Efficient genetic transformation method of stem tumor sesbania

Abstract

The invention discloses an efficient genetic transformation method of stem tumor sesbania, and belongs to the technical field of plant genetic transformation. According to the efficient genetic transformation method of the stem tumor sesbania, the cotyledonary node is used as the initial explant, callus induction is not needed, an optimized culture medium component is combined, a genetic transformation system of the stem tumor sesbania can be rapidly and effectively established, the genetic transformation efficiency can be improved and can reach 25% or above, the transformation time is shortened, and the cost is reduced. And a foundation is laid for domestication and accurate improvement work of the stem tumor sesbania.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic transformation, and specifically relates to a high-efficiency genetic transformation method of stem nodule sesbania, and in particular to a high-efficiency genetic transformation method using cotyledon nodes of stem nodule sesbania as explants. Background Art

[0002] Sesbania rostrata, also known as hairy calyx sesbania or beaked sesbania, is a herbaceous plant of the genus Sesbania in the Leguminosae family. It is a high-yield and high-quality leguminous green manure originating from tropical and subtropical regions. Sesbania rostrata is a dual nitrogen-fixing plant that can fix nitrogen in both the roots and stems. The activity of nitrogenase in the nodules is 2.3 times that of the nodules, and the nitrogen fixation capacity of a single plant nodule can reach 46 times that of the nodules. In addition, since it can carry out biological nitrogen fixation by forming nodules, it is less affected by soil factors and is the target plant for leguminous plant breeding. Therefore, it is necessary to conduct research on its transgenic and genetic transformation.

[0003] Patent document CN115710589A (hereinafter referred to as document 1) has disclosed a genetic transformation method of Sesbania cannabina, which uses aseptically cultured cotyledons or aseptically cultured hypocotyls as explants, induces callus formation after Agrobacterium infection, and further differentiates to produce regenerated transgenic plants. However, on the one hand, the method disclosed in the document 1 is subject to large species limitations and is difficult to be applied to stem tumor Sesbania or other varieties in the genus Sesbania. On the other hand, the genetic transformation efficiency of the method disclosed in the document 1 is low, wherein the transformation efficiency when using aseptically cultured cotyledons as explants is only 5%, and when using aseptically cultured hypocotyls as explants, the transformation efficiency is only 12%. Therefore, there is an urgent need for an efficient genetic transformation method suitable for stem tumor Sesbania to provide a basis for the domestication and precise improvement of stem tumor Sesbania. Summary of the invention

[0004] In response to one or more problems existing in the prior art, one aspect of the present invention provides a method for efficient genetic transformation of stem nodule sesbania, which uses the cotyledonary nodes of sterile stem nodule sesbania seedlings as explants, inducing the production of adventitious buds through Agrobacterium infection and recovery culture, and then obtaining stem nodule sesbania rooted regenerated plants after screening, subculture and rooting culture.

[0005] In some embodiments, the method for preparing the explant includes the following operations: taking the cotyledon with a section of hypocotyl from the sterile seedling of the tuber sesbania, cutting off the hypocotyl, leaving about 1 mm (e.g., 0.8-1.2 mm), separating the cotyledons along the gap between the two cotyledons, cutting off half of the cotyledons, scraping off the growth point to obtain the cotyledon node of the tuber sesbania, and marking 8-10 wounds in the meristem of the cotyledon node as the explant.

[0006] In some embodiments, the genetic transformation method comprises the following steps:

[0007] (1) Preparation of sterile seedlings of Sesbania sesbania: sterilized Sesbania sesbania seeds were inoculated into 1 / 2MS solid culture medium to obtain sterile seedlings of Sesbania sesbania;

[0008] (2) Explant preparation: obtaining cotyledon nodes from the sterile seedlings of the tuber sesbania as explants;

[0009] (3) Infection and co-cultivation: The explants are infected with an Agrobacterium infection solution, and after infection, the explants are dried and placed in a co-cultivation medium for dark cultivation to obtain co-cultivation explants;

[0010] (4) recovery culture: inserting the co-culture explant with the wound side facing upward obliquely into the recovery culture medium and culturing until adventitious buds grow out;

[0011] (5) Screening culture: Cut off the cotyledon part of the adventitious bud tissue grown on the recovery medium, scrape off the dark brown surface at the base of the explant with clustered buds, and transfer it to the screening medium for culture;

[0012] (6) Subculture: After 3-4 weeks of screening and culture, the dead adventitious buds are removed and the surviving adventitious buds are transferred to the subculture medium for subculture;

[0013] (7) Rooting culture: The adventitious buds obtained by subculture in step (6) are transferred to a rooting medium to obtain rooted regenerated plants of nodular Sesbania sesbania.

[0014] In some embodiments, the ingredients of the 1 / 2MS solid culture medium in step (1) are: 1 / 2MS culture medium, 20-30 g / L sucrose, and 3-5 g / L plant gel.

