Application of HaKASIII gene in increasing content of vegetable fatty acid

Abstract

The invention provides application of a HaKASIII gene in increasing the content of plant fatty acid, and belongs to the technical field of genetic engineering breeding. Through correlation analysis, it is found that the expression quantity of the HaKASIII gene is in extremely significant negative correlation with the content of oleic acid, is in extremely significant positive correlation with the content of linoleic acid, and is in significant positive correlation with the contents of palmitic acid and linolenic acid at the same time. According to the invention, an overexpression vector pCambia2301-KY-HaKASIII of the HaKASIII gene is constructed, and genetic transformation is carried out on arabidopsis thaliana by using an agrobacterium tumefaciens flower immersion method, so that the overexpression of the HaKASIII gene can significantly improve the content of C18: 2 (linoleic acid), the content of C18: 3 (linolenic acid) and the content of C16: 0 (palmitic acid) in arabidopsis thaliana seeds.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering breeding, and in particular relates to the application of a HaKASIII gene in increasing the fatty acid content of plants. Background Art

[0002] In the plant fatty acid synthesis pathway, KASIII catalyzes the initial condensation reaction of acyl ACP and malonyl ACP in fatty acid synthesis. So far, although the KASIII genes of some plants such as pea (Pisum sativum), jatropha (Jatrophacurcas) and sunflower (Helianthus annuus) have been cloned, there are not many studies on the related gene functions. In addition to using acetyl ACP as a substrate, plant KASIII can also use other acyl ACPs as substrates to synthesize fatty acid end products with different carbon chain structures. In plants, KASIII is one of the main determinants of the carbon chain structure of fatty acids.

[0003] Studies have found that the rate of fatty acid synthesis in plants is affected by KASIII activity, which indicates that KASIII may be one of the rate-limiting enzymes in the fatty acid synthesis pathway. Overexpression of KASIII genes from Spinacia oleracea and Cuphea hookeriana in tobacco (Nicotiana tabacum) and Arabidopsis thaliana (Arabidopsis thaliana), respectively, increased the content of C16:0 fatty acids. When the sunflower (Helianthus annuus) KASIII gene was overexpressed in Escherichia coli, the C16:0 fatty acid content in the overexpressed strain of Escherichia coli was reduced. The acyl ACPs available to KASIII genes from these different sources are not exactly the same, and the changes in fatty acid composition caused by changes in gene expression are not consistent. There are no reports on the effect of the HaKASIII gene on plant fatty acid synthesis. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a HaKASIII gene for use in increasing the fatty acid content of plants.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides application of HaKASIII gene in regulating the content of fatty acids in plants, and overexpression of HaKASIII gene increases the content of fatty acids in plants.

[0007] Preferably, the fatty acid comprises linoleic acid, linolenic acid or palmitic acid.

[0008] Preferably, the method for overexpressing the HaKASIII gene comprises the following steps:

[0009] An overexpression vector of the HaKASIII gene was constructed, and the plant was genetically transformed using the Agrobacterium floral dipping method to screen out the transgenic strains overexpressing the HaKASIII gene, thereby achieving overexpression of the HaKASIII gene.

[0010] Preferably, the overexpression vector of the HaKASIII gene is pCambia2301-KY-HaKASIII, wherein the pCambia2301-KY-HaKASIII uses pCambia2301-KY as the initial vector, and a HaKASIII gene fragment is cloned at the KpnI restriction site of pCambia2301-KY.

[0011] Preferably, the plant is Arabidopsis thaliana.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] The present invention performs bioinformatics analysis on the sunflower HaKASIII gene and finds that the secondary structure of the protein encoded by HaKASIII is a random curl, which is a hydrophilic protein and subcellularly localized in chloroplasts. The sunflower HaKASIII has the closest evolutionary relationship with artichoke and lettuce KASIII of the same Asteraceae family, and the sequence similarity is 93%.

[0014] The present invention found through qRT-PCR that HaKASIII is expressed in sunflower seeds, leaves, stems, tubular flowers, ligulate flowers, and roots, and the expression level of HaKASIII (3-ketoacyl-ACP synthase II I) is the highest during the entire seed development process at 7 days after flowering. Correlation analysis found that the expression level of the HaKASIII gene was extremely significantly negatively correlated with the oleic acid content, extremely significantly positively correlated with the linoleic acid content, and significantly positively correlated with the palmitic acid and linolenic acid contents.

