Application of rice gene OsbHLH176 in regulation and control of cold resistance

Abstract

The invention relates to the field of rice gene engineering, in particular to application of a rice gene OsbHLH176 in regulation and control of cold resistance. According to the invention, a rice gene OsbHLH176 of which the nucleotide sequence is shown as SEQ ID NO.1 is edited by utilizing a CRISPR-Cas9 gene editing technology, and the expression of the rice gene OsbHLH176 is knocked out, so that the cold-sensitive rice mutant is obtained. And an OsbHLH176 overexpression material is constructed by using a pC1390U vector. Experimental results show that compared with wild rice, the cold resistance of the OsbHLH176 overexpression mutant is obviously improved, while the cold resistance of the OsbHLH176 knockout mutant is weakened, which indicates that the gene is a positive regulatory factor in a cold resistance pathway. The invention provides a strategy for improving the cold tolerance of the rice, and provides a theoretical basis and practical guidance for improving the adaptability of the rice in a cold environment and agricultural production.

Description

Technical Field

[0001] The invention relates to the technical field of plant transgenic technology and crop genetic breeding, and in particular to the application of rice gene OsbHLH176 in regulating cold tolerance. Technical Background

[0002] Rice is an important food crop in the world. It is widely grown in Asia, providing staple food for billions of people. It is also gradually being promoted in Africa and South America. However, low temperature has a significant impact on rice growth, involving cell membrane stability, hormone balance, carbohydrate metabolism, signal transduction, and photosynthesis. Low temperature can damage cell membranes, leading to substance leakage and abnormal cell function; interfere with hormone regulation, affecting growth and development; disrupt carbohydrate metabolism and reduce overall energy utilization efficiency; weaken signal transduction capabilities and affect environmental adaptability; and reduce chlorophyll content and photosynthesis efficiency. In addition, low temperature also induces oxidative damage, accumulates superoxide dismutase (SOD) and malondialdehyde (MDA), and further damages metabolic function. Therefore, improving the cold tolerance of rice is crucial to ensuring yield.

[0003] Rice has different sensitivities to low temperatures at different growth stages. Low temperatures during the bud stage delay germination and even cause seedling rot; low temperatures during the seedling stage inhibit photosynthesis and tillering, which may lead to seedling death; low temperatures during the reproductive stage affect pollen development and pollination success rate, and reduce fruit set rate and grain quality. Cold-tolerant breeding has become a research focus, and the use of molecular methods to explore key genes and cultivate cold-tolerant varieties provides a new path to increase yields.

[0004] Cold-tolerant transcription factors play a core role in plant cold resistance, such as the CBF family regulating cold-responsive gene expression and enhancing cell membrane stability; the HSF family maintaining cell function stability; the WRKY family responds to low temperatures through multiple pathways such as regulating the antioxidant system; the NAC and MYB families are involved in cell wall synthesis and antioxidant metabolism, respectively. The cold-tolerant mechanism involves a complex network of low-temperature signal perception, plant hormone regulation, and phosphorylation modification.

[0005] This study discovered and verified the gene OsbHLH176 related to rice cold tolerance. This gene is located on chromosome 3. After knocking out the gene, rice cold tolerance was significantly reduced, while overexpression significantly enhanced low temperature adaptability. Based on this, a strategy to improve cold tolerance by regulating the expression of OsbHLH176 was proposed, which not only improves the cold resistance of rice, but also provides a reference for cold-tolerant breeding of other crops, and has broad application prospects in responding to climate change. Summary of the invention

[0006] In view of the deficiencies in the prior art, the purpose of the present invention is to provide an application of the rice gene OsbHLH176 in regulating cold tolerance. The present invention discovered the gene OsbHLH176 related to rice cold tolerance through high-throughput genomics analysis and functional genomics research. The gene is located on chromosome 3, the MSU_Locus number is LOC_Os03g19780, the full length of the genome sequence is 1091bp, the length of the coding region is 618bp, and the length of the encoded protein is 205 amino acid residues. The present invention verified the function of the OsbHLH176 gene under low temperature stress through gene knockout and overexpression. After knocking out the gene, the cold tolerance of rice seedlings was significantly weakened, which was manifested as an increase in mortality under low temperature conditions; while overexpressing the gene enhanced the cold tolerance of rice seedlings and significantly reduced the mortality under low temperature conditions.