[0015] In some embodiments, the operation of preparing the sterile seedlings of tuber sesbania in step (1) includes: grinding the skin of tuber sesbania seeds and washing them with distilled water for 2-3 times; disinfecting them with 75% alcohol for 1-2 minutes; soaking and disinfecting them with 30%-40% bleach water for 2-3 times, shaking and washing them on a shaker at 100-200 rpm for 20-30 minutes each time; soaking the seeds with sterile water for 4-5 times; after the last washing, placing the seeds on sterilized filter paper and absorbing them; inoculating the dried seeds on 1 / 2MS solid culture medium and culturing them at 25-28°C in weak light (light intensity 5-100lx) for 6-7 days.

[0016] In some embodiments, the composition of the co-cultivation medium in step (3) is: 1 / 10 LS medium, 1 / 10 MS organic component, 0.4-0.6 g / L MES, 10-20 g / L glucose, 100-200 μM / L acetosyringone, 3-5 g / L plant gel, and the pH is adjusted to 5.6; or the composition of the co-cultivation medium is: LS medium, 0.4-0.6 g / L vitamin B6, 0.4-0.6 g / L niacin, 0.4-0.6 g / L MES, 2.0-3.0 mg / L CuSO4·5H2O, 20-30 g / L sucrose, 4-6 mg / L zeatin, 3-5 g / L plant gel, and the pH is adjusted to 5.8.

[0017] In some embodiments, the Agrobacterium in step (3) is selected from LBA4404, GV3101, EHA105, AGL0 and AGL1.

[0018] In some embodiments, the time for infecting the explant with the Agrobacterium infection solution in step (3) is 5-20 minutes, optionally under gentle shaking conditions of a shaker at 120-180 rpm.

[0019] In some embodiments, the dark culture time in step (3) is 3-4 days and the temperature is 23±2°C.

[0020] In some embodiments, the recovery medium in step (4) is composed of: LS medium, 0.4-0.6 g / L vitamin B6, 0.4-0.6 g / L niacin, 0.4-0.6 g / L MES, 2.0-3.0 mg / L CuSO4·5H2O, 20-30 g / L sucrose, 3-5 g / L phytagel, 4-5 mg / L zeatin, 300-400 mg / L carbenicillin, pH adjusted to 5.8; or the recovery medium is composed of: MS medium, 1.8-2.2 mg / L 2,4-D, 0.8-1.2 mg / L kinetin, 3-5 g / L phytagel, 20-30 g / L sucrose; or the recovery medium is composed of: MS medium, 0.8-1.2 mg / L 6-benzylaminoadenine, 0.8-1.2 mg / L kinetin, 0.8-1.2 mg / L thidiazuron, 0.14-0.16 mg / L naphthaleneacetic acid, 20-30 g / L sucrose, 3-5 g / L plant gel; or the recovery medium is composed of: MS medium, 0.08-0.12 g inositol, 0.4-0.6 mg / L 6-benzylaminoadenine, 0.8-1.2 mg / L 2,4-D, 0.8-1.2 mg / L NAA, 20-30 g / L sucrose, 3-5 g / L plant gel.

[0021] In some embodiments, the conditions for culturing on the recovery medium in step (4) are: culturing at 25±2°C under light conditions of 16 / 8h light and dark conditions until adventitious buds grow, and culturing can be optional for 2-3 weeks.

[0022] In some embodiments, the composition of the screening medium in step (5) is: LS medium, 0.4-0.6 g / LMES, 2.0-3.0 mg / L CuSO4·5H2O, 15-20 g / L sucrose, 3-5 g / L plant gel, 4-5 mg / L zeatin, 300-400 mg / L carbenicillin, 3-5 mg / L glufosinate, or 5-10 mg / L glyphosate, or 3-5 mg / L G418, or 6-18 mg / L hygromycin (where glufosinate, glyphosate, G418 and hygromycin are all used as screening agents, and one of them can be selected when used, preferably glufosinate), and the pH is adjusted to 5.8.

[0023] In some embodiments, the culture medium used in the subculture in step (6) is the recovery culture medium used in step (4).

[0024] In some embodiments, the conditions for culturing on the subculture medium in step (6) are: 25±2°C light, 16 / 8h light / dark conditions until the adventitious buds of the tumorous sesbania reach 3-5 cm, and new culture medium is replaced every 20-30 days.

[0025] In some embodiments, the composition of the rooting medium in step (7) is: 1 / 2MS medium, 20-30 g / L sucrose, 3-5 g / L plant gel, 150-200 mg / L carbenicillin, 0.04-0.06 mg / L naphthaleneacetic acid, and the pH is adjusted to 5.8.

[0026] In some embodiments, the conditions for culturing on the rooting medium in step (7) are: culturing under light at 25±2°C, and optionally culturing for 2-3 weeks until the plant height is ≥8 cm to obtain the stem tumor sesbania rooted regenerated plants.

[0027] The transformation efficiency of the genetic transformation method of glufosinate-ammonium is above 25%, preferably above 30%.

[0028] On the other hand, the present invention also provides a method for cultivating transgenic tumorous sesbania, which comprises obtaining tumorous sesbania root-regenerated plants according to the efficient genetic transformation method of tumorous sesbania provided by the present invention, and screening and molecularly detecting the tumorous sesbania root-regenerated plants to obtain transgenic tumorous sesbania plants into which the target gene is transferred.