[0015] The invention constructs an overexpression vector pCambia2301-KY-HaKASIII of the HaKASIII gene, and uses the Agrobacterium floral dipping method to genetically transform Arabidopsis thaliana. It is found that overexpression of the HaKASIII gene can significantly increase the contents of C18:2 (linoleic acid), C18:3 (linolenic acid) and C16:0 (palmitic acid) in Arabidopsis thaliana seeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the secondary structure prediction of the protein encoded by Sunflower HaKASIII;

[0017] Figure 2It is the tertiary structure prediction of the protein encoded by Sunflower HaKASIII;

[0018] Figure 3 It is the hydrophilicity / hydrophobicity analysis of the protein encoded by sunflower HaKASIII;

[0019] Figure 4 It is the phylogenetic tree analysis of the sunflower HaKASIII gene;

[0020] Figure 5 It is the expression pattern of sunflower HaKASIII gene in different developmental stages and different parts. DETAILED DESCRIPTION

[0021] The present invention provides application of HaKASIII gene in regulating the content of fatty acids in plants, and overexpression of HaKASIII gene increases the content of fatty acids in plants.

[0022]

[0023] In the present invention, the fatty acid includes linoleic acid, linolenic acid or palmitic acid; the method for overexpressing the HaKASIII gene includes the following steps: constructing an overexpression vector of the HaKASIII gene, genetically transforming the plant by using the Agrobacterium floral dipping method, screening out a transgenic strain overexpressing the HaKASIII gene, and achieving overexpression of the HaKASIII gene; the overexpression vector of the HaKASIII gene is preferably pCambia2301-KY-HaKASIII, the pCambia2301-KY-HaKASIII uses pCambia2301-KY as the initial vector, and a HaKASIII gene fragment is cloned at the KpnI restriction site of pCambia2301-KY; the Agrobacterium is preferably Agrobacterium GV3101. The plant is Arabidopsis thaliana.

[0024] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0025] Example 1

[0026] Bioinformatics of Sunflower HaKASIII Gene

[0027] 1. The sunflower HaKASIII gene contains an open reading frame of 1176 bp, encoding 391 amino acids. The nucleotide sequence of the sunflower HaKASIII gene (accession number XM_022166985.2) is shown in SEQ ID NO.1, and the protein sequence it encodes (accession number XP_022022677.1) is shown in SEQ ID NO.2. The basic physicochemical property prediction tool Protparam (https: / / web.expasy.org / protparam / ) under the ExPASy system was used to predict parameters such as amino acid composition, relative molecular weight, isoelectric point and atomic composition.

[0028] Experimental results: The prediction of basic physical and chemical properties of proteins shows that the total number of atoms in the protein encoded by the HaKASIII gene is 5779, and the molecular formula is C 1802 H 2883 N 509 O 570 S 15 The protein molecular weight is 41.28KD, the theoretical isoelectric point is 5.19, and the protein is predicted to be an acidic protein. The amino acid composition of the HaKASIII encoded protein is shown in Table 1.

[0029] Table 1 Amino acid composition of the protein encoded by Sunflower HaKASIII

[0030]

[0031] 2. Use the SOPMA online program (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.pl?page=npsa_sopma.htm

[0032] l) and SWISS-MODEL (https: / / swissmodel.expasy.org / interactive) were used to analyze and predict the secondary and tertiary structures of sunflower HaKASIII protein.

[0033] Experimental results: The secondary structure of the protein encoded by HaKASIII was predicted and analyzed. The results showed that the protein had 27.62% α helix, 40.92% random coil, 23.02% extended chain, and 8.44% β turn. The prediction results showed that the secondary structure of the protein encoded by HaKASIII was random coil ( Figure 1 ). Prediction of the tertiary structure of the HaKASIII encoded protein ( Figure 2 ), the qualitative model energy analysis (QMEAN) score was -2.90, and the global model quality evaluation (GMQE) score was 0.66.

[0034] 3. Protein hydrophilicity analysis and subcellular localization prediction

[0035] The hydrophobicity of the protein was analyzed using the online analysis software Protscale (http: / / web.expasy.org / protscale / ), and the subcellular localization was predicted using the online analysis software (Cell-PLoc 2.0, http: / / www.csbio.sjtu.edu.cn / bioinf / Cell-PLoc-2 / ).

