Application of TaJAZ7 gene knockout substance in improvement of crop gibberellic disease resistance

Abstract

The invention relates to an application of a TaJAZ7 gene knockout substance in improvement of crop gibberellic disease resistance, and belongs to the technical field of plant genetic engineering. The relevance between the TaJAZ7 gene and the gibberellic disease resistance is found for the first time, a CRISPR / Cas9 gene editing technology is adopted, the TaJAZ7 gene is specifically knocked out in a receptor material, an editing plant CR-Tajaz7 with a changed TaJAZ7 sequence is obtained, gibberellic disease resistance identification is carried out on a T2-generation homozygous plant by adopting a single-flower instillation method, and compared with a receptor parent Fielder, the gibberellic disease resistance identification result shows that the gibberellic disease resistance identification result is more obvious. The gibberellic disease resistance of the edited plant CR-Tajaz7 is obviously improved, and the edited plant CR-Tajaz7 can be used for creating new gibberellic disease resistant germplasm The gene and application provide a new way for prevention and treatment of crop gibberellic disease, and have a wide application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, in particular to the application of a material for knocking out TaJAZ7 gene in improving the resistance of crops to fusarium head blight. Background Art

[0002] Fusarium head blight (FHB) is an important fungal disease caused by Fusarium graminearum. The disease occurs widely around the world, especially in warm and humid climates. Fusarium head blight not only leads to a significant decrease in the yield of crops (such as wheat, barley, oats, corn, etc.), but also produces toxic fungal toxins (such as deoxynivalenol, DON), which contaminate food and feed, and seriously threaten the health of humans and animals. Discovering new genes for resistance to wheat fusarium head blight can provide a theoretical and practical basis for the breeding of disease-resistant varieties, promote the breeding of fusarium head blight-resistant varieties and their application in production, and help ensure national food security and food safety.

[0003] Jasmonic acid is an important plant hormone that is widely involved in plant growth and development, disease resistance and stress resistance. Activation of this pathway can enhance plant disease resistance, such as strengthening cell walls and inducing the expression of antimicrobial proteins. JAZ proteins (Jasmonate ZIM-domain proteins) are key negative regulators in the jasmonic acid (JA) signaling pathway in plants. They bind to the transcription factor MYC2 and inhibit its transcriptional activity, thereby negatively regulating the jasmonic acid signaling pathway. Damaged or mutated JAZ proteins will release the inhibition of MYC2 and activate the jasmonic acid signaling pathway. At present, the correlation between JAZ proteins and plant resistance to Fusarium head blight has not been reported. Summary of the invention

[0004] In response to the above problems, this application discovered for the first time the correlation between wheat TaJAZ7 protein and plant resistance to ergot disease, and through CRISPR / Cas9 gene editing technology, specifically knocked out the wheat TaJAZ7 protein encoding gene, activated the jasmonic acid signaling pathway, enhanced wheat resistance to ergot disease, and created new germplasm resistant to ergot disease.

[0005] Specifically, the present application is implemented through the following technical solutions:

[0006] First, the present application provides the use of a substance for knocking out the TaJAZ7 gene in improving the resistance of crops to scab. The above-mentioned crops include at least one of wheat, barley, oats and corn.

[0007] The wheat TaJAZ7 protein encoding gene (Genbank accession numbers: XM_044504103.1, XM_044515353.1 and XM_044522279.1), the present application screened and obtained its three homologous genes TaJAZ7-A, TaJAZ7-B, TaJAZ7-D, their nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and the encoded protein amino acid sequences are shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 respectively.

[0008] Further, the above application refers to introducing a vector containing TaJAZ7 knockout gene material or an Agrobacterium strain containing the vector into cells, tissues or plant individuals of a host plant to create a gene editing material resistant to Fusarium fusarium. The above TaJAZ7 knockout gene material includes a gene editing vector CR-TaJAZ7. The above host plant includes barley, wheat, oats or corn. The vectors used are conventional vectors in the art, including but not limited to the vector pBUE411 (commercially available vector), such as the vector disclosed in the document "Xing, Hui-Li, et al." ACRISPR / Cas9 toolkit for multiplex genome editing inplants." BMC plant biology 14 (2014): 1-12." In specific implementations, pYLCRISPR / Cas9Pubi-H, pYLCRISPR / Cas9pUbi-N, pYLCRISPR / Cas9P35S-B, pYLCRISPR / Cas9Pubi-B and other vectors can also be used; the Agrobacterium used is also conventional Agrobacterium, including but not limited to conventional commercially available Agrobacterium strains such as Agrobacterium EHA105.

[0009] The application steps include: using the CRISPR / Cas9 system to knock out the TaJAZ7 gene to change the structure or function of the TaJAZ7 gene; the above-mentioned CRISPR / Cas9 system contains a target sequence sgRNA (SEQ ID NO.4) that simultaneously targets the TaJAZ7-A, TaJAZ7-B, and TaJAZ7-D genes.

[0010] Furthermore, the specific steps of the above application are:

[0011] 1) Preparation of vector containing TaJAZ7 gene target sequence

[0012] Dissolve the forward primer (SEQ ID NO.8) and the reverse primer (SEQ ID NO.9) in TE to a 100 μM stock solution, add 1 μl of each forward primer and reverse primer to 98 μl of 0.5×TE and dilute to 1 μM; incubate at 90°C for 30 s, move to room temperature and cool to complete annealing to obtain a fusion product.

