20 min. Wash the protoplast cell suspension with osmotic pressure buffer to remove the residual PEG, then mix the protoplast cells with the upper soft agar medium that is sterilized and kept at 45°C, mix gently, and evenly spread on 4-6 solid regeneration medium plates containing 100 mg / L hygromycin B for protoplast cell wall regeneration, and culture upright in a 28°C incubator for 1 day, and inverted for 5-7 days, and regenerated transformants grow out.

[0039] Positive transformant screening was to select transformants with hygromycin resistance from the transformation regeneration plate and transfer them to the screening plate CSL-H (CSL solid medium + 100 mg / L hygromycin B), culture at 28°C for 7 days for subculture purification, and subculture on the hygromycin resistance screening plate for 4 consecutive times. The cells of 17 single colony transformants were selected and inoculated into YPS liquid medium, cultured at 28°C and 220 rpm for 72 hours, and the mycelium was collected to extract the genome. Figure 1Genomic PCR was performed using the primers shown in . Figure 2 As shown in the upper middle figure, all 17 transformants have integrated the hygromycin resistance selection marker hph gene; Figure 2 As shown in the figure below, only the 8# transformant amplified a target DNA fragment of about 2.9kb that spanned the upstream DNA region of the upstream homologous arm of the cefR gene and the hph gene, indicating that the cefR-KO1 element was integrated into the cefR gene site by homologous recombination. Therefore, only the 8# transformant among the 17 transformants underwent homologous recombination of the exogenous DNA, and the homologous recombination efficiency of the exogenous DNA in the C. acremonium CGMCC 3.3795 strain was 1 / 17, or 5.9%. It can be seen that the success rate of gene knockout under this condition is 5.9%.

[0040] Example 2: Construction of a genetically engineered strain of Cephalosporium acremonium with a Ku70 gene knocked out and lacking the NHEJ pathway Ac-△Ku70

[0041] 2.1 Construction of targeting elements for knocking out the Ku70 gene using the split-marker method

[0042] Primers UpKu70-F (5'-GCTGCATCA CGGCGTGCACTGTGGCG-3', SEQ ID NO.1), UpKu70-R (5'-TGTTACTTCAGTACTAGAAGAAAAACAC-3', SEQ ID NO.2), DwKu70-F (5'-GAGGAGAACACCTGAACTTGTCTGGG-3', SEQ ID NO.3), and DwKu70-R (5'-GACGGTGATGGAGCGGCTGCTGCGGTTG-3', SEQ ID NO.4) were designed based on the information published in the genome database of Cephalosporium acremonium CGMCC 3.3795. The genomic DNA of Cephalosporium acremonium strain CGMCC 3.3795 was used as a template and pfu was used to generate the primers. PCR amplification was performed using DNA polymerase, and the upstream sequence Up-border of the Ku70 gene with a size of 1.5 kb was amplified using primers UpKu70-F / UpKu70-R, and the downstream sequence Down-border of the Ku70 gene with a size of 1.5 kb was amplified using primers DwKu70-F / DwKu70-R. Plasmid pHyg was used as a template, hyg-F (5'TTCTTCTAGTACTGAAGTAACATCGACAGAAGATGATATTGAAGGAGCA-3', SEQ ID NO.5) and hyg-926R (5'-ATTTGTGTACGCCCGACAGTCCCGG-3', SEQ ID NO.6) were used as primers to amplify the 5' end partial sequence of the hph gene expression cassette with a size of about 1.3 kb, and hyg-300F (5'-CAAGACCTGCCTGAAACCGAACTG-3', SEQ ID NO.7) and hyg-R (5'-GACAAGTTCAGGTGTTCTCCTCAAGAAGGATTACCTCTAAACAAGTG-3', SEQ ID NO.8) were used as primers to amplify the 3' end partial sequence of the hph gene expression cassette with a size of about 1.5 kb. The above PCR amplification products were detected by 1.0% agarose gel electrophoresis and purified by gel excision recovery. By using the fusion PCR method, UpKu70-F and hyg-926R were used as primers to fuse the upstream sequence Up-border with the 5' end sequence of the selection marker gene hph expression cassette to obtain a fusion product as the targeting element AcKu70-A (SEQ ID NO.9). By using hyg-300F and DwKu70-R as primers, the 3' end sequence of the selection marker gene hph expression cassette was fused with the downstream sequence Down-border to obtain a fusion product as the targeting element AcKu70-B (SEQ ID NO.10).The hph sequences at the 3' end of the targeting element AcKu70-A and the 5' end of the targeting element AcKu70-B have an overlapping portion, and the length of the overlapping portion is 626 bp; eg. Figure 3 shown.