[0029] The efficient genetic transformation method of stem tumor sesbania provided based on the above technical scheme adopts cotyledon nodes as explants for transformation and optimizes the culture medium formula. The explants differentiate quickly, the number of differentiation is large, the growth is strong, and the regeneration efficiency is much higher than that of cotyledons and hypocotyls as explants. At the same time, using cotyledon nodes as explants does not require inducing the formation of callus tissue, but can directly induce the production of adventitious buds, which greatly shortens the regeneration time and can provide a basis for the domestication and precise improvement of stem tumor sesbania.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] (1) The method for genetic transformation of cotyledonary nodes of stem nodule sesbania established in the present invention fills the gap in the genetic transformation system of stem nodule sesbania.

[0032] (2) The present invention explored and optimized the processing methods and culture conditions in the transformation process through experiments, and successfully established a stable Agrobacterium-mediated genetic transformation system of cotyledon nodes of stem tumor Sesbania sesbania.

[0033] (3) The genetic transformation method of the present invention has high transformation efficiency, is not genotype-specific, and has a short transformation cycle, with the entire process taking only about 3 months. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The photographs are of the cotyledon node (A), the adventitious bud of the cotyledon node (B), the resistant bud of Sesbania obtained after screening with the screening medium (C), and the tumorous Sesbania plant obtained after culture with the rooting medium (D) obtained in Example 1. DETAILED DESCRIPTION

[0035] The present invention aims to provide a highly efficient genetic transformation method using the cotyledonary nodes of stem tumor sesbania as explants, which mainly comprises the following steps:

[0036] (1) Preparation of sterile seedlings of Sesbania sesbania: sterilized Sesbania sesbania seeds were inoculated into 1 / 2MS solid culture medium to obtain sterile seedlings of Sesbania sesbania;

[0037] (2) Explant preparation: obtaining cotyledon nodes from the sterile seedlings of the tuber sesbania as explants;

[0038] (3) Infection and co-cultivation: The explants are infected with an Agrobacterium infection solution, and after infection, the explants are dried and placed in a co-cultivation medium for dark cultivation to obtain co-cultivation explants;

[0039] (4) recovery culture: inserting the co-culture explant with the wound side facing upward obliquely into the recovery culture medium and culturing until adventitious buds grow out;

[0040] (5) Screening culture: The cotyledon part of the adventitious bud tissue grown on the recovery medium is cut off, the dark brown surface at the base of the explant with a large number of clustered buds is scraped off, and the explant is transferred to the screening medium containing the corresponding screening agent for culture;

[0041] (6) Subculture: After 3-4 weeks of screening, the dead adventitious buds are removed and transferred to the subculture medium for subculture;

[0042] (7) Rooting culture: The adventitious buds cultured in step (6) are transferred to a rooting medium to obtain rooted regenerated plants of nodular Sesbania sesbania.

[0043] Based on the genetic transformation method provided by the present invention, the transformation efficiency can reach more than 25%, preferably more than 30%.

[0044] The present invention is further described below in conjunction with specific embodiments. It should be understood that the specific embodiments are only used to further illustrate the present invention, rather than to limit the content of the present invention.

[0045] In the following, only some exemplary embodiments are briefly described. As those skilled in the art will appreciate, the described embodiments may be modified in various ways without departing from the spirit or scope of the present invention. Therefore, the drawings and descriptions are considered to be exemplary and non-restrictive in nature.

[0046] The methods used in the following examples are all conventional methods unless otherwise specified. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).

[0047] The methods for obtaining various biological materials described in the examples are only to provide a method for obtaining them in an experiment to achieve the specific disclosed purpose, and should not be a limitation on the source of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological materials that can be obtained without violating laws and moral ethics can be replaced and used according to the instructions in the examples. The experimental materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores.

[0048] The nucleotide sequences involved in the following examples can all be synthesized by existing technologies. The JRH0951 vector used in the examples is recorded in the following documents: Sun X et al. Targeted mutagenesis in soybean using the CRISPR-Cas9 system [J]. Scientific reports, 2015, 5 (1): 10342 and Li C et al. Adomestication-associated gene GmPRR3b regulates the circadian clock and flowering time in soybean [J]. Molecular plant, 2020, 13 (5): 745-759, which can be obtained by the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The biological material is only used to repeat the relevant experiments of the present invention and is not used for other purposes.

[0049] The term "MS medium" used in this article refers to the abbreviation of the medium developed by Murashige and Skoog, purchased from Beijing Ximeijie Technology Co., Ltd., product number M519; the term "1 / 2MS medium" refers to the medium obtained by reducing the usage of all components in the MS medium to half of the original amount; the term "1 / 10MS organic component" means that the usage of the organic component in the MS medium is reduced to one tenth of the original amount.

[0050] The term "LS medium" used in this article is the abbreviation of Linsmaier & Skoog plant tissue culture medium, purchased from Beijing Ximeijie Technology Co., Ltd., product number L689; the term "1 / 10LS medium" refers to the medium obtained by reducing the usage of all components in the LS medium to one tenth of the original amount.