[0007] In the first aspect, the present invention protects the use of protein OsbHLH176 in any of the following:

[0008] (A1) Application in enhancing cold tolerance of rice;

[0009] (A2) Use in the preparation of products for enhancing the cold tolerance of rice;

[0010] (A3) Application in breeding cold-tolerant rice;

[0011] Wherein, the protein is any one of the following:

[0012] (B1) a protein with an amino acid sequence as shown in SEQ ID NO: 2;

[0013] (B2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein of (B1), which has 80% or more identity with the protein shown in A1) and has the function of regulating cold resistance of rice;

[0014] (B3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of (B1) or (B2).

[0015] In order to facilitate purification or detection of the protein in A1), a tag protein may be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing.

[0016] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0017] The tag protein includes but is not limited to: GST (glutathione sulfhydryltransferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein, etc.

[0018] In a second aspect, the present invention protects the use of the gene encoding the protein described above in any of the following:

[0019] (A1) Application in enhancing cold tolerance of rice;

[0020] (A2) Use in the preparation of products for enhancing the cold tolerance of rice;

[0021] (A3) Application in breeding cold-tolerant rice;

[0022] The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0023] In a third aspect, the present invention also protects the use of a recombinant vector containing the gene described above in any of the following:

[0024] (A1) Application in enhancing cold tolerance of rice;

[0025] (A2) Use in the preparation of products for enhancing the cold tolerance of rice;

[0026] (A3) Application in breeding cold-tolerant rice.

[0027] In a specific embodiment, the backbone vector of the recombinant vector is a pC1390U vector.

[0028] In a fourth aspect, the present invention also protects the use of a microorganism containing the gene or the recombinant vector described above in any of the following:

[0029] (A1) Application in enhancing cold tolerance of rice;

[0030] (A2) Use in the preparation of products for enhancing the cold tolerance of rice;

[0031] (A3) Application in breeding cold-tolerant rice.

[0032] In a fifth aspect, the present invention protects a method for enhancing the cold tolerance of rice, the method comprising increasing the content and / or activity of the protein mentioned above in the target rice to improve the cold tolerance of the target rice.

[0033] In a specific embodiment, the increasing of the content and / or activity of the above-mentioned protein is achieved by increasing the expression level of the gene encoding the protein in the target rice.

[0034] In a sixth aspect, the present invention protects a method for cultivating cold-tolerant rice, the method comprising increasing the content and / or activity of the protein mentioned above in the target rice to improve the cold tolerance of the target rice.

[0035] In a specific embodiment, the increasing of the content and / or activity of the above-mentioned protein in the target rice is achieved by increasing the expression level of the gene encoding the protein in the target rice.

[0036] Beneficial Effects

[0037] The present invention proposes a strategy for improving the cold tolerance of rice by regulating the expression of the OsbHLH176 gene. This technology can effectively improve the growth adaptability of rice in cold environments and provide a new idea for rice breeding.

[0038] In addition, the cold-tolerant gene and its application technology provided by the present invention can not only enhance the resistance of rice to low temperature conditions, but also provide a reference for improving the cold tolerance of other crops. As global climate change leads to increasingly severe low-temperature environments, this technology has broad application prospects and can help agricultural production better cope with the challenges brought by cold weather. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 is the vector map of the pC1390U vector;

[0040] Figure 2 This is a map of the TKC vector used for CRISPR-Cas9

[0041] Figure 3 It is a map of CRISPR-Cas9 knockout targets and mutation sites;

[0042] Figure 4 The cold-tolerant phenotypes of wild-type (WT), mutant (bhlh176), and overexpression (176OE) plants treated at 4°C for 3d and 5d, and at 28°C (control group);

[0043] Figure 5 This is a quantitative data diagram of the phenotypes of various materials related to the OsbHLH176 gene under cold treatment. DETAILED DESCRIPTION

[0044] The following examples are provided for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0045] The rice variety Zhonghua 11 was preserved in the laboratory. The overexpression vector pC1390U used in the present invention is shown in the map. Figure 1 , the sequence is shown in SEQ ID NO:3.