[0036] Experimental results: The amino acid sequence of the protein encoded by HaKASIII was analyzed for hydrophilicity. More than 50% of the part greater than zero is hydrophobic protein, and more than 50% of the part less than zero is hydrophilic protein. The results show that the protein encoded by HaKASIII is a hydrophilic protein ( Figure 3 ). Cell-PLoc 2.0 software predicted that the subcellular localization of HaKASIII encoded protein was in chloroplasts.

[0037] 4. Analysis of HaKASIII gene system evolution

[0038] The phylogenetic tree was constructed using MEGA7 software. The amino acid sequences of the sunflower HaKASIII gene and KASIII from species such as Brassicanapus L., soybean (Glycine max L.), and upland cotton (Gossypium hirsutum L.) as well as the three members of the KAS family KASI, KASII, and KASIII from Arabidopsis thaliana L. were used to construct a phylogenetic tree.

[0039] Experimental results: Figure 4 It was found that the sunflower HaKASIII and the KASIII of other species were clustered in a large branch, and had the closest evolutionary relationship with the KASIII of artichoke (Cynara cardunculus var. Scolymus L.), lettuce (Lactuca sativa L.) and small grass (Erigeron canadensis L.) of the same Asteraceae family, with sequence similarities of 93%, 93%, and 91%, respectively.

[0040] Example 2

[0041] 1. HaKASIII gene expression analysis

[0042] Total RNA was extracted from sunflower seeds (high oleic sunflower maintenance line L-1-OL-1 was planted in the experimental base of the Institute of Economic Crops of Heilongjiang Academy of Agricultural Sciences in 2019) using a plant total RNA extraction kit (Tiangen), and 0.5 μg RNA was used to synthesize the first chain of cDNA using ReverTraAce qPCRRTMasterMix with gDNARemover (TOYOBO). THUNDERBIRD SYBR qPCRMix (TOYOBO) reagent, Roche LightCycler480II fluorescence quantitative PCR instrument, sunflower β-actin gene (AF282624) as the internal reference gene, and the total reaction system of Real-Time PCR was 20 μL: cDNA 1.2 μL, SYBR Green 10 μL, Primer 0.6 μL each, ddH2O 7.6 μL. The real-time PCR reaction program was as follows: 98°C for 2 min; 98°C for 10 s, 58°C for 10 s, and 68°C for 30 s, for a total of 45 cycles. After the PCR reaction was completed, a melting curve analysis was performed using 2 -ΔΔCtThe expression level of the target gene was analyzed by the method. The primers for the internal reference gene β-actin were F: GCAAAAAGCAGCTCGTCTGT (SEQ ID NO.3), R: AGCAGCTTCCATTCCAATCA (SEQ ID NO.4), and the HaKASIII fluorescence quantitative primers were F: TGTACTTGTGATTGGAGCCG (SEQ ID NO.5), R: ATAAACCGTCCTCTTCGCTG (SEQ ID NO.6).

[0043] Experimental results: Figure 5 As shown. qRT-PCR revealed that HaKASIII was expressed in sunflower seeds, leaves, stems, tubular flowers, ligulate flowers, and roots. The expression level of HaKASIII (3-ketoacyl-ACP synthase II I) was the highest during the entire seed development process at 7 days after flowering, and the expression level decreased significantly at 12 days and 17 days after flowering. It was basically not expressed in seeds at other stages, and was expressed to varying degrees in other tissues, among which the highest expression level was in leaves and ligulate flowers, close to the expression level in seeds at 7 days after flowering.

[0044] 2. Carry out correlation analysis between the expression level of HaKASIII gene detected at different stages of seed development and the seed oil content and the contents of five basic fatty acids.

[0045] Experimental results: as shown in Table 2.

[0046] Table 2 Correlation analysis between HaKASIII gene expression and oil content

[0047]

[0048] As shown in Table 2, the expression level of HaKASIII gene was extremely significantly negatively correlated with the oleic acid content, extremely significantly positively correlated with the linoleic acid content, and significantly positively correlated with the palmitic acid and linolenic acid contents, indicating that the gene may be related to the synthesis of these fatty acids.

