Gene ClALMT12 for regulating and controlling organic acid content of clausena lansium fruits and application of gene ClALMT12

Abstract

The invention belongs to the technical field of biological engineering, discloses a gene ClALMT12 for regulating and controlling the organic acid content of clausena lansium fruits and application of the gene ClALMT12, and particularly discloses application of ClALMT12 in regulating and controlling the organic acid content of plant leaves / fruits. According to the invention, the clausena lansium ClALMT12 gene is screened for the first time, and experiments prove that the ClALMT12 gene can significantly enhance the accumulation of organic acids in tobacco leaves and tomato fruits. The gene can be used as a target gene for regulating and controlling the organic acid content of the clausena lansium fruits and improving the flavor of the fruits for in-depth research, and has relatively high application and research values.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and particularly relates to a gene ClALMT12 for regulating the organic acid content of yellow peel fruit and an application thereof. Background Art

[0002] my country is the country with the most genetic resources, the largest cultivated area and the highest yield of Clausena lansium (Lour.) Skeels in the world, and Guangdong Province ranks first in my country in terms of cultivated area of ​​Clausena lansium. There are nearly 200,000 mu of Clausena lansium in Yunan County alone. The fruit of Clausena lansium is rich in nutrition and has the effects of anti-oxidation, anti-aging and anti-tumor. It is a rare fruit that can be used as both medicine and food and is deeply loved by consumers. The mature and marketed period of Clausena lansium is staggered with the market period of the major fruit in the south, lychee and longan. It is a high-economic-value crop worthy of promotion. However, there are very few varieties of Clausena lansium that can be promoted and there is a problem of single fruit taste. The main cultivated varieties are mainly sour Clausena lansium, mainly 'Yunan seedless Clausena' and 'Jixin Clausena', and sweet Clausena, mainly 'Congcheng sweet Clausena' and 'Yunan rock sugar Clausena'. The sour Clausena tastes sour, while the sweet Clausena tastes pure and sweet with extremely low acid content, resulting in serious polarization of the taste of the Clausena varieties on the market. Fruit flavor is a key factor in determining the public acceptance of fruit tree varieties and directly determines whether they can achieve commercial success. The organic acid content of kumquat fruit is a key factor affecting fruit flavor. Therefore, it is urgent to further explore the regulatory mechanism of organic acid accumulation and metabolism in kumquat fruit and promote the creation and improvement of high-quality kumquat varieties. Summary of the invention

[0003] The purpose of the first aspect of the present invention is to provide the application of ClALMT12.

[0004] The second aspect of the present invention aims to provide applications of biomaterials related to ClALMT12.

[0005] The third aspect of the present invention aims to provide the use of a reagent for targeting upregulating the expression level of ClALMT12.

[0006] The fourth aspect of the present invention aims to provide a method.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides the use of ClALMT12 as described in any one of (1) to (5):

[0009] (1) Regulate the organic acid content of plant leaves;

[0010] (2) preparing products for regulating the organic acid content of plant leaves;

[0011] (3) Regulate the quality of plant fruits;

[0012] (4) preparing products for regulating the quality of plant fruits;

[0013] (5) Genetically engineered plants that produce high-quality fruit;

[0014] The amino acid sequence of ClALMT12 includes the amino acid sequence shown in SEQ ID NO:2.

[0015] In some embodiments of the present invention, the plants include tobacco and / or fruits and vegetables.

[0016] In some embodiments of the present invention, the fruits and vegetables include at least one of kumquat, tomato, and citrus.

[0017] In some embodiments of the present invention, regulating the quality of plant fruits includes regulating the content of organic acids in the plant fruits.

[0018] The second aspect of the present invention provides a use of a biomaterial related to ClALMT12 as described in any one of (1) to (5):

[0019] (1) Regulate the organic acid content of plant leaves;

[0020] (2) preparing products for regulating the organic acid content of plant leaves;

[0021] (3) Regulate the quality of plant fruits;

[0022] (4) preparing products for regulating the quality of plant fruits;

[0023] (5) Genetically engineered plants that produce high-quality fruit;

[0024] The biological material carries ClALMT12, and the amino acid sequence of the ClALMT12 includes the amino acid sequence shown in SEQ ID NO:2.