[0046] 1 Cloning of OsbHLH176 gene

[0047] 1.1 Rice RNA extraction

[0048] 0.2 g of young rice leaves were used to extract total RNA using the Trizol method. The RNA purity was assessed by measuring the RNA concentration and A260 / A280 ratio; meanwhile, the integrity of the RNA was tested by agarose gel electrophoresis to verify its quality.

[0049] 1.2 Reverse transcription to obtain rice cDNA

[0050] The residual genomic DNA in RNA was removed and reverse transcribed to obtain cDNA. The operation was performed according to PrimeScript of TaKaRa Company. TM Follow the instructions of RT reagent Kit with gDNA eraser (Perfect Real Time).

[0051] The reaction conditions were as follows: incubation at 42°C for 30 min in a PCR instrument and heating at 85°C for 5 sec to inactivate Prime Script RT Enzyme Mix and gDNA Eraser.

[0052] 1.3 Obtaining the OsbHLH176 gene

[0053] Primers were designed using Primer3 Plus software, the GC content was controlled between 40% and 60%, and the cloning primers OsbHLH176-F and OsbHLH176-R were designed for PCR amplification to obtain the full-length coding region product of OsbHLH176. Figure 1) on the rice, designed primers OsbHLH176-KpnI-F and OsbHLH176-BamHI-R, and introduced the flanking sequence of the OsbHLH176 gene into the KpnI and BamHI restriction sites by PCR amplification. The success of the amplification product was verified by 1% agarose gel electrophoresis. Finally, the sequencing results showed that the sequence of the coding region of the OsbHLH176 gene was consistent with the OsbHLH176 coding region sequence annotated in the rice genome data.

[0054] (1) Primers were designed using Primer3 Plus software. The sequence information is:

[0055] OsbHLH176-F: 5'TGCACAGCAACCAGGTGTAT 3';

[0056] OsbHLH176-R: 5'GCGGGTTAATCACCGCAATG 3'.

[0057] 2Overexpression of OsbHLH176 gene

[0058] pC1390U (the vector map is as Figure 1 (shown in Figure 1) After KpnI and BamHI digestion, the linear fragment was recovered by gel excision; the OsbHLH176 gene coding region fragment was recovered. After connection, transformation and identification, positive clone colonies were selected for expansion and culture, and the recombinant plasmid was extracted for enzyme digestion identification.

[0059] 2.1 PCR product recovery

[0060] After the electrophoresis is completed, the amplified product is quickly cut out with a clean blade wiped with alcohol cotton under ultraviolet light to remove the gel block containing the DNA fragment, and placed in a 1.5mL sterile ep tube. The PCR product is then recovered using the TaKaRa company's kit to obtain the required target gene fragment.

[0061] 2.2 Double enzyme digestion

[0062] For the pC1390U plasmid, KpnI and BamHI were used for restriction digestion, and the reaction was carried out at 37°C for 15 min in a sterilized 0.2 mL ep tube. The obtained product was verified by electrophoresis and stored in a 4°C refrigerator for later use.

[0063] 2.3 DNA ligation

[0064] The above plasmid and the purified product of OsbHLH176 were ligated with DNA ligase in a sterilized 0.2 mL ep tube. The overexpression vector verified by sequencing was named pC1390U-OsbHLH176.

[0065] 3CRISPR-Cas9-mediated knockout of OsbHLH176 gene

[0066] The exon region sequence with high specificity for gene OsbHLH176 was screened as the target through the CRISPR website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR / CRISPR), and then the target sequence was cloned into the TKC vector (see the vector map for details). Figure 2 ), the knockout vector of OsbHLH176 was obtained by sequencing identification. The process is as follows:

[0067] (1) Primers are synthesized according to the target sequence, and the sequence information is:

[0068] Primer1: 5'CAGATGATCCGTGGCACCGAGGCGCAGCCTTCCAAGGTTTTAGAGCTA GAA 3';

[0069] Primer2: 5'TTCTAGCTCTAAAACCTTGGAAGGCTGCGCCTCGGTGCCACGGATCAT CTG 3'.