[0043] 2.2 Protoplast transformation

[0044] The cells of Cephalosporium acremonium CGMCC 3.3795 were inoculated into CSL liquid fermentation medium, and a protoplast suspension was prepared as described in Example 1. 10 μL of AcKu70-A fragment (about 5 μg) and 10 μL of AcKu70-B fragment (about 5 μg) were added to 100 μL of the above protoplast suspension at the same time, and ice bathed for 30 minutes. Then 900 μL of PEG buffer was added, and the mixture was gently mixed and placed at room temperature for 20 minutes; the protoplast cell suspension was washed with an osmotic pressure buffer to remove the residual PEG. Then the protoplast cells were mixed with 15 mL of the upper soft agar medium that was sterilized and kept at 45°C, gently mixed, and evenly spread on 4-6 solid regeneration medium plates containing 100 mg / L hygromycin B, and cultured upright in a 28°C incubator for 1 day, and inverted for 5-7 days, and regenerated transformants grew out.

[0045] 2.3 Screening and verification of transformants

[0046] The transformants with hygromycin resistance were transferred from the plate to the screening plate CSL-H (CSL solid medium + 100 mg / L hygromycin B), cultured at 28°C for 5 days for subculture purification, and subculture purification was repeated four times on the screening plate CSL-H. Three transformants were randomly selected and cultured in YPS liquid medium, and the mycelia were collected to extract genomic DNA. Figure 3 Genomic PCR verification was performed using the indicated primer sites. Figure 4 PCR verification results of three randomly selected transformants. Figure 3 The results of PCR detection of UpKu70-F / hyg-R (F3 / R3) with the primers in Figure 3 The verification results of PCR detection of hyg-F / hyg-R (F5 / R3) with primers in Figure 3 The verification results of PCR detection with primer pair Up-check-F1 / hyg-R (F1 / R3); D is the verification results of Figure 3 The verification results of PCR detection with primer pair Up-check-F2 / hyg-R (F2 / R3) are shown in Figure 2. Figure 3 The verification results of PCR detection of primer pair Ku70-F / Ku70-R (F4 / R4), F is based on Figure 3The verification results of PCR detection of hyg-F / Dw-check-R2(F5 / R2) with the primer pair hyg-F / Dw-check-R2(F5 / R2); G is Figure 3 Verification results of PCR detection using the middle primer pair hyg-F / Dw-check-R1(F5 / R1).

[0047] Among them, the target bands were amplified in lanes A, B, C, D, F and G of transformant 3#, indicating that homologous recombination occurred between the targeting element AcKu70-A and the targeting element AcKu70-B at the Ku70 site in transformant 3#. Figure 4 E in the middle is the result of PCR verification of the primer pair inside the Ku70 gene. It was found that the target band inside the Ku70 gene was not amplified in the 3# transformant, which indicates that the Ku70 gene of the 3# transformant was successfully knocked out. The 3# transformant was defined as the Cephalosporium acremonium genetic engineering strain Ac-△Ku70 with the Ku70 gene successfully knocked out and the NHEJ pathway deleted.

[0048] Example 3: Analysis of the efficiency of homologous recombination of exogenous DNA in genetically engineered strains lacking the NHEJ pathway

[0049] 3.1 Analysis of homologous recombination efficiency of exogenous DNA in Ku70 gene-deficient strain Ac-△Ku70

[0050] The targeting element cefR-KO2 of the regulatory gene cefR was prepared by referring to the method described in Example 1.1, except that the hygromycin resistance gene hph expression cassette was replaced with the glufosinate resistance selection marker bar gene expression cassette.

[0051] The bar gene expression cassette with a glufosinate resistance screening marker bar (5'-TCGACAGAAGATGATATTGAAGGAGC-3') and bar-R (5'-GATCCACTTAACGTTACTGAAATCATC-3') was amplified by PCR to obtain a glufosinate resistance screening marker bar gene expression cassette with a size of about 2.1 kb. The glufosinate resistance screening marker bar gene expression cassette fragment was fused with the Up-border fragment and the Down-border fragment in Example 1.1 by fusion PCR technology, and the fusion PCR product was used as a template, and UpcefR-F and DwcefR-R were used as primers to amplify a cefR gene targeting element cefR-KO2 fragment with a size of about 5.1 kb (such as Figure 5 In the figure above, bar is the bar gene expression cassette for the screening marker glufosinate resistance, cefR is the gene to be knocked out, Up-border is the upstream homology arm, and Down-border is the downstream homology arm).

[0052] The cells of the genetically engineered strain Ac-△Ku70 obtained in Example 2 above were inoculated into the CSL liquid fermentation medium, and a protoplast suspension was prepared according to the method described in Example 1.2. 10 μL of the targeting element cefR-KO2 fragment (about 10 μg) was added to 100 μL of the protoplast suspension, and the mixture was placed on ice for 30 min. Then 900 μL of PEG buffer was added, and the mixture was gently mixed and placed at room temperature for 20 min; the protoplast cell suspension was washed with an osmotic pressure buffer to remove the residual PEG. The protoplast cells were then mixed with 15 mL of the upper soft agar medium sterilized at 45°C, gently mixed, and evenly spread on 4-6 solid regeneration medium plates containing 100 mg / L glufosinate, and cultured upright in a 28°C incubator for 1 day, and inverted for 5-7 days, and regenerated transformants grew out.