[0051] Example 1: Highly efficient genetic transformation of stem tumor Sesbania

[0052] 1.1. Construction of genetic transformation expression vector

[0053] (1) Using the JRH0951 vector as a template, primers F1+R1 (as shown below) were used to amplify product A (GmU6+sgRNA), the nucleotide sequence of which is shown in SEQ ID NO: 1 below:

[0054] gcttaggccttctagacgacggccagtgaattcaaaataaatggtaaaatgtcaaatcaaaactaggctgcagtatgcagagcagagtcatgatgatactacttactacaccgattcttgtgtgcagaaaaatatgttaaaataattgaatctttctctagccaaatttgacaacaatgta caccgttcatattgagagacgatgcttcttgtttgctttcggtggaagctgcatatactcaacattactccttcagcgagtttccaactgagtcccacattgcccagacctaacacggtattcttgtttataatgaaatgtgccaccacatggattTGTGGCACTTGGAGTTGCAA(SEQ ID NO:1);

[0055] (2) Using the JRH0951 vector as a template, primers F2+R2 (as shown below) were used to amplify product B (sgRNA+scaffold), the nucleotide sequence of which is shown in SEQ ID NO: 2 below:

[0056] TGTGGCACTTGGAGTTGCAAaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttttgga tcctctagagtcgacctgcaggcatgcaagcttggcgtaatcattctagaacgcgttgccg (SEQ ID NO: 2);

[0057] (3) The soybean gene editing vector RPS5A-Cas9 vector (see Zhao, F. et al. (2022). CRISPR-Cas9-engineered mutation to identify the roles of phytochromes in regulating photomorphognesis and flowering time in soybean. Crop J. 10, 1654-1664) was digested with XbaⅠ and connected with products A and B to obtain a genetic transformation expression vector (i.e., the target gene vector, which contains the Bar resistance gene;

[0058] F1: GCTTAGGCCTTCTAGAcgacggccagtgaattcaaa (SEQ ID NO: 3);

[0059] R1: TTGCAACTCCAAGTGCCACAaatccatgtggtggcacatt (SEQ ID NO: 4);

[0060] F2: TGTGGCACTTGGAGTTGCAAgttttagagctagaaatagcaagtta (SEQ ID NO: 5);

[0061] R2: CGGCAACGCGTTCTAGAatgattacgccaagcttgca (SEQ ID NO: 6).

[0062] 1.2 Agrobacterium transformation

[0063] This experiment is used to construct Agrobacterium containing the target gene vector and the marker gene (Bar resistance gene), and specifically includes the following operations:

[0064] Transformation of Agrobacterium EHA105 with the target gene vector: Take out the EHA105 competent cell (China, Shanghai, Cat: AC1010) from the -80°C freezer and place it on ice to melt; Add 100 ng of the target gene vector (obtained in step 1.1 above) to 100 μL EHA105 competent cell and place it on ice for 20 min; Use the electroporation method for transformation, add 200 μL of antibiotic-free liquid LB culture medium after electroporation, place in a shaker, and incubate at 28°C, 200 rpm for 1 h; Spread the entire bacterial liquid on LB solid culture medium containing kanamycin (50 μg / mL) and rifampicin (100 μg / mL), and culture inverted at 28°C for 2 days. After the colonies grow, pick a single positive clone and add it to the liquid LB medium with kanamycin (50 μg / mL) and rifampicin (100 μg / mL), and culture it at 28°C and 180 rpm for 16 hours. The bacterial liquid at this time is the Agrobacterium bacterial liquid transformed with the target gene vector, which can be preserved with 50% glycerol at a volume ratio of 1:1 and stored in a -80°C refrigerator.

[0065] 1.3. Specific steps of genetic transformation

[0066] 1.3.1 Preparation of sterile seedlings of Sesbania sesbania

[0067] (1) Collect mature pods from tuber sesbania plants, remove the shells, select plump and spot-free seeds, grind the tuber sesbania seeds, wash them 2-3 times with distilled water; disinfect them with 75% alcohol for 1 minute, and wash them thoroughly with distilled water; soak and disinfect them with 30%-40% Kao bleach 2-3 times, shaking and washing them on a shaker at 100-200 rpm for 20-30 minutes each time; soak and wash the seeds with sterile water 4-5 times; after the last wash, place the seeds on sterilized filter paper and blot them dry.

[0068] (2) Inoculate the dried seeds into 1 / 2MS solid culture medium (culture medium composition: 1 / 2MS culture medium, 30g / L sucrose, 4g / L plant gel, pH = 5.8), inoculate 20-25 seeds per plate, and try to spread the seeds as much as possible to obtain the maximum growth space. Cultivate at 25-28°C in weak light (light intensity 5-100lx) for 6-7 days until the cotyledons of the seedlings grow out but have not yet unfolded, and obtain the aseptic seedlings of stem nodule sesbania.

[0069] 1.3.2 Explant preparation

[0070] Take the cotyledon with a section of hypocotyl from the sterile cultured tuber sesbania seedling obtained in step 1.3.1, and cut it off. Leave about 1 mm of hypocotyl, separate the cotyledons along the gap between the two cotyledons, cut off half of the cotyledon, scrape off the growth point, and obtain the cotyledon node of tuber sesbania. Then make 8-10 wounds in the meristem of the cotyledon node as the explant. Figure 1 Panel A in the middle is a photograph of a cotyledon node used as an explant.