[0025] In some embodiments of the present invention, the biological material is any one of a1) to a12):

[0026] a1) a nucleic acid molecule encoding C1ALMT12;

[0027] a2) an expression cassette containing the nucleic acid molecule described in a1);

[0028] a3) a recombinant vector containing the nucleic acid molecule described in a1);

[0029] a4) a recombinant vector containing the expression cassette described in a2);

[0030] a5) a recombinant microorganism containing the nucleic acid molecule described in a1);

[0031] a6) a recombinant microorganism containing the expression cassette described in a2);

[0032] a7) a recombinant microorganism containing the recombinant vector described in a3);

[0033] a8) a recombinant microorganism containing the recombinant vector described in a4);

[0034] a9) a transgenic animal cell line containing the nucleic acid molecule described in a1);

[0035] a10) a transgenic animal cell line containing the expression cassette described in a2);

[0036] a11) a transgenic animal cell line containing the recombinant vector described in a3);

[0037] a12) A transgenic animal cell line containing the recombinant vector described in a4).

[0038] In some embodiments of the invention, the transgenic animal cell line does not contain reproductive material.

[0039] In some embodiments of the present invention, the nucleic acid molecule comprises the sequence shown in SEQ ID NO:1.

[0040] In some embodiments of the present invention, the expression cassette comprises a 5' transcription control region, an open reading frame encoding the fusion protein of the first aspect of the present invention, a translation control signal, a 3' untranslated region (3'UTR) and a transcription termination signal.

[0041] In some embodiments of the present invention, the 5' transcription control region comprises a promoter (a universal promoter, such as a viral promoter (SV40 promoter) or a mammalian "housekeeping" promoter, may be used), a transcription start site, an enhancer and / or a silencer element.

[0042] In some embodiments of the invention, the 3'UTR may encode an AU-rich element, which is a common regulator of mRNA stability through the 3'-5' exosome pathway and is usually located in the 3'UTR. The AU-rich element may contain one or more repeats of the sequence AUUUA. It may also contain one or more so-called US2B elements having the sequence AUAUAU.

[0043] In some embodiments of the present invention, the vector comprises a promoter, and the promoter is operably linked to the nucleic acid molecule.

[0044] In some embodiments of the present invention, the vector is independently selected from a non-pathogenic viral vector and a viral vector.

[0045] In some embodiments of the present invention, the viral vector comprises at least one of a lentiviral vector, an adenoviral vector, a baculoviral vector, a retroviral vector, a poxvirus vector, a Sendai virus vector, and a herpes simplex virus vector.

[0046] In some embodiments of the present invention, the non-viral vector includes at least one of a plasmid vector, a cationic polymer vector, chitosan, polyethyleneimine, a nanoparticle vector, and a liposome.

[0047] In some embodiments of the present invention, the vector is a plasmid vector, a phagemid, a viral vector, a cell vector, a bacteriophage, a cosmid, a F cosmid, or an artificial chromosome.

[0048] In some embodiments of the present invention, the plasmid vector may be an optional plasmid, and the viral vector may be an optional virus.

[0049] In some embodiments of the present invention, the recombinant expression vector uses super1300 as the original expression vector.

[0050] In some embodiments of the present invention, the cells include prokaryotic cells and eukaryotic cells; the cells are not new species of plants or animals.

[0051] In some embodiments of the present invention, the prokaryotic cells include Escherichia coli, Streptomyces, Bacillus subtilis and other bacteria well known in the art that can be used to express target proteins.

[0052] In some embodiments of the present invention, the eukaryotic cell comprises at least one of a yeast cell, a mammalian cell, a plant cell and an insect cell.

[0053] In some embodiments of the present invention, the plants include tobacco and / or fruits and vegetables.

[0054] In some embodiments of the present invention, the fruits and vegetables include at least one of kumquat, tomato, and citrus.

[0055] In some embodiments of the present invention, regulating the quality of plant fruits includes regulating the content of organic acids in the plant fruits.

[0056] The third aspect of the present invention provides a use of a reagent for targeting upregulating the expression of ClALMT12 as described in any one of (1) to (5):

[0057] (1) Regulate the organic acid content of plant leaves;

[0058] (2) preparing products for regulating the organic acid content of plant leaves;

[0059] (3) Regulate the quality of plant fruits;

[0060] (4) preparing products for regulating the quality of plant fruits;

[0061] (5) Genetically engineered plants that produce high-quality fruit;

[0062] The amino acid sequence of ClALMT12 includes the amino acid sequence shown in SEQ ID NO:2.

