Application of watermelon KNOX transcription factor ClSPR in creation of reticulate peel watermelon

Abstract

The invention discloses application of a watermelon KNOX transcription factor ClSPR in creation of reticulate peel watermelons, and belongs to the technical field of plant genetic engineering. According to the application of the watermelon KNOX transcription factor ClSPR in creation of the reticulate peel watermelon, disclosed by the invention, a CRISPR / Cas9 gene editing technology is adopted, and the watermelon KNOX transcription factor ClSPR is subjected to fixed-point editing, so that a new germplasm of the reticulate peel watermelon is obtained. Compared with a wild type, the reticulated peel watermelon germplasm created by the method has the advantages that the peel stripe phenotype is changed, and other tissues such as female flowers, leaves, tendrils, stems and roots have no visible phenotype change; through the technology, directional genetic improvement of peel stripe phenotypes of excellent watermelon germplasm can be realized, a new material is accumulated for breeding of new varieties, and the method has important production and application potential.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and more particularly to the application of watermelon KNOX transcription factor ClSPR in creating net-textured rind watermelon. Background Art

[0002] Watermelon (Citrullus lanatus), a member of the Cucurbitaceae family, is an important Cucurbitaceae crop that is widely planted in the world, and is also a fruit-type cash crop. According to statistics, in 2022, the planting area of ​​watermelon in my country was 1.3919 million hectares, and the total output reached 60.5422 million tons, accounting for 47.73% and 60.57% of the world's total cultivated area and output, respectively (FAO, http: / / www.fao.org / ). Therefore, as one of the important melon crops cultivated in my country, watermelon plays an important role in agricultural structural adjustment and rural economic development.

[0003] Peel stripes are an important appearance quality of watermelon, which can directly affect consumers' preferences in the market. For example, Crimson watermelon, which has green, wide stripes on the peel and diffuse stripe edges, is very popular in the United States, Brazil and Europe; while Jubille watermelon, which has dark green, medium-wide stripes on the peel and clear stripe edges, has a large market sales in China and South Korea. It can be seen that peel stripes, as a typical agronomic trait of watermelon, are not only of great significance to the improvement of watermelon commercial properties, but also can affect consumers' purchasing choices to a certain extent, thereby affecting the market sales of watermelon. At present, the research on watermelon stripe traits is mainly focused on genetic analysis and candidate gene positioning and cloning, and the molecular mechanism research of related regulatory genes has not been reported. For example, Kim et al. located the major QTL locus of watermelon peel stripes to the 2.29Mb range of chromosome 6; and HeeBum, Park et al. also located the peel stripe regulatory locus S to the 3.99Mb range of chromosome 6; Margal et al.'s research showed that the candidate genes for watermelon peel stripes and inter-striped peel color were Cla97C09G175170 and Cla97C09G175150 on chromosome 9, respectively; Wang et al.'s research found that the formation of discontinuous stripes on watermelon peel was regulated by ClIS (Cla019202).

[0004] Therefore, providing the application of watermelon KNOX transcription factor ClSPR in creating netted rind watermelon is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides the use of watermelon KNOX transcription factor ClSPR in creating netted rind watermelon.

[0006] In the early stage of this invention, the watermelon peel stripe regulatory gene ClSPR was located through traditional gene positioning technology, and the best candidate gene was preliminarily determined through sequence and expression analysis. Based on this gene, the CRISPR / Cas9 technology can be used to change the phenotype of watermelon peel stripes, thereby enriching the appearance traits of excellent watermelon materials and providing material resources for the enrichment of new varieties of special watermelons.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] The invention discloses an application of watermelon KNOX transcription factor ClSPR in creating netted rind watermelon. The CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1.