[0071] 1.3.3 Infection and co-cultivation

[0072] The explant prepared in step 1.3.2 is co-cultured with Agrobacterium infection solution, wherein the Agrobacterium infection solution is obtained by shaking (gentle shaking at 150 rpm on a shaker) the Agrobacterium transformed in step 1.2 (containing the target gene vector and the marker gene Bar) in an infection solution containing 200 μM / L acetosyringone (composed of: 1 / 10 LS culture medium, 0.05 g / L vitamin B6, 0.05 g / L nicotinic acid, 0.2 g / L glycine, 0.5 g / L MES (2-(N-morpholinyl)ethanesulfonic acid), 10 g / L glucose, 100-200 μM / L acetosyringone, pH adjusted to 5.6); specifically, the explant and the Agrobacterium infection solution are gently shaken and cultured on a shaker at 150 rpm for 5-10 minutes, and after the infection is completed, they are placed on sterilized filter paper and blown dry. The explants were then inoculated into co-cultivation medium (medium composition: 1 / 10 LS medium, 1 / 10 MS organic component, 0.5 g / L MES, 10 g / L glucose, 200 μM / L acetosyringone, 4 g / L phytagel, pH adjusted to 5.6) and cultured at 23°C in the dark for 3-4 days to obtain co-cultivation explants.

[0073] 1.3.4 Recovery culture

[0074] The wound side of the co-cultured explant was inserted obliquely into the recovery medium (medium composition: LS medium, 0.5 g / L vitamin B6, 0.5 g / L niacin, 0.5 g / L MES, 2.5 mg / L CuSO4·5H2O, 20 g / L sucrose, 4 g / L phytagel, 5 mg / L zeatin, 400 mg / L carbenicillin (pH adjusted to 5.8)) and cultured at 25°C with 16 / 8 h light and dark conditions for 2 weeks until adventitious buds grew out. Figure 1 As shown in panel B.

[0075] 1.3.5 Screening and culture

[0076] The cotyledon part of the adventitious bud tissue grown on the recovery medium was cut off, the dark brown surface at the base of the explant with a large number of clustered buds was scraped off, and the explants were transferred to the screening medium containing the corresponding screening agent (medium composition: LS medium, 0.5g / LMES, 2.5mg / L CuSO4·5H2O, 20g / L sucrose, 4g / L plant gel, 5mg / L zeatin, 400mg / L carbenicillin, 5mg / L glufosinate (CAS: 77182-82-2) (pH adjusted to 5.8)) for culture.

[0077] 1.3.6 Subculture

[0078] After 3-4 weeks of screening and culture, remove the dead adventitious buds and transfer the surviving adventitious buds to the subculture medium for subculture. The subculture medium is the recovery medium in step 1.3.4. Replace the new medium every 20-30 days until the adventitious buds reach 3-5 cm. Culture at 25°C under light. Figure 1 Panel C in the middle shows the tumor-resistant buds of Sesbania sesbania obtained by subculture after selection with the selection medium.

[0079] 1.3.7 Rooting culture

[0080] The adventitious buds of the tuber sesbania were transferred to a rooting medium (composition of the medium: 1 / 2MS medium, 30 g / L sucrose, 4 g / L phytagel, 200 mg / L carbenicillin, 0.05 mg / L naphthaleneacetic acid (pH = 5.8)), and cultured under light at 25°C for 2-3 weeks until the plant height reached about 10 cm, to obtain a tuber sesbania rooted regenerated plant, such as Figure 1 As shown in panel D.

[0081] 1.4. Identification of transgenic positive plants

[0082] In this step, 2×Rapid Taq Master Mix (China, Beijing, Cat: P112-03) of Novozymes was used for ordinary PCR amplification to verify whether the root-regenerated plants of Sesbania sesbania obtained in step 1.3 above were transgenic plants of Sesbania sesbania with the target gene vector transferred into them. Specifically, the DNA samples extracted from the root-regenerated plants of Sesbania sesbania were PCR amplified using the primer pairs (CP7162 (F) and CP7163 (R)) shown below (reaction conditions: 95°C 5min, (95°C 30s, 55°C 30s, 72°C 30s) × 30 cycles, 72°C 5min). If a sequence (pGmU6-sgRNA-scaffold) with a fragment size of 487bp could be amplified, the root-regenerated plants of Sesbania sesbania were positive transgenic Sesbania sesbania plants containing the target gene vector in their genome.

[0083] CP7162(F):gcttaggccttctagacgacg (SEQ ID NO:7);

[0084] CP7163(R):tgattacgccaagcttgcat (SEQ ID NO:8).

[0085] The test results showed that when the number of initial cotyledon nodes used as explants was 60, 20 positive transgenic stem tumor Sesbania plants were finally identified, so the genetic transformation efficiency of Example 1 was about 33.3%.

[0086] Example 2

[0087] Example 2 refers to the operation of Example 1, except that the co-culture time of the aseptically cultured explant (cotyledon node of Sesbania truncatum) and the Agrobacterium infection solution is extended to 20 minutes in step 1.3.3 of "1.3, Specific operation steps for genetic transformation" in Example 1. The results show that extending the co-culture time of the explant and the Agrobacterium infection solution does not affect the differentiation state of the explant and the genetic transformation efficiency (which can reach more than 30%).