[0063] In some embodiments of the present invention, the plants include tobacco and / or fruits and vegetables.

[0064] In some embodiments of the present invention, the fruits and vegetables include at least one of kumquat, tomato, and citrus.

[0065] In some embodiments of the present invention, regulating the quality of plant fruits includes regulating the content of organic acids in the plant fruits.

[0066] A fourth aspect of the present invention provides a method, wherein the method is to overexpress ClALMT12 in a target plant;

[0067] The method comprises any one of 1) to 3):

[0068] 1) A method for increasing the organic acid content of plant leaves;

[0069] 2) A method for improving the quality of plant fruits;

[0070] 3) A method for cultivating genetically modified plants with high quality plant fruits;

[0071] The amino acid sequence of ClALMT12 includes the amino acid sequence shown in SEQ ID NO:2.

[0072] In some embodiments of the present invention, the method comprises the following steps:

[0073] (1) Construction of ClALMT12 gene overexpression vector;

[0074] (2) The overexpression vector is transferred into Agrobacterium and then infects plants.

[0075] In some embodiments of the present invention, the backbone vector of the overexpression vector is super1300.

[0076] In some embodiments of the present invention, the method for constructing the overexpression vector includes the steps of cloning the ClALMT12 gene, connecting the recovered product with the super1300 vector, and constructing the overexpression vector (i.e., super1300-ClALMT12 overexpression vector).

[0077] In some embodiments of the present invention, when the plant is a tomato, the overexpression vector is transferred into Agrobacterium in step (2) and then infects a tomato explant. The infected tomato explant is screened to grow callus tissue, and further cultivated to obtain a ClALMT12 stably overexpressing tomato plant (i.e., a tomato plant whose tomato fruit contains a higher content of organic acids).

[0078] That is, the ClALMT12 gene overexpression vector super1300-ClALMT12 was used to carry out genetic transformation with tomato explants by Agrobacterium-mediated method, and the ClALMT12 stable overexpression tomato strain was obtained through molecular identification.

[0079] The beneficial effects of the present invention are:

[0080] Based on the flavor of the yellow peel fruit, the present invention divides the yellow peel into two subgroups, sweet yellow peel and sour yellow peel. Based on transcriptomic analysis, the gene ClALMT12 encoding the ALMT protein family is found in the significantly differentially expressed genes. The RT-qPCR result also confirms this result, and the gene is further studied in depth. The yellow peel ClALMT12 gene is cloned for the first time. By transiently overexpressing ClALMT12 in tobacco leaves in a tobacco transient expression system, it is verified that the gene can significantly enhance the accumulation of organic acid content. At the same time, the transgenic technology is used to heterologously overexpress ClALMT12 in tomatoes, which further verifies that the gene can significantly enhance the accumulation of organic acid content in the fruit. The scheme of the present invention effectively overcomes the gap in the research on the regulation of organic acid accumulation in yellow peel fruits in the prior art. The yellow peel ClALMT12 gene can be used as a target gene for regulating the organic acid content of yellow peel fruits and improving the flavor of fruits for in-depth research, and has high application and research value.

[0081] In the method provided by the present invention, the transient gene expression technology used has simple steps and is effective, which can effectively shorten the time for studying gene function. Heterologous gene expression can play an important role in the study of gene function of species for which a transgenic system has not yet been successfully established, and is of great significance for revealing the function of yellow peel genes, molecular breeding, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1 is the discovery of ClALMT12; A is the transcriptome analysis of the expression level of ClALMT12 in sour kumquat and sweet kumquat, B is the qPCR analysis of the expression level of ClALMT12 in sour kumquat and sweet kumquat germplasm, respectively; C is the correlation analysis of ClALMT12 expression level and organic acid content in kumquat.

[0083] Figure 2The figure shows the cloning of ClALMT12 and the structure of its encoded protein; A is the agarose gel electrophoresis diagram of PCR-amplified ClALMT12, B is the schematic diagram of the ClALMT12 protein structure; C is the homology comparison and domain analysis of ClALMT12 and 7 ALMT protein sequences from other species.

[0084] Figure 3 Phylogenetic tree analysis of ClALMT12 and homologous ALMT proteins in seven other species.

[0085] Figure 4 The figure shows the construction and identification of ClALMT12 overexpression vector; A is the colony PCR identification after transformation into DH5α competent cells; B is the colony PCR identification after transformation into GV3101 competent cells.