[0049] Example 3

[0050] 1. Construction of HaKASIII gene overexpression vector

[0051] Using pCambia2301-KY (purchased from Shanghai Zeye Biotechnology Co., Ltd.) as the initial vector, the HaKASIII gene was inserted into the expression vector by homologous recombination. The vector pCambia2301-KY was cut with KpnI (Thermo) to linearize it. After recovery, it was recombined with the HaKASIII gene fragment. The recombinant product was transformed into Escherichia coli DH5α cells (Shanghai Weidi Biotechnology Co., Ltd.) as follows:

[0052] (1) Add 10 μL of the ligation product to 100 μL of E. coli competent cells and place on ice for 30 min.

[0053] (2) Heat shock at 42°C for 75 seconds and ice bath for 2 minutes.

[0054] (3) Add 800 μL of LB liquid culture medium and incubate at 37°C on a shaker for 30 min.

[0055] (4) Centrifuge at 6000 rpm for 3 min, discard the culture medium, and spread on a Kana (50 mg / L) resistance culture medium plate.

[0056] (5) Inverted culture at 37°C for 14 h, PCR detection using 1 μL bacterial solution as template, and sequencing of positive bacterial solution. Pick PCR-positive transformants, shake culture to extract plasmids, and obtain the HaKASIII gene overexpression vector pCambia2301-KY-HaKASIII (see Zhou Fei, Wang Wenjun, Ma Jun, et al. Cloning and functional analysis of sunflower FAD2-1 gene [J]. Chinese Journal of Oil Crops, 2023, 45(05): 954-964. DOI: 10.19802 / j.issn.1007-9084.2022186.).

[0057] 2. Agrobacterium transformation

[0058] (1) Take out the competent Agrobacterium GV3101 and dissolve it on ice. Gently mix 20 μL of the competent Agrobacterium GV3101 and 2 μL of the HaKASIII gene overexpression vector pCambia2301-KY-HaKASIII plasmid and place it on ice for 10 min.

[0059] (2) Quick freezing in liquid nitrogen for 5 minutes.

[0060] (3) Incubate in 37°C water bath for 5 min, then in ice bath for 5 min.

[0061] (4) Add 800 μL of antibiotic-free LB liquid culture medium and culture at 28°C with shaking for 3 h.

[0062] (5) Centrifuge at 5000 rpm / min for 5 min, take 100 μL of the supernatant and gently pipette to mix, apply it to LB plate (50 mg / L Kana, 50 mg / L Rif), and incubate it upside down at 28°C for 60 h.

[0063] (6) The correct bacterial solution for PCR testing should be stored in a -80℃ refrigerator until use.

[0064] 3. Flower Dipping Method to Infect Arabidopsis

[0065] (1) Preparation of bacterial solution: Agrobacterium containing the pCambia2301-KY-HaKASIII vector was streaked on LB medium (50 mg / L Kana, 50 mg / L R Rif), incubated at 28°C for 48 h, and then inoculated into 5 mL of medium containing antibiotics and incubated at 28°C with slow shaking; the next day, inoculated into 200 mL of medium containing antibiotics and incubated at 28°C with fast shaking; the OD 600 = 0.8, centrifuged at 4000 rpm / min for 8 min at 4°C; after removing the supernatant, the cells were resuspended in 5% sucrose, 0.02% SilwetL-77% MS solution to an OD of 600 =0.8.

[0066] (2) Infection: Cut off the white inflorescence, place it in the heavy suspension for 4 seconds, and then cover it with plastic wrap. After 24 hours of dark culture, remove the film. Repeat the above steps for the second infection after 7 days.

[0067] (3) After the siliques mature, collect the seeds.