[0088] Example 3

[0089] Example 3 refers to the operation of Example 1, except that the composition of the co-cultivation medium in step 1.3.3 of "1.3, Specific Operation Steps for Genetic Transformation" in Example 1 is adjusted to: LS medium, 0.5 g / L vitamin B6, 0.5 g / L nicotinic acid, 0.5 g / L MES, 2.5 mg / L CuSO4·5H2O, 20 g / L sucrose, 5 mg / L zeatin, 4 g / L phytogel, pH adjusted to 5.8, and the only difference between this co-cultivation medium and the recovery medium in step 1.3.4 in Example 1 is that carbenicillin is not added. The explant is inoculated on this co-cultivation medium for co-cultivation and subsequent steps. After the change, the differentiation state of the explant and the genetic transformation efficiency (which can reach more than 30%) are not affected, and the workload of medium configuration can be reduced (the recovery medium in step 1.3.4 can be obtained by adding 300-400 mg / L carbenicillin to the co-cultivation medium).

[0090] Embodiment 4-7

[0091] Example 4 refers to the operation of Example 1, except that the composition of the co-cultivation medium in step 1.3.3 of "1.3, specific operation steps for genetic transformation" in Example 1 is adjusted to: LS medium, 0.4 g / L vitamin B6, 0.4 g / L niacin, 0.4 g / L MES, 2.0 mg / L CuSO4·5H2O, 20 g / L sucrose, 4 mg / L zeatin, 3 g / L plant gel, and the pH is adjusted to 5.8.

[0092] Example 5 refers to the operation of Example 1, except that the composition of the co-cultivation medium in step 1.3.3 of "1.3, specific operation steps for genetic transformation" in Example 1 is adjusted to: LS medium, 0.6 g / L vitamin B6, 0.6 g / L niacin, 0.6 g / L MES, 3.0 mg / L CuSO4·5H2O, 30 g / L sucrose, 6 mg / L zeatin, 5 g / L plant gel, and the pH is adjusted to 5.8.

[0093] Example 6 The operation of Example 1 was referred to, except that the composition of the recovery medium in step 1.3.4 in "1.3. Specific operation steps for genetic transformation" in Example 1 was adjusted to: LS medium, 0.4 g / L vitamin B6, 0.4 g / L niacin, 0.4 g / L MES, 2.0 mg / L CuSO4·5H2O, 20 g / L sucrose, 4 mg / L zeatin, 3 g / L phytagel, 300 mg / L carbenicillin, and the pH was adjusted to 5.8.

[0094] Example 7 The operation of Example 1 is referred to, except that the composition of the recovery medium in step 1.3.4 in "1.3. Specific operation steps for genetic transformation" in Example 1 is adjusted to: LS medium, 0.6 g / L vitamin B6, 0.6 g / L niacin, 0.6 g / L MES, 3.0 mg / L CuSO4·5H2O, 30 g / L sucrose, 6 mg / L zeatin, 5 g / L phytagel, 400 mg / L carbenicillin, and the pH is adjusted to 5.8.

[0095] The test results show that the above Examples 4-7 can achieve a genetic transformation efficiency of more than 30%.

[0096] Examples 8-10

[0097] Example 8 is performed in accordance with the procedures of Example 1, except that the screening agent glufosinate in step 1.3.5 of "1.3, Specific Operation Procedures for Genetic Transformation" in Example 1 is replaced with 8 mg / L glyphosate (CAS: 1071-83-6).

[0098] Example 9 is performed in accordance with the procedures of Example 1, except that the selection agent glufosinate in step 1.3.5 of "1.3, Specific operation steps for genetic transformation" in Example 1 is replaced with 12 mg / L hygromycin (CAS No: 64-75-5).

[0099] Example 10 was performed in accordance with the procedures of Example 1, except that the screening agent glufosinate in step 1.3.5 of "1.3, Specific Operation Procedures for Genetic Transformation" in Example 1 was replaced with 4 mg / L G418 (CAS No: 108321-42-2).

[0100] The test results show that when any one of the screening agents in Examples 8-10 above is used for screening and cultivation, the screening effect is relatively poor compared with that of using glufosinate as a screening agent, and relatively few seedlings emerge, but a genetic transformation efficiency of more than 20% (but not more than 30%) can still be achieved, while using glufosinate as a screening agent can achieve a genetic transformation efficiency of more than 30%. Therefore, in the genetic transformation method provided by the present invention, glufosinate, glyphosate, hygromycin and G418 can be used as screening agents, but glufosinate is preferably used.

[0101] Comparative Examples 1-4

[0102] Comparative Example 1 was carried out in accordance with the procedures of Example 1, except that the composition of the recovery medium in step 1.3.4 of "1.3, Specific Operation Procedures for Genetic Transformation" in Example 1 was adjusted to: MS medium, 2 mg / L 2,4-D, 1 mg / L kinetin, 4 g / L plant gel, and 30 g / L sucrose (recovery medium 1).