[0086] Figure 5 The figures are phenotypic analysis of tobacco leaves with transient overexpression of ClALMT12 and changes in ClALMT12 expression levels; A is the agarose gel electrophoresis diagram of the ClALMT12 expression level detection in tobacco leaves 3 days after transient overexpression of ClALMT12; B is the changes in organic acid content in tobacco leaves 3 days after injection of engineered bacteria containing an empty vector (super1300) and a ClALMT12 overexpression vector (super1300-ClALMT12); in the figure, ** represents p < 0.01.

[0087] Figure 6 The figure shows the process of obtaining stable plants overexpressing ClALMT12 in tomato; A is co-cultivation; B is screening and cultivation; C is differentiation cultivation; D is rooting to form resistant seedlings; E is the fruiting traits of transgenic tomatoes; F is the extraction of transgenic tomato genomic DNA and PCR detection of the marker gene HPT (hygromycin gene) using the HPT-F / HPT-R primers; G is the RT-PCR method to detect the expression of ClALMT12 in the overexpression strain; H is the detection of organic acid content in the fruit of the transgenic tomato strain stably expressing ClALMT12. DETAILED DESCRIPTION

[0088] The present invention is further described in detail below through specific examples.

[0089] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0090] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0091] In the following embodiments of the present invention, the materials involved include:

[0092] Tobacco material was Nicotiana benthamiana, and tomato material was Micro-TOM;

[0093] The primers and sequencing used in the experiment were completed by Sangon Biotech (Shanghai) Co., Ltd.;

[0094] HindIII and KpnI were purchased from Thermo Fisher Scientific;

[0095] High-fidelity enzymes, IIOne Step Cloning Kit, RNA extraction kit, reverse transcription kit, and DNA purification kit were purchased from Nanjing Novogene Biotech Co., Ltd.;

[0096] Escherichia coli competent cells DH5α and Agrobacterium competent cells GV3101 were purchased from Shanghai Weidi Biotechnology Co., Ltd.;

[0097] The remaining molecular reagents were mainly purchased from Nanjing Novozymes Biotech Co., Ltd. and Sangon Biotech (Shanghai) Co., Ltd.

[0098] The method for determining the content of organic acid in the embodiment is as follows:

[0099] Weigh an appropriate amount of fruit and vegetable samples in a mortar, add a small amount of boiled and cooled single distilled water to grind into a homogenate, rinse the mortar several times in small amounts, transfer to a test tube and dilute to the corresponding scale, shake well and let stand for 30 minutes (shake well several times during the period); centrifuge at 12000rpm for 15 minutes, and collect the supernatant. Use a fully automatic calibrator to measure, draw the corresponding filtrate into a beaker of 50ml boiled and cooled single distilled water, and titrate with a calibrated NaOH solution. Record the amount of NaOH titrant used and repeat three times. Use distilled water instead of the filtrate as a blank control.

[0100] Pre-culture medium: MS+1mg / L IAA+1.75mg / L ZT;

[0101] Co-culture medium: MS+1mg / L IAA+1.75mg / L ZT;

[0102] Screening medium: MS+1mg / L IAA+1.75mg / L ZT+10mg / L hyg+500mg / L Cb;

[0103] Differentiation medium: MS+1mg / L IAA+1.75mg / L ZT+5mg / L hyg+500mg / L Cb;

[0104] Rooting medium: MS+5mg / L hyg+250mg / L Cb;

[0105] Among them, MS was purchased from BioRun with the catalog number RFA01; IAA was purchased from Bio-Tech with the catalog number A600723-0025; ZT was purchased from Bio-Tech with the catalog number A411990-0025; Cb was purchased from BioRun with the catalog number RJD00; and hygromycin B was purchased from BioRun with the catalog number RJA00-1g.

[0106] The information of the Huangpi germplasm resources involved in the embodiment is shown in Table 1, all of which are from the Huangpi germplasm resource garden of the Ministry of Agriculture and Rural Affairs.