[0053] Transformants with glufosinate resistance were selected from the screening regeneration medium plate and transferred to the screening plate CSL-B (CSL solid medium + 100 mg / L glufosinate), cultured at 28°C for 5 days for subculture purification, and subcultured on the screening plate CSL-B for 4 consecutive times. The cells of 16 transformants were randomly selected and inoculated into YPS liquid medium, cultured at 28°C and 220 rpm for 72 hours, and the mycelium was collected to extract genomic DNA. Figure 5 The primers UpcefR-F / Bar-check-R shown in the figure were used for genomic PCR verification. Figure 5 As shown in the figure below, among the 16 randomly selected transformants, except for transformant 10#, all other transformants amplified the target band of 1.9kb, which indicates that the cefR-KO2 element in these transformants was integrated into the cefR gene locus by homologous recombination. The cefR gene of 15 of the 16 randomly selected transformants was knocked out, so the homologous recombination probability of exogenous DNA in the Ku70 gene-deficient strain Ac-△Ku70 was 15 / 16, i.e. 93.75%. This indicates that knocking out the Ku70 gene of the Cephalosporium acremonium CGMCC 3.3795 strain increased the homologous recombination probability of exogenous DNA from 5.9% to 93.75%.

[0054] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A method for improving the application efficiency of Cephalosporium acremonium gene targeting technology, characterized in that: The Ku70 gene in the Cephalosporium acremonium strain was knocked out to increase the probability of homologous recombination of exogenous DNA in the strain.

2. The method according to claim 1, characterized in that The Ku70 gene is knocked out using the Split-Marker method; specifically, the step of knocking out the Ku70 gene includes: (1) Using the genome of Cephalosporium acremonium as a template, amplifying the upstream sequence Up-border and the downstream sequence Down-border of the Ku70 gene by PCR, and amplifying the 5' end partial sequence and the 3' end partial sequence of the selection marker hph gene expression cassette by PCR (for example, using plasmid pHyg as a template); (2) using fusion PCR technology, the upstream sequence Up-border obtained in step (1) is fused with the 5' end portion of the selection marker hph gene expression cassette to obtain a fusion product and use it as the targeting element AcKu70-A; the downstream sequence Down-border obtained in step (1) is fused with the 3' end portion of the selection marker hph gene expression cassette to obtain a fusion product and use it as the targeting element AcKu70-B; (3) preparing protoplasts of Cephalosporium acremonium, and then simultaneously transforming the targeting element AcKu70-A and the targeting element AcKu70-B obtained in step (2) into the protoplasts of Cephalosporium acremonium and culturing them to obtain transformants; (4) Screening the transformants in which the Ku70 gene is knocked out in step (3) to obtain recombinant Cephalosporium acremonium with improved homologous recombination ability.

3. The method according to claim 1 or 2, characterized in that: The overlapping portion of the 5' end portion sequence and the 3' end portion sequence of the hph expression cassette is 300-900 bp in length; the overlapping portion of AcKu70-A and AcKu70-B is the 300-900 bp overlapping sequence obtained in step (1).

4. The method according to claim 2, characterized in that: The step of knocking out the Ku70 gene also includes: (5) The primer sequences for amplifying the Up-border are shown in SEQ ID N0.1-SEQ ID N0.2; the primer sequences for amplifying the Down-border are shown in SEQ ID N0.3-SEQ ID N0.4; the primer sequences for amplifying the 5' end partial sequence of the selection marker hph gene expression cassette are shown in SEQ ID N0.5-SEQ ID N0.6; the primer sequences for amplifying the 3' end partial sequence of the selection marker hph gene expression cassette are shown in SEQ ID N0.7-SEQ ID N0.8; Specifically, the sequence of the targeting element AcKu70-A is shown in SEQ ID N0.9, and the sequence of the targeting element AcKu70-B is shown in SEQ ID N0.

10.

5. The method according to any one of claims 2 to 4, characterized in that: The screening of the Ku70 gene knockout transformants is to screen the transformants by hygromycin resistance, then verify the Ku70 gene knockout transformants by genomic PCR, and obtain the pure recombinant bacteria Ac-△Ku70 by subculture and continuous hygromycin resistance screening.

6. A recombinant strain of Cephalosporium acremonium with high-efficiency homologous recombination ability, characterized in that: The method is prepared by any one of claims 1 to 5.

7. The recombinant Cephalosporium acremonium according to claim 6, characterized in that The homologous recombination efficiency of the exogenous DNA of the recombinant bacteria is greatly improved compared with that of the Cephalosporium acremonium strain, and the recombinant bacteria is the Ku70 gene deleted strain Ac-△Ku70.

8. Use of the recombinant Cephalosporium acremonium according to claim 6 or 7 in microbial genetic engineering, characterized in that: Used for genetic modification related to gene targeting technology.

9. The use according to claim 8, characterized in that: The genetic modification related to the gene targeting technology is gene knockout, gene knock-in, gene replacement or promoter replacement.

10. The use according to claim 8, characterized in that: The genetic modification associated with the gene targeting technology is the deletion of long segments of the genome.

Images