[0103] Comparative Example 2 was performed according to the procedures of Example 1, except that the composition of the recovery medium in step 1.3.4 of "1.3, Specific Operation Procedures for Genetic Transformation" in Example 1 was adjusted to: MS medium, 1 mg / L 6-benzylaminoadenine, 1 mg / L kinetin, 1 mg / L thidiazuron, 0.15 mg / L naphthaleneacetic acid, 30 g / L sucrose, and 4 g / L phytagel (recovery medium 2).

[0104] Comparative Example 3 was performed according to the procedures of Example 1, except that the composition of the recovery medium in step 1.3.4 of "1.3, Specific Operation Procedures for Genetic Transformation" in Example 1 was adjusted to: MS medium, 0.1 g / L inositol, 0.5 mg / L 6-benzylaminoadenine, 1 mg / L 2,4-D, 1 mg / L NAA, 30 g / L sucrose, and 4 g / L plant gel (recovery medium 3).

[0105] Comparative Example 4 was carried out in accordance with the procedures of Example 1, except that the composition of the recovery medium in step 1.3.4 of "1.3, Specific operation steps for genetic transformation" in Example 1 was adjusted to: MS medium 3 g / L, B5 vitamin 4 g / L, MES 1 g / L, sucrose 30 g / L, kinetin (KT) 0.5 mg / L, 6-benzyladenine (6-BAP) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L (pH 5.6) (recovery medium 4).

[0106] The results show that when any one of the recovery mediums 1-4 in the above comparative examples 1-4 is used to recover the co-cultured explants, the adventitious buds differentiated from the co-cultured explants are less and differentiate more slowly, and more adventitious buds are screened out after subsequent screening and culture, which ultimately leads to fewer root-regenerated plants of the stem nodule sesbania obtained after subsequent subculture and rooting culture. The test results show that when the number of the initial cotyledonary nodes as the explant is 60, when any one of the recovery mediums 1-4 in the above comparative examples 1-4 is used as the recovery medium, less than 9 positive transgenic stem nodule sesbania plants can be finally identified, so the genetic transformation efficiency of comparative examples 1-4 is less than 15%.

[0107] Comparative Example 5

[0108] Comparative Example 5 was operated according to Example 1, except that the rooting medium in step 1.3.7 of "1.3, Specific Operation Steps for Genetic Transformation" in Example 1 was adjusted to a conventional rooting medium (MS medium, 30 g / L sucrose, 0.05 mg / L naphthaleneacetic acid). The test results showed that the rooting medium of Example 1 had a more obvious advantage over the rooting medium of Comparative Example 5, and could more effectively promote the rapid rooting of the adventitious buds of stem tumor sesbania.

[0109] Finally, it should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for efficient genetic transformation of stem tumor sesbania, characterized in that: The genetic transformation method uses the cotyledonary nodes of the aseptic seedlings of the stem nodule sesbania as explants, inducing the production of adventitious buds through recovery culture after infection with Agrobacterium, and then obtaining the stem nodule sesbania rooted regenerated plants through screening, subculture and rooting culture.

2. The genetic transformation method according to claim 1, characterized in that The explant preparation method comprises the following operations: taking a cotyledon with a section of hypocotyl from the sterile seedling of the tuber sesbania, cutting off the cotyledon, leaving 0.8-1.2 mm of the hypocotyl, separating the cotyledons along the gap between the two cotyledons, cutting off half of the cotyledons, scraping off the growth point part to obtain the cotyledon node of the tuber sesbania, and marking 8-10 wounds in the meristem of the cotyledon node as the explant.

3. The genetic transformation method according to claim 1 or 2, characterized in that The genetic transformation method comprises the following steps: (1) Preparation of sterile seedlings of Sesbania sesbania: sterilized Sesbania sesbania seeds were inoculated into 1 / 2MS solid culture medium to obtain sterile seedlings of Sesbania sesbania; (2) Explant preparation: obtaining cotyledon nodes from the sterile seedlings of the tuber sesbania as explants; (3) Infection and co-cultivation: The explants are infected with an Agrobacterium infection solution, and after infection, the explants are dried and placed in a co-cultivation medium for dark cultivation to obtain co-cultivation explants; (4) recovery culture: inserting the co-culture explant with the wound side facing upward obliquely into the recovery culture medium and culturing until adventitious buds grow out; (5) Screening culture: Cut off the cotyledon part of the adventitious bud tissue grown on the recovery medium, scrape off the dark brown surface at the base of the explant with clustered buds, and transfer it to the screening medium for culture; (6) Subculture: After 3-4 weeks of screening and culture, the dead adventitious buds are removed and the surviving adventitious buds are transferred to the subculture medium for subculture; (7) Rooting culture: The adventitious buds obtained by subculture in step (6) are transferred to a rooting medium to obtain rooted regenerated plants of nodular Sesbania sesbania.