[0107] Table 1 Information on Huangpi germplasm resources

[0108]

[0109]

[0110] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0111] Example 1 Discovery of C1ALMT12 gene

[0112] The flavor of fruit trees is a scientific issue of common concern to all fruit tree breeders, and kumquat is no exception. Kumquat varieties can be clearly divided into two subgroups based on taste: sweet kumquat and sour kumquat. Sweet kumquat tastes sweet and clear without sourness. Sour kumquat tastes sour and sweet, with a distinct sour taste, and there is a clear difference in sweet and sour taste from the young fruit. In order to study the genetic basis of the taste of kumquat fruit, this example sequenced the transcriptome of sweet kumquat and sour kumquat fruits (see Table 1 for kumquat germplasm resource information), and performed differential expression analysis, and found that a gene annotated as encoding a malic acid transporter was significantly different, named ClALMT12.

[0113] Furthermore, the inventors selected 5 sweet and 5 sour kumquat varieties (see Table 1 for the germplasm resource information of kumquats), and analyzed the expression level of ClALMT12 by qPCR. The results showed that the expression level of ClALMT12 in the sour kumquat varieties was significantly higher than that in the sweet kumquat varieties, and the correlation analysis showed that the expression level of ClALMT12 was significantly positively correlated with the organic acid content of the fruit ( Figure 1 B and C). The above results suggest that ClALMT12 can regulate the accumulation of organic acids in fruits. Since the molecular biology research of yellow peel has just started, there is still a blank in the transient transformation system and stable transgenic system. In order to verify the function of ClALMT12 in yellow peel in regulating the accumulation of organic acids in fruits, heterologous overexpression was selected for verification.

[0114] Example 2: Cloning and bioinformatics analysis of the CDS region of the C1ALMT12 gene

[0115] Referring to the reference genome of Wampee "JingFeng" assembled by our research group (chen et al. 2024. Identification of Key Genes Controlling Sugar and Organic Acid Accumulation in Wampee Fruit (Clausena lansium) via Genome Assembly and Genome-wide Association Analysis), ClALMT12 sequence was extracted, and primers ClALMT12-F / ClALMT12-R were designed using Premier 5.0 (Table 1). Total RNA from Wampee leaves was extracted using an RNA extraction kit (FastPure Plant Total RNA Isolation Kit (Polysaccharides & Polyphenolics–rich), Novazon, China), and reversed into cDNA using the HiScriptIV 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Novazon, China).

[0116] The coding sequence CDS was cloned using cDNA as template and ClALMT12-F / ClALMT12-R as primers. The PCR product was subjected to 1.5% agarose gel electrophoresis and the results were detected and recorded using a gel imaging system (Bio-Rad). Figure 2 A), the PCR product was recovered and connected to BlunT3, transformed into DH5α competent cells, single colonies were picked for colony PCR, and the positive bacteria were sent to Sangon Biotechnology (Guangzhou) Co., Ltd. for sequencing to obtain the CDS sequence of ClALMT12 with a sequence size of 1845 bp. The CDS sequence of the ClALMT12 gene was determined, and its nucleotide sequence is shown in SEQ ID NO: 1.

[0117]

[0118] Table 2 Cloning, identification and real-time fluorescence quantitative (RT-qPCR) primers used in the experiment

[0119]

[0120] The conserved domains and physicochemical properties of ClALMT12 were analyzed using ExPaSy: The ClALMT12 gene encodes 541 amino acids (the amino acid sequence of ClALMT12 is shown in SEQ ID NO: 2), the theoretical molecular weight is 60.29 kD, the theoretical isoelectric point is 8.39, the protein contains 58 negatively charged residues (Asp+Glu) and 62 positively charged residues (Arg+Lys), the instability coefficient is 34.33, the aliphatic index is 99.89, and the average hydrophilicity is 0.024, indicating that ClALMT12 is a hydrophilic and stable protein. According to the protein structure prediction of the SMART (http: / / smart.embl.de / smart / set_mode.cgi?NORMAL=1) website, ClALMT12 contains an identical PFAM domain named "ALMT", located at positions 48 to 504 of the amino acid sequence (the protein structure diagram is shown in Figure 2 (B).

[0121] Amino acid sequence of C1ALMT12: * (SEQ ID NO: 2).

[0122] To further investigate the relationship between ClALMT12 and other species during evolution, we also conducted gene sequencing on orange (Citrussinensis, KAH9769659.1), jujube (Ziziphus jujuba, XP_015880299.3), wild apple (Malussylvestris, XP_050131980.1), poplar (Populus trichocarpa, PNT54488.1), cotton (Gossypium hirsutum, XP_040963263.1), cacao (Theobroma cacao, XP_007039541.1), Arabidopsis thaliana (Arabidopsis Phylogenetic analysis of eight ALMT family genes including thaliana (NP_193531.1) showed that ClALMT12 and sweet orange CitALMT12 (KAH9769659.1) were on the same branch and had the closest relationship ( Figure 3 ).