[0009] Further, the use of biological materials with knocked-out watermelon KNOX transcription factor ClSPR in creating netted rind watermelon, wherein the CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1;

[0010] The biological material is any one of the following:

[0011] A: An expression cassette capable of silencing the watermelon KNOX transcription factor ClSPR;

[0012] B: a recombinant vector containing the expression cassette described in A;

[0013] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

[0014] Furthermore, a method for creating a new germplasm of watermelon with netted rind is provided, wherein CRISPR / Cas9 or other gene editing technologies are used to perform site-specific editing or knockout of the watermelon KNOX transcription factor ClSPR or its conserved domain sequence, thereby causing the gene protein to be functionally deficient or mutated, resulting in a phenotype of a rind covered with netted rind. The CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1.

[0015] This invention is the first to use the localized watermelon KNOX transcription factor ClSPR and combine it with CRISPR / Cas9 technology to create a new watermelon germplasm with netted rind. This method can achieve the directed genetic improvement of the rind stripe phenotype of excellent watermelon germplasm, accumulate new materials for the breeding of new varieties, and has important production application potential.

[0016] Through the above technical solutions, it can be known that compared with the prior art, the present invention discloses the application of watermelon KNOX transcription factor ClSPR in creating netted rind watermelon. For the first time, CRISPR / Cas9 or other gene editing systems are used to perform gene editing and knockout of KNOX transcription factor ClSPR or its conserved domain, so that the gene function is lost or mutated, thereby forming a netted rind phenotype. Compared with the wild-type material, the netted rind watermelon germplasm created by the present invention has no visible phenotypic changes in other tissues such as female flowers, leaves, tendrils, stems, roots, etc., except for the change in the rind stripe phenotype; this technology can achieve the directional genetic improvement of the rind stripe phenotype of excellent watermelon germplasm, accumulate new materials for the selection and breeding of new varieties, and has important production application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0018] Figure 1 The accompanying drawing shows the recombinant plasmid sgRNA expression element of the present invention; wherein U6-26p and U6-29p are promoters, U6-26t is a terminator, gRNA-Sc is a gRNA skeleton, and Target1 and Target2 are target sites;

[0019] Figure 2 The accompanying drawings are schematic diagrams of the target structure and phenotype diagrams of the present invention;

[0020] Among them, (a) schematic diagram of the ClSPR gene structure; the location of Target1 and Target2 on the gene, and two gene-edited plants Clspr_1 and Clspr_2 were obtained, which had 4bp and 1bp deletions in Target1, respectively, and 7bp and 6bp deletions in Target2, respectively (- indicates deletion); (b) fruit peel stripe phenotypes of unedited plants (WT) and edited plants, where the WT fruit peel is covered with dark green stripes, while the fruit peel of the edited plants Clspr_1 and Clspr_2 is covered with reticular fine lines. DETAILED DESCRIPTION

[0021] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] The CDS sequence of ClSPR is shown in SEQ ID NO.1.

[0023] ATGGCGGATCTTTACGGACTCCATCCCCTCGCTGATAACTCTTACCAGTCATCTTCAGCGACGACGTTGGGTAGCTTTCCTCTTCTTGCTAATTCTCCAATGGCTTCTGCAGATTATTCTCATCTACTTCCTGCTTTTGAATCGGAATATTTGCGGACGGTTTCGTCGGCCGCCTGCGACACCGTTGCGGCGGCGGCTGAGATTGAAACAGCGCGAGCTAATTCCGAGTACTCCGCCGGTGTAATTCGAGCGAAAATTGCTTCTCATCCTCTTTACCCTAAACTCGTCGATGCGTTCGTGAACTGCCAAAAGGTCGGTGTACCG CCGGAGTTCGCTGATATTC CAGACCAAAACAACCGTGGAAGTGATATCGGCGAAGAAATTTCCGGCGTTTCAAATTGCTTGGGTGTCGATCCCGAACTCGATGAGTTCATGGAAACATACTACAGGATACTAGCCAAATACGAGTTAGATCTCTCCCAGTCCTTCATGGAAGCATCTTCCTTTCTCAACAACATGGGAATGCAGTTAAACGTGCTTTGCAATAACGATGAAACTGCTCCGAAAGAGAATATAAGCGCCGGAGAAGTAGAATTACAAGACTCTCTTGTGGTTCCGGGAAATGAAGATCGCGAGCTGAAGGATCGACTTTTGCGGGAGTACGGTGGTCATATTAGTAGCTTAAAGCAGGAATTCTCAAAAACTAAAAAGAAGGCAAATCTGCCGAGAGAAGCCAAACAGATCCTGCTTCACTG GTGGAACAGCCATTCCCAG TGGCCATATCCCACTGACACAGAAAAAGTTGAGTTGGCCGAGTCGACAGGCCTAACCCGAAAACAAATAAACAACTGGTTCATAAACCAGAGGAAACGGCATTGGAAATCACCATAA;SEQ ID NO.1。