[0070] (2) Dissolve the above primer sequences in 1×TE to a 100 μM stock solution. Take 1 μL of primer 1 and primer 2 as the front and back primers, add 1 μL of each into 98 μL of 0.5×TE solution, and mix and dilute to 1 μM.

[0071] (3) Keep at 95°C for 3 min, then cool to room temperature to complete annealing.

[0072] (4) Enzyme digestion and conjugation system (Thermo scientific) is as follows:

[0073]

[0074] The reaction procedure was: 37°C for 5 min, 20°C for 5 min. The above two conditions were maintained for 10 cycles. The amplification reaction was carried out in a BIO-RAD T100 thermal cycler. The product was transformed into Escherichia coli DH5α competent cells (CB101, Beijing Tiangen Company), and the positive clones were selected and sequenced. The sequence determination results showed that the obtained fragment was an OsbHLH176 knockout vector containing the target sequence, named pTKC-OsbHLH176.

[0075] 4 Rice genetic transformation

[0076] 4.1 Transformation of Agrobacterium

[0077] Seed treatment: Select mature and full rice seeds, remove the shells, disinfect with 75% alcohol for 1-2 minutes, discard the alcohol, add 0.15% mercuric chloride (containing 0.1% Tween 20) for 10 minutes, discard the mercuric chloride, and rinse with sterile distilled water for 6 times. Inoculate the seeds with callus induction medium and culture them at 28℃ for 20 days.

[0078] Preparation of Agrobacterium: Streak the Agrobacterium EHA105 transformed with the pC1390U-OsbHLH176 vector on an LB plate containing 20 mg / L RIf and 50 mg / L Kan, and culture at 28°C for 2 days; pick a single colony in LB liquid culture medium and culture at 28°C 200 rpm for 2 days; before infection, scrape the bacterial liquid into the suspension culture medium, shake at 28°C 180 rpm for 3-3.5 hours, and adjust to OD600 = 0.1-0.15.

[0079] Callus infection: Take rice callus with a diameter of 2-4 mm and immerse it in the bacterial solution for 20 minutes. Then absorb the surface bacterial solution and cover it with sterilized filter paper. After blowing dry in a clean bench for 30 minutes, transfer it to the co-cultivation medium covered with sterilized filter paper, and culture it in the dark at 20℃ overnight, and then culture it in the dark at 25℃ for 2 days.

[0080] Washing and screening: Wash the co-cultured callus with sterile distilled water for 7-8 times, and finally soak it in sterile water containing 500 mg / L carbenicillin for 30 minutes, discard the solution and dry the surface water, and blow dry it in a clean bench for 1 hour. Place the callus tissue after bacterial removal in a screening medium containing hygromycin and culture it at 32℃ for 14 days.

[0081] 4.2 Callus differentiation and regeneration

[0082] After 14 days of screening and culture, the resistant callus was transferred to the differentiation medium and cultured at 28°C with a photoperiod of 14 hours of light / 10 hours of darkness. When the resistant callus grew into 3-4 cm tall regenerated shoots in the differentiation medium, it was transferred to the rooting medium and continued to be cultured until it developed into a complete transgenic rice plant. 5 Identification of cold tolerance of wild type, OsbHLH176 gene mutants and overexpression plants

[0083] The seeds of wild type, OsbHLH176 gene mutant and overexpression rice were placed in a 2.5% sodium hypochlorite solution for disinfection for 20 minutes (note that the time should not be too long), and then washed 5 times with sterilized deionized water. After washing, the seeds were evenly spread on filter paper, an appropriate amount of sterilized water was added, and placed in an incubator at 28°C for germination. Three days later, the germinated seeds were transferred to a 96-well hydroponic box, and 40 seeds of each variety (wild type, OsbHLH176 mutant, overexpression plant) were planted, and 3 biological replicates were set up. The growth conditions are: 13 hours of light, 11 hours of darkness, light intensity of 40,000 LUX, temperature of 28°C during light, temperature of 25°C in darkness, and relative humidity of 75% (the phenotype of the plants after treatment is as follows) Figure 4 shown).