4. The genetic transformation method according to claim 3, characterized in that The ingredients of the 1 / 2MS solid culture medium in step (1) are: 1 / 2MS culture medium, 20-30 g / L sucrose, 3-5 g / L plant gel; and / or The operation of preparing the aseptic seedlings of the tuber sesbania in step (1) comprises: grinding the skin of the tuber sesbania seeds, washing them with distilled water for 2-3 times; disinfecting them with 75% alcohol for 1-2 minutes; soaking and disinfecting them with 30%-40% bleaching water for 2-3 times, and shaking and washing them on a shaker at 100-200 rpm for 20-30 minutes each time; soaking and washing the seeds with sterile water for 4-5 times; after the last washing, placing the seeds on sterilized filter paper and absorbing them; and inoculating the dried seeds on a 1 / 2MS solid culture medium and culturing them at 25-28°C under weak light (light intensity of 5-100lx) for 6-7 days.

5. The genetic transformation method according to claim 3 or 4, characterized in that: The composition of the co-cultivation medium in step (3) is: 1 / 10 LS medium, 1 / 10 MS organic component, 0.4-0.6 g / L MES, 10-20 g / L glucose, 100-200 μM / L acetosyringone, 3-5 g / L phytagel, and the pH is adjusted to 5.6; or the composition of the co-cultivation medium is: LS medium, 0.4-0.6 g / L vitamin B6, 0.4-0.6 g / L niacin, 0.4-0.6 g / L MES, 2.0-3.0 mg / L CuSO4·5H2O, 20-30 g / L sucrose, 4-6 mg / L zeatin, 3-5 g / L phytagel, and the pH is adjusted to 5.8; and / or The Agrobacterium in step (3) is selected from LBA4404, GV3101, EHA105, AGL0 and AGL1; and / or The time for infecting the explant with the Agrobacterium infection solution in step (3) is 5-20 minutes, optionally under gentle shaking conditions of a shaker at 120-180 rpm; and / or The dark culture time in step (3) is 3-4 days, and the temperature is 23±2°C.

6. The genetic transformation method according to any one of claims 3 to 5, characterized in that: The recovery medium in step (4) is composed of: LS medium, 0.4-0.6g / L vitamin B6, 0.4-0.6g / L niacin, 0.4-0.6g / L MES, 2.0-3.0mg / L CuSO4·5H2O, 20-30g / L sucrose, 3-5g / L phytagel, 4-5mg / L zeatin, 300-400mg / L carbenicillin, and the pH is adjusted to 5.8; or the recovery medium is composed of: MS medium, 1.8-2.2mg / L 2,4-D, 0.8-1.2mg / L kinetin, 3-5g / L phytagel, 20-30g / L sucrose; or the recovery medium is composed of: MS medium, 0.8-1.2mg / L 6-benzylaminoadenine, 0.8-1.2 mg / L kinetin, 0.8-1.2 mg / L thidiazuron, 0.14-0.16 mg / L naphthylacetic acid, 20-30 g / L sucrose, 3-5 g / L phytagel; or the recovery medium is composed of: MS medium, 0.08-0.12 g inositol, 0.4-0.6 mg / L 6-benzylaminoadenine, 0.8-1.2 mg / L 2,4-D, 0.8-1.2 mg / L NAA, 20-30 g / L sucrose, 3-5 g / L phytagel; and / or The conditions for culturing on the recovery medium in step (4) are: culturing at 25±2°C under light conditions of 16 / 8h until adventitious buds grow, and culturing can be optional for 2-3 weeks.

7. The genetic transformation method according to any one of claims 3 to 6, characterized in that: The screening medium in step (5) is composed of: LS medium, 0.4-0.6 g / L MES, 2.0-3.0 mg / L CuSO4·5H2O, 15-20 g / L sucrose, 3-5 g / L phytagel, 4-5 mg / L zeatin, 300-400 mg / L carbenicillin, 3-5 mg / L glufosinate, or 5-10 mg / L glyphosate, or 3-5 mg / L G418, or 6-18 mg / L hygromycin, and the pH is adjusted to 5.8; and / or The medium used in the subculture in step (6) is the recovery medium used in step (4); and / or The culture conditions in the subculture medium in step (6) are: 25±2°C illumination, 16 / 8h light / dark conditions, until the adventitious buds of the tuber sesbania grow to 3-5 cm, and the culture medium is replaced every 20-30 days.

8. The genetic transformation method according to any one of claims 3 to 7, characterized in that: The rooting medium in step (7) comprises: 1 / 2MS medium, 20-30 g / L sucrose, 3-5 g / L phytagel, 150-200 mg / L carbenicillin, 0.04-0.06 mg / L naphthaleneacetic acid, and the pH is adjusted to 5.8; and / or The culture conditions on the rooting medium in step (7) are: culture under light at 25±2° C., and culture can be selected for 2-3 weeks until the plant height is ≥8 cm, to obtain the stem tumor sesbania rooted regenerated plants.

9. The genetic transformation method according to any one of claims 1 to 8, characterized in that The transformation efficiency of the genetic transformation method is above 25%, preferably above 30%.

10. A method for cultivating transgenic tumorous sesbania, characterized in that: The method comprises obtaining the root-regenerated plants of Sesbania sesbania according to any one of the methods of claims 1 to 9, and screening and molecularly detecting the root-regenerated plants of Sesbania sesbania to obtain transgenic Sesbania sesbania plants into which the target gene is transferred.

Images