[0013] The fusion product was connected to the CRISPR / Cas9 system vector according to the following system: 2μl fusion product, 60-80ng pBUE411 plasmid, 1.5μl 10×CutSmart Buffer, 1.5μl 10mM ATP, 10U Bsa I-HF endonuclease, 35U T4 ligase, and ddH2O was added to a total volume of 15μl. The enzyme digestion and ligation were performed for about 10-15 cycles using a variable temperature cycle: 37℃5min; 10℃5min, 20℃5min; and finally 37℃5min to obtain the gene editing vector CR-TaJAZ7, which contains the TaJAZ7 gene target sequence sgRNA (SEQ ID NO.4);

[0014] The CRISPR / Cas9 system vectors used in the present application include but are not limited to the vector pBUE411, which is a conventional commercially available vector, as disclosed in the document “Xing, Hui-Li, et al.” A CRISPR / Cas9 toolkit for multiplex genome editing in plants.” BMC plant biology 14(2014): 1-12.”

[0015] 2) Transform the editing vector CR-TaJAZ7 obtained in step 1) into Escherichia coli, select positive clones and extract plasmids;

[0016] 3) The plasmid obtained in step 2) is transferred into Agrobacterium to obtain transformed bacteria; the Agrobacterium used includes but is not limited to conventional commercially available Agrobacterium strains such as Agrobacterium EHA105.

[0017] 4) Introducing the transformed bacteria obtained in step 3) into young embryos of the host plant through genetic transformation to obtain gene-edited plants T0, and continuously self-pollinating the T0 generation to obtain T2 generation edited plants; performing genetic testing on the T2 generation edited plants, and selecting homozygous edited plants therefrom, that is, obtaining gene-edited plants with improved resistance to ergot.

[0018] The above-mentioned "genetic transformation" refers to the use of conventional plant transgenic technology in the field, such as the genetic transformation method disclosed in the document "Hayta S, Smedley MA, Clarke M, et al. An Efficient Agrobacterium-Mediated Transformation Protocol for Hexaploid and Tetraploid Wheat [J]. Current Protocols, 2021, 1 (3)." to introduce a vector containing the TaJAZ7 gene target sequence or an Agrobacterium strain containing the vector into the plant to create a gene-edited plant resistant to ergot disease.

[0019] Preferably, the above-mentioned host plants include but are not limited to wheat, barley, and corn, so as to obtain gene-edited materials containing the gene for production.

[0020] The present invention uses CRISPR / Cas9 gene editing technology to edit TaJAZ7 in the receptor material to obtain the TaJAZ7 gene-edited plant CR-Tajaz7. The single flower drip method was used to identify the resistance of T2 generation homozygous plants to fusarium wilt. Compared with the receptor parent Fielder, the edited plant CR-Tajaz7 has significantly improved resistance to fusarium wilt, and can be used to create new germplasm resistant to fusarium wilt in wheat. This method provides a new way to prevent and control wheat fusarium wilt and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a diagram of the TaJAZ7 gene structure.

[0022] Figure 2 Schematic diagram of the target segment DNA sequence of TaJAZ7 gene-edited plants.

[0023] Figure 3 The ergot resistance phenotype of the T2 generation homozygous edited plants of the TaJAZ7 gene.

[0024] Figure 4 These are the statistical results of the number of diseased spikelets of T2 generation homozygous edited plants with TaJAZ7 gene. DETAILED DESCRIPTION

[0025] Unless otherwise specified in the examples, conventional methods and experimental reagents are used in the art. The wheat variety Fielder involved is a common variety, as disclosed in the document "He Y, Wu L, Liu X, et al. TaUGT6, a novel UDP-glycosyltransferase gene enhances the resistance to FHB and DON accumulation in wheat [J]. Frontiers in Plant Science, 2020: 1549." The Fielder wheat in this example is preserved by the wheat genetics and breeding team of the Institute of Food Crops, Jiangsu Academy of Agricultural Sciences.

[0026] The reagents and carriers involved in the examples are all commercially available.

[0027] The pBUE411 vector (plasmid) was purchased from Addgene (Plasmid #62200).

[0028] BsaⅠ restriction endonuclease and T4 DNA ligase were purchased from BioLabs;

[0029] Escherichia coli DH5α and Agrobacterium tumefaciens EHA105 (Cat. No. AC1012) were purchased from Shanghai Weidi Biological Company;

[0030] The plasmid extraction kit was purchased from Nanjing Novozyme Biotechnology Co., Ltd.;

[0031] Other chemical reagents such as tryptone, agar powder, sodium chloride, and kanamycin (Kan, 50 μg / mL) were all domestic analytical grade reagents.

[0032] LB+Kan solid medium: 10 g Tryptone, 5 g Yeast Extract, 10 g NaCl, add water to 1000 mL, adjust pH to 7.2; then add agar powder with a final concentration of 1.8% and Kan with a final concentration of 50 μg / ml.

[0033] Example 1 Creation of CRISPR / Cas9 gene-edited wheat plant CR-Tajaz7

[0034] Based on the previous scientific research, this example screened and obtained three homologous genes of TaJAZ7 gene, TaJAZ7-A, TaJAZ7-B, and TaJAZ7-D, whose nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively, and the edited amino acid sequences are shown in SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7, respectively. The structure of TaJAZ7 gene is shown in Figure 1 As shown, Figure 1 In the figure, the white boxes represent 5'-UTR and 3'-UTR, the blue boxes represent the exon region, the orange boxes represent the two conserved functional domains of TaJAZ7, TIFY and Jas, and the black lines represent the gene editing target site sgRNA (SEQ ID NO.4).

[0035] The steps for creating the CRISPR / Cas9 gene-edited plant CR-Tajaz7 are as follows:

[0036] 1) The target site sequences that simultaneously target the three homologous genes of TaJAZ7 were designed through the public website http: / / crispr.hzau.edu.cn / CRISPR-Cereal / , and the forward primer SEQ ID NO.8: CTTGGAGAAGCGCAAGGACCGCCTCGG and the reverse primer SEQ ID NO.9: AAACCCGAGGCGGTCCTTGCGCTTCTC