[0084] When the seedlings grow to two weeks old, they are transferred to an artificial climate chamber for cold tolerance assessment. The cold treatment conditions are: 13 hours of light, 11 hours of darkness, light intensity of 40,000 LUX, temperature of 4°C during light, temperature of 4°C during darkness, and relative humidity of 70%. After 3-5 days of cold treatment, the seedlings are removed and restored to normal growth conditions: 13 hours of light, 11 hours of darkness, light intensity of 40,000 LUX, temperature of 28°C during light, temperature of 25°C during darkness, and relative humidity of 70%. After 7 days of resumption of growth, the survival rate was calculated by the ratio of the number of surviving seedlings to the total number of seedlings, and the ion leakage rate was determined (about 0.3 g of seedling leaves treated at 4°C were weighed and placed in a 15-ml centrifuge tube containing 5 ml of ultrapure water. Oscillate at 200 rpm for 1 hour at room temperature, and measure the solution conductivity and record it as S1. Subsequently, the centrifuge tube was placed in boiling water and heated for 20 minutes. After being taken out, it was shaken again at room temperature for 1 hour, and the total conductivity was measured and recorded as S2. The conductivity of the ultrapure water used was 0, so the relative ion leakage rate was calculated according to the formula: Ion leakage rate (%) = S1 / S2).

[0085] The results are as follows Figure 5 As shown: Figure 5 A shows that under 3 days of cold stress, the survival rates of the OsbHLH176 mutant and the wild type decreased, with the wild type being 78.5% and the OsbHLH176 mutant being 43.3%. This indicates that the survival rate of the OsbHLH176 mutant is lower than that of the wild type. Figure 5 B shows that after 5 days of cold stress, the survival rates of the OsbHLH176 mutant and the wild type were significantly decreased, with the wild type having a survival rate of 19.8% and the OsbHLH176 overexpressing rice having a survival rate of 84.5%, indicating that the survival rate of the OsbHLH176 overexpressing rice was significantly higher than that of the wild type. Figure 5C showed that after cold stress, the cell membranes of all materials were damaged to varying degrees, among which the ion leakage rate of the wild type was 46.3%, while the ion leakage rate of OsbHLH176 overexpressing rice was 22.8%. The results showed that the ion leakage rate of OsbHLH176 overexpressing rice was lower than that of the wild type. In summary, the OsbHLH176 gene plays an important role in regulating the cold tolerance of rice.

[0086] The cold-tolerant gene and its application method provided by the present invention can significantly improve the adaptability and resistance of rice in low-temperature environments, and is expected to increase the yield and stability of rice in the context of global climate change. Through gene editing technology, precise breeding can be achieved, reducing dependence on traditional breeding methods and improving the sustainability of rice production.

[0087] The present invention has been described above with general descriptions and specific embodiments, but it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

[0088] sequence:

[0089] SEQ ID NO: 1

[0090] CDS

[0091] >LOC_Os03g19780.1

[0092] ATGGCGTCCACCTCGGGCTCGGCGGCGGCGGTGGAGGAGAGGGGGAATAGTGAGCGGAAGAGGAAGCGTGGCGCGACGGGGGAGTCGGAGGGGTCCGAGGCGCAGCCTTCCAAGTGGCGGACGCGGCGGGCGCACGAGATCTACTCGTCGAAGCTCCTCGACGCCATCCGCCTCGTGCGTTCCGGGTCGCCCTCCTCCTCGGCGGCGGCCCCGCCGCGCAGCCGGGCCGTGCGCGAGGCGGCCGACCGCGCGCTCGCCGTCTCGGCGCGCGGGCGGACGCGCTGGAGCCGCGCCATCCTCGCGTCCCACCGCCGCCGCATCCAGGCCGCGCGCCGCGCGCGCCTCCGCGAGGCCATCTCCCCGCCGTCGCGCCACCCATCCTCGTCGTCCGGTAAAGGGCCGAAGGCCCCAGCTCTGGCGAGGAAGGCGAAGGTGCTCGGGCGGCTGGTGCCCGGCTGCCGCAAGCTCCCATTCCCGGCTCTCCTCGCCGAGGCCTCCGACTACATCGCCGCGCTGGAGATGCAGGTGCGCGCCATGACCGCGCTCGCCGAGGTCCTTTCCACCGTCTCCGGCTCAGGCTCAGCCTCCTCCTCCGGCGGCTCCTCTTCGCCGGCGTGA