[0068] 4. Screening and identification of transgenic plants

[0069] Arabidopsis T0 generation seeds were disinfected and cleaned, and were spread on 1 / 2MS culture plates containing kanamycin (40 mg) for germination, and resistance screening was performed. The resistant seedlings that grew true leaves and could take root were selected and transplanted to grow up. When Arabidopsis was in good growth condition, a small amount of leaves were taken to extract DNA and PCR was used to detect whether the transgenic was successful. After harvesting the seeds of a single plant, it was used as the T1 generation. The resistance screening adopted the same method as the seeds of the T0 generation, and the resistant seedlings with a separation ratio of 3:1 were transferred to the soil and then cultured. After harvesting the seeds of a single plant, it was used as the T2 generation. The resistance screening adopted the same method as the seeds of the T1 generation, and the resistant seedlings with a separation ratio of 3:1 were transferred to the soil and then cultured. After harvesting the seeds of a single plant, it was used as the T3 generation. The transgenic homozygous plants were the plants that did not undergo trait separation after the resistance screening. Fluorescence quantitative PCR (qRT-PCR) was used to detect the expression of HaKASIII gene in each strain. The primers for HaKASIII fluorescence quantitative were F: TGTACTTGTGATTGGAGCCG (SEQ ID NO.5), R: ATAAACCGTCCTCTTCGCTG (SEQ ID NO.6). The primers for the internal reference gene Arabidopsis actin were: At-actin-F: CGGCGAGTCATCGTCATCAATGT (SEQ ID NO.7); At-actin-R: GTTCGGGATTACGGTGGTGGGA (SEQ ID NO.8). HaKASIII had a high expression level in the transgenic strains HaKASIII-2, HaKASIII-5, and HaKASIII-9, which were used for the subsequent functional analysis of the HaKASIII gene.

[0070] 5. Detection of fatty acid content in transgenic plants

[0071] The detection of fatty acid content and oil content in wild-type and transgenic T3 generation Arabidopsis seeds was commissioned to Wuhan Mattwell Biotechnology Co., Ltd., and three biological replicates were taken (three plants each from HaKASIII-2, HaKASIII-5, and HaKASIII-9 lines).

[0072] Experimental results: as shown in Table 3.

[0073] Table 3 Fatty acid and oil content in seeds of Arabidopsis thaliana overexpressing HaKASIII

[0074] fatty acid wild type HaKASIII-2 HaKASIII-5 HaKASIII-9 C16:0％ 9.234±0.524 11.689±0.437** 11.964±0.847** 11.650±0.432* C18:0％ 2.436±0.254 2.428±0.268 2.456±0.264 2.407±0.260 C18:1％ 13.487±1.205 10.898±0.854** 11.165±0.796* 10.873±1.134** C18:2％ 34.013±2.379 38.879±3.638* 39.674±4.251** 39.396±2.457** C18:3％ 18.495±1.068 19.984±1.342* 19.968±1.782* 19.973±1.405* Oil content% 18.003±0.897 17.532±2.467 17.658±2.134 17.321±3.102

[0075] Note: * represents p < 0.05, the difference is significant; ** represents p < 0.01, the difference is extremely significant.

[0076] As shown in Table 3, compared with wild-type Arabidopsis, the fatty acid and oil content of Arabidopsis seeds overexpressing HaKASIII were changed. The oil content of wild-type Arabidopsis seeds was 18.003%, and the oil content of Arabidopsis seeds overexpressing HaKASIII was 17.321%-17.658%, and the oil content was slightly reduced, but the change was not significant. The C18:1 (oleic acid) content of Arabidopsis seeds overexpressing HaKASIII decreased significantly, and the contents of C18:2 (linoleic acid), C18:3 (linolenic acid) and C16:0 (palmitic acid) increased significantly, and the C18:0 (stearic acid) content did not change significantly.

[0077] It can be seen from the above examples that the overexpression of the HaKASIII gene in the present invention can significantly increase the contents of C18:2 (linoleic acid), C18:3 (linolenic acid) and C16:0 (palmitic acid) in Arabidopsis seeds.

[0078] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. The HaKASIII gene is used in regulating the fatty acid content of plants, characterized in that: Overexpression of the HaKASIII gene increases the content of plant fatty acids.

2. The use according to claim 1, characterized in that: The fatty acids include linoleic acid, linolenic acid or palmitic acid.

3. The use according to claim 1 or 2, characterized in that: The method for overexpressing the HaKASIII gene comprises the following steps: An overexpression vector of the HaKASIII gene was constructed, and the plant was genetically transformed using the Agrobacterium floral dipping method to screen out the transgenic strains overexpressing the HaKASIII gene, thereby achieving overexpression of the HaKASIII gene.

4. The use according to claim 3, characterized in that: The overexpression vector of the HaKASIII gene is pCambia2301-KY-HaKASIII. The pCambia2301-KY-HaKASIII uses pCambia2301-KY as the initial vector, and a HaKASIII gene fragment is cloned at the KpnI restriction site of pCambia2301-KY.

5. The use according to any one of claims 1 to 4, characterized in that: The plant is Arabidopsis thaliana.

Images