[0024] Example 1 Selection of editing sites for gene C1SPR

[0025] According to the CDS sequence of ClSPR (as shown in SEQ ID NO.1) and the target site online design website CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / news.php, V2), the target site for gene editing was designed, and two editing sites (Target1 and Target2) were designed. Among them, the targets Target1 and Target2 are located on the second and fourth exons of the gene ClSPR, respectively.

[0026] Target1 sequence: CCGGAGTTCGCTGATATTC; SEQ ID NO.2;

[0027] Target2 sequence: GTGGAACAGCCATTCCCAG; SEQ ID NO.3.

[0028] Example 2 CRISPR / Cas9 editing vector construction

[0029] 1) PCR amplification:

[0030] According to the above two sets of target sequences, the adapter primers Target1F / Target2R were synthesized, and the intermediate vector pCBC-DT1T2 diluted 100 times was used as a template, and the high-fidelity enzyme PrimeStarMax Premix (TaKaRa) was used for PCR amplification. The PCR amplification system was: PrimeStarMax Premix (2×) 25μL, template 2.5μL, upstream and downstream primers 2.5μL each, ddH2O 17.5μL. The PCR reaction program was: 98℃10s, 58℃5s, 72℃15s, 38 cycles; 72℃5min.

[0031] The target sequence adapter primer (the underlined part is the target sequence) is as follows:

[0032] Target1 sequence primer: Target1F

[0033] ATATATGGTCTCGATTG GAATATCAGCGAACTCCGG GTTTTAGAGCTAGAAATAGC;SEQ ID NO.4;

[0034] Target2 sequence primer: Target2R

[0035] ATTATTGGTCTCGAAAC CTGGGAATGGCTGTTCCAC CAATCTCTTAGTCGACTCTAC; SEQ ID NO.5.

[0036] 2) Vector digestion:

[0037] The CRISPR / Cas9 vector PBSE402 was digested with restriction endonuclease BsaI (NEWENGLAND BioLabs). The digestion system was: PBSE402 2 μg, CutSmart buffer 5 μL, BsaI 1 μL, ddH2O to 50 μL. Digestion was performed at 37°C for 2 h, and gel recovery was performed after electrophoresis detection.

[0038] PCR product and vector connection: The PCR amplified product was connected to the vector PBSE402 after restriction digestion by homologous recombination. The connection system is: the molar ratio of vector to insert fragment is about 1:2; 5× reaction buffer 4μL; NovoRec Plus recombinase 1μL; ddH2O is made up to 20μL. 50℃, connection for 10min.

[0039] The recombinant plasmid backbone is shown in Figure 1 .

[0040] 3) Recombinant plasmid transformation:

[0041] Take 5 μl of the ligation product and heat-shock transform it into E. coli competent DH5a, apply it to LB solid culture plate containing 50 mg / L kanamycin, and culture it overnight at 37° C. Use primers U626-IDF / U629-IDR to detect the positive colony.

[0042] The specific primer sequences are as follows:

[0043] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC; SEQ ID NO.6;

[0044] U629-IDR: AGCCCTCTCTCTTTCGATCCATCAAC; SEQ ID NO.7.