[0123] Example 3 Construction of C1ALMT12 overexpression vector and phenotypic analysis

[0124] 1. Construction of ClALMT12 overexpression vector

[0125] According to the ClALMT12 coding sequence, a forward primer ClALMT12-F1 containing a homology arm of the Hind III restriction site (CCAAATCGACTCTAGAAAGCTT, SEQ ID NO: 13) and a reverse primer ClALMT12-R1 containing a homology arm of the Kpn I restriction site (CCTCGCCCTTGCTCACCATGGTACC, SEQ ID NO: 14) were designed (primer sequences are shown in Table 2). The cDNA was used as a template for amplification and recovered by gel running. The recovered product and the overexpression vector super1300 were digested and recovered using restriction endonucleases Hind III and Kpn I (Thermo Fisher Scientific), respectively. After that, DH5α competent cells were transformed, and single colonies were picked for colony PCR (such as PCR) using vector universal primers Super1300-F / Super1300-R (primer sequences are shown in Table 2). Figure 4 The positive colonies were shaken and sent to the company for sequencing. After the sequencing was correct, the plasmid was extracted to obtain the overexpression vector super1300-ClALMT12.

[0126] 2. Molecular identification and phenotypic analysis after transient overexpression of ClALMT12

[0127] The plasmids containing ClALMT12 overexpression vector (super1300-ClALMT12) and empty vector (super1300) were transformed into Agrobacterium GV3101, and colony PCR was performed for identification ( Figure 4 (B), positive single clones were picked to prepare engineered bacteria, and the engineered bacteria containing the ClALMT12 overexpression vector (super1300-ClALMT12) and the empty vector (super1300) were injected into 4-6 week-old Nicotiana benthamiana leaves, and RT-PCR primers qClALMT12-F / qClALMT12-R were designed (primer sequences are shown in Table 2), and the expression of ClALMT12 was detected after 3 days.

[0128] The results showed that the expression of ClALMT12 could be detected in tobacco leaves injected with super1300-ClALMT12 overexpression vector ( Figure 5Then, the organic acid content of tobacco leaves injected with empty vector (super1300) and overexpression vector (super1300-ClALMT12) was detected. Compared with tobacco leaves injected with empty vector, the organic acid content of tobacco leaves injected with overexpression vector (super1300-ClALMT12) was significantly increased ( Figure 5 (middle B).

[0129] 3. Molecular identification and phenotypic analysis after heterologous overexpression of ClALMT12

[0130] Take the germinated sterile seedlings of tomato (Micro-TOM), wait for the cotyledons to fully expand, cut off the cotyledon petiole and cotyledon tip with a scalpel, keep the middle part and cut it into 2-3 sections and inoculate it into the pre-culture medium, and pre-culture it at 23±2℃ for 2-3 days. Pick the identified positive Agrobacterium (obtained from the molecular identification and phenotypic analysis after transient overexpression of 2.ClALMT12) and put it into the infection solution to prepare the OD 600 = 0.1 Agrobacterium resuspension; infect for 10-15 min, inoculate the dried explants in co-cultivation medium, and culture in the dark at 23±2℃ for 2 days ( Figure 6 The callus after recovery culture was inoculated into the screening medium and cultured at 23°C with 16h / 8h light / darkness for 15 to 30 days ( Figure 6 The selected calli were inoculated into differentiation medium and cultured at 23°C with 16h / 8h light / darkness for 30-40 days ( Figure 6 C). When the seedlings to be differentiated grow to about 2-3 cm, they are cut off from the callus and inoculated into rooting medium. They are cultured at 23°C and 16h / 8h light / dark for 10-15 days to obtain resistant regenerated plants ( Figure 6 D). Tomato genomic DNA was extracted and PCR detection of the marker gene HPT (hygromycin gene) was performed. The detection primers were HPT-F / HPT-R (primer sequences are shown in Table 2). The PCR detection results of the marker gene HPT are shown in Figure 6 Middle F.