[0093] SEQ ID NO:2

[0094] Protein

[0095] >LOC_Os03g19780.1

[0096] Met Ala Ser Thr Ser Gly Ser Ala Ala Ala Val Glu Glu Arg Gly Asn SerGlu Arg Lys Arg LysArg Gly Ala Thr Gly Glu Ser Glu Gly Ser Glu Ala Gln ProSer Lys Trp Arg Thr Arg Arg Arg Ala His GluIle Tyr Ser Ser Lys Leu Leu Asp AlaIle Arg Leu Val Arg Ser Gly Ser Pro Ser Ser Ser Ala Ala AlaPro Pro Arg SerArg Ala Val Arg Glu Ala Ala Asp Arg Ala Leu Val Ser Ala Arg Gly Arg ThrArgTrp Ser Arg Ala Ile Leu Ala Ser His Arg Arg Arg Ile Gln Ala Ala Arg ArgAla Arg Leu Arg Glu AlaIle Ser Pro Pro Ser Arg His Pro Ser Ser Ser GlyLys Gly Pro Lys Ala Pro Ala Leu Ala Arg LysAla Lys Val Leu Gly Arg Leu ValPro Gly Cys Arg Lys Leu Pro Phe Pro Ala Leu Leu Ala Glu AlaSer Asp Tyr IleAla Ala Leu Glu Met Gln Val Arg Ala Met Thr Ala Leu Ala Glu Val Leu Ser ThrValSer Gly Ser Gly Ser Ala Ser Ser Ser Gly Gly Ser Ser Ser Pro Ala*.

Claims

1. Application of protein in any of the following: (A1) Application in enhancing cold tolerance of rice; (A2) Use in the preparation of products for enhancing the cold tolerance of rice; (A3) Application in breeding cold-tolerant rice; in, The protein is any one of the following: (B1) a protein with an amino acid sequence as shown in SEQ ID NO: 2; (B2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein of (B1), which has 80% or more identity with the protein shown in A1) and has the function of regulating cold resistance of rice; (B3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of (B1) or (B2).

2. Use of the gene encoding the protein according to claim 1 in any of the following: (A1) Application in enhancing cold tolerance of rice; (A2) Use in the preparation of products for enhancing the cold tolerance of rice; (A3) Application in breeding cold-tolerant rice; The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

3. Use of the recombinant vector containing the gene according to claim 2 in any of the following: (A1) Application in enhancing cold tolerance of rice; (A2) Use in the preparation of products for enhancing the cold tolerance of rice; (A3) Application in breeding cold-tolerant rice.

4. The use according to claim 3, characterized in that: The backbone vector of the recombinant vector is pC1390U vector.

5. Use of a microorganism containing the gene according to claim 2 or the recombinant vector according to claim 3 in any of the following: (A1) enhancing the cold tolerance of rice; (A2) Use in the preparation of products for enhancing the cold tolerance of rice; (A3) Application in breeding cold-tolerant rice.

6. A method for enhancing cold tolerance of rice, characterized in that: The method comprises increasing the content and / or activity of the protein according to claim 1 in the target rice to improve the cold tolerance of the target rice.

7. The method according to claim 6, characterized in that The increasing of the content and / or activity of the protein according to claim 1 in the target rice is achieved by increasing the expression level of the gene encoding the protein in the target rice.

8. A method for cultivating cold-tolerant rice, characterized in that: The method comprises increasing the content and / or activity of the protein according to claim 1 in the target rice to improve the cold tolerance of the target rice.

9. The method according to claim 8, characterized in that The increasing of the content and / or activity of the protein according to claim 1 in the target rice is achieved by increasing the expression level of the gene encoding the protein in the target rice.

Images