[0045] After sequencing was correct, the recombinant plasmid was extracted and transformed into Agrobacterium competent cells EHA105. After PCR verification, it was used for watermelon genetic transformation. The steps of Agrobacterium transformation are as follows:

[0046] Take 1 μl of recombinant plasmid and add it to Agrobacterium EHA105 competent cells, insert it into an ice box for 5 minutes, then put it into liquid nitrogen for quick freezing for 5 minutes, put it into a 37℃ water bath for 5 minutes, add 400 μl of antibiotic-free medium to each tube for recovery, and transfer it to a shaker at 200 rpm and 28℃ for shaking. Take 100 μl of the recovered bacterial solution and spread it on LB solid medium containing antibiotics, dry it at room temperature, and after the bacterial solution is fully absorbed, turn the culture dish upside down and culture it in a 28℃ incubator for 2-3 days.

[0047] Example 3

[0048] 1) Genetic transformation of watermelon:

[0049] Take full watermelon germplasm 'TC' seeds, soak them in 50-55℃ distilled water for about 30 minutes, and then peel off the seed shells. Wash the peeled kernels with 75% alcohol for about 30 seconds in a clean bench, wash them twice with sterile water, and then soak them in 3% sodium hypochlorite for 15 minutes for disinfection. After washing with sterile water for 5-7 times, dry them, sow them in MS solid culture medium, and culture them in the dark at 25℃ for 3 days.

[0050] After the seeds germinate, remove them, cut off the two ends of the cotyledons, and divide the remaining cotyledons into 8 pieces for easy infection. During this period, the EHA105 single colony containing the recombinant plasmid verified by PCR was picked into LB liquid medium containing 50 mg / L kanamycin and 20 mg / L rifampicin, and the bacterial solution was shaken to an OD of 600 =0.8, resuspend the bacterial solution in MS culture medium (MS5194.43g / L, sucrose 30g / L, 6-BA 1.5mg / L) to a final concentration of OD 600 = 0.2 to obtain a bacterial suspension. The cut cotyledons were soaked in the bacterial suspension for 15 min, taken out and dried, and then co-cultivated in a co-cultivation medium (CM: MS519 4.43 g / L, sucrose 30 g / L, G3251 (PhytoTechLabs) 3 g / L, 6-BA 1.5 mg / L) padded with filter paper and cultured at 25°C in the dark for 3 days.

[0051] After 3 days of co-cultivation, the cotyledon blocks were removed and washed with sterile water to remove excess Agrobacterium liquid on the surface (washed about 5-7 times) until the sterile water was clear. After being taken out and dried, they were placed on recovery medium (RM: MS5194.43g / L, sucrose 30g / L, G32513g / L, 6-BA 1.5mg / L, Timentin 200mg / L) for recovery culture at 28°C for 7 days.

[0052] After 7 days, the cotyledons of the recovery culture were transferred to MS medium (selective medium SM) containing 1.5 mg / L 6-BA, 200 mg / L Timentin and 1.4 mg / L Basta for selection culture, and subcultured at 28°C for 3-4 weeks, with subculture every 7 days. After that, the explants with obvious buds were transferred to the bud elongation medium (containing 4.43 g / L MS524, 30 g / L sucrose, 3 g / LG3251, 1 g / L inositol, 500 μL / L SH organic solution, 0.01 mg / L NAA, 0.1 mg / L 6-BA, 200 mg / L Timentin and 1.4 mg / L Basta), and the culture conditions were 28°C, 8 h / d in the dark, 16 h / d in the light, and the light intensity was 8000 Lx. The selected buds were cut off (note that the incision should not contain callus), and transferred to MS medium containing 0.5 mg / L IBA and 200 mg / L Timentin for rooting culture at 28°C until rooting.

[0053] SH organic solution contains 10g / L nicotinic acid, 10g / L VB1, and 1g / L VB6.

[0054] When the regenerated seedlings have roots and grow to 4-5 true leaves, take them out of the culture bottle, slowly rinse off the culture medium at the roots with clean water, transplant them to the substrate that has been sterilized at high temperature and high pressure in advance, water them thoroughly and keep them warm and moist. After 3-4 days, you will see water droplets on the cover of the hole tray, and gradually open the cover to harden the seedlings.