[0131] RNA was extracted from the mature fruits of the positive plants and the untransformed wild-type tomato plants, respectively, and reverse transcribed into cDNA. The cDNA was amplified using qClALMT12-F / qClALMT12-R, and the wild-type was used as the control. The expression of ClALMT12 in the regenerated plants was detected by agarose gel electrophoresis. The plants that could amplify the target fragment band were the stable plants with heterologous overexpression of ClALMT12 ( Figure 6 Middle E).

[0132] The results are as follows Figure 6As shown in G to H, the fruit organic acid content of the wild type and two overexpression tomato lines was detected respectively. The results showed that the fruit organic acid content of the overexpression lines was significantly higher than that of the wild type, which proved that the improvement method of the fruit organic acid content based on the ClALMT12 gene of the present invention can significantly increase the fruit organic acid content and has high application and research value.

[0133] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of ClALMT12 in any one of (1) to (5): (1) Regulate the organic acid content of plant leaves; (2) preparing products for regulating the organic acid content of plant leaves; (3) Regulate the quality of plant fruits; (4) preparing products for regulating the quality of plant fruits; (5) Genetically engineered plants that produce high-quality fruit; The amino acid sequence of ClALMT12 includes the amino acid sequence shown in SEQ ID NO:

2.

2. Use of the biomaterial related to ClALMT12 in any one of (1) to (5): (1) Regulate the organic acid content of plant leaves; (2) preparing products for regulating the organic acid content of plant leaves; (3) Regulate the quality of plant fruits; (4) preparing products for regulating the quality of plant fruits; (5) Genetically engineered plants that produce high-quality fruit; The biological material carries ClALMT12, and the amino acid sequence of the ClALMT12 includes the amino acid sequence shown in SEQ ID NO:

2.

3. The use according to claim 2, characterized in that: The biological material is any one of a1) to a12): a1) a nucleic acid molecule encoding ClALMT12; a2) an expression cassette containing the nucleic acid molecule described in a1); a3) a recombinant vector containing the nucleic acid molecule described in a1); a4) a recombinant vector containing the expression cassette described in a2); a5) a recombinant microorganism containing the nucleic acid molecule described in a1); a6) a recombinant microorganism containing the expression cassette described in a2); a7) a recombinant microorganism containing the recombinant vector described in a3); a8) a recombinant microorganism containing the recombinant vector described in a4); a9) a transgenic animal cell line containing the nucleic acid molecule described in a1); a10) a transgenic animal cell line containing the expression cassette described in a2); a11) a transgenic animal cell line containing the recombinant vector described in a3); a12) A transgenic animal cell line containing the recombinant vector described in a4).

4. The use according to claim 3, characterized in that: The nucleic acid molecule includes the sequence shown in SEQ ID NO:

1.

5. Use of a reagent for upregulating the expression of ClALMT12 as described in any one of (1) to (5): (1) Regulate the organic acid content of plant leaves; (2) preparing products for regulating the organic acid content of plant leaves; (3) Regulate the quality of plant fruits; (4) preparing products for regulating the quality of plant fruits; (5) Genetically engineered plants that produce high-quality fruit; The amino acid sequence of ClALMT12 includes the amino acid sequence shown in SEQ ID NO:

2.

6. The use according to any one of claims 1 to 5, characterized in that: The plants include tobacco and / or fruits and vegetables; preferably, the fruits and vegetables include at least one of kumquat, tomato and citrus.

7. The use according to any one of claims 1 to 5, characterized in that: The regulating the plant fruit quality includes regulating the content of organic acids in the plant fruit.

8. A method comprising overexpressing ClALMT12 in a target plant; The method comprises any one of 1) to 3): 1) A method for increasing the organic acid content of plant leaves; 2) A method for improving the quality of plant fruits; 3) A method for cultivating genetically modified plants with high quality plant fruits; The amino acid sequence of ClALMT12 includes the amino acid sequence shown in SEQ ID NO:

2.

9. The method according to claim 8, characterized in that The method comprises the following steps: (1) Construction of ClALMT12 gene overexpression vector; (2) transferring the overexpression vector into Agrobacterium and then infecting plants; Preferably, the backbone vector of the overexpression vector is super1300.

10. Application of the reagent for detecting ClALMT12 in distinguishing sweet and sour kumquat varieties; Preferably, the reagent includes a primer sequence for detecting ClALMT12; Preferably, the primer sequences are shown in SEQ ID NO:3 to SEQ ID NO:4.

Images