[0055] 2) Detection of genetically modified watermelon plants:

[0056] The PBSE402 vector carries a GFP fluorescent tag, and the CTAB method is used to extract the DNA of the watermelon regenerated seedlings with GFP fluorescence. The steps are as follows: take a small part of the young leaves, quickly grind them into powder in liquid nitrogen, and put them in a 1.5 ml centrifuge tube; add preheated 800 μl CTAB extraction buffer, and water bath at 65°C for 30 minutes; add an equal volume of chloroform and isoamyl alcohol, wherein the volume ratio of chloroform to isoamyl alcohol is 24:1, and centrifuge at 8000r / min for 10 minutes after mixing; transfer the supernatant to a new centrifuge tube, add 2 / 3 volume of isopropanol, and gently mix by turning upside down; centrifuge at 10000r / min for 10 minutes; pour out the supernatant, rinse the precipitate twice with 75% volume ethanol, and then drain the remaining liquid after pouring it out. After drying for 3 minutes, dissolve it with 100μl ddH2O (containing 0.1% RNase), and store it at 4°C for later use.

[0057] Using the extracted DNA as template, the sequences of the two target sites were amplified by PCR using target 1 primer ClSPR-CRJC-F1 / R1 and target 2 primer ClSPR-CRJC-F2 / R2, respectively. The positive control was the recombinant plasmid, and the negative control was the non-transgenic plant DNA.

[0058] The specific primer sequences are as follows:

[0059] ClSPR-CRJC-F1:

[0060] ATTATTCTCATCTACTTCCTGCTT;SEQ ID NO.8;

[0061] ClSPR-CRJC-R1:

[0062] TTTTCTTTTTCTTTTATCTACCGT;SEQ ID NO.9;

[0063] ClSPR-CRJC-F2:

[0064] GGAGGGTTGATAGATTGGGGTTT;SEQ ID NO.10;

[0065] ClSPR-CRJC-R2:

[0066] TAGGAGTAAGTTAGCATGTTTGGT; SEQ ID NO. 11.

[0067] The amplification system was: 2×Taq PCR StarMix with loading Dye 10μL, template 1μL, upstream and downstream primers 1μL each, ddH2O 7μL. The PCR reaction program was: 94℃3min; 94℃30s, 58℃30s, 72℃1min, 30 cycles; 72℃5min. The PCR products were recovered according to the band size and TA cloned. After the bacterial solution PCR was positive, the clones were selected for testing to confirm the editing event. The results are shown in Figure 2 A total of two gene-edited plants, Clspr_1 and Clspr_2, were obtained, with 4bp and 1bp missing in Target1, respectively, and 7bp and 6bp missing in the target region of Target2, respectively.

[0068] 3) Phenotypic observation of transgenic watermelon plants:

[0069] The edited plants Clspr_1 and Clspr_2 were planted in a solar greenhouse and managed normally. When the fruits were ripe (35 days after pollination), their phenotypes were observed: compared with the wild-type plants (WT), the fruits were covered with dark green stripes ( Figure 2), the fruits of the edited plants were covered with reticular stripes and the phenotype was changed.

[0070] In summary, the present invention provides a method for creating reticulated rind watermelon germplasm through gene editing technology. By sequence editing the rind stripe regulatory gene ClSPR, a reticulated stripe watermelon line can be quickly obtained, which can provide technical support for the targeted improvement of the rind stripe phenotype of excellent watermelon germplasm.

[0071] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of watermelon KNOX transcription factor ClSPR in creating netted rind watermelon, characterized in that: The CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.

1.

2. The application of biological materials with knockout of watermelon KNOX transcription factor ClSPR in creating netted rind watermelon, characterized in that: The CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1; The biological material is any one of the following: A: An expression cassette capable of silencing the watermelon KNOX transcription factor ClSPR; B: a recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

3. A method for creating a new germplasm of netted rind watermelon, characterized in that: CRISPR / Cas9 gene editing technology was used to perform site-specific editing on the watermelon KNOX transcription factor ClSPR; the CDS sequence of the watermelon KNOX transcription factor ClSPR was shown in SEQ ID NO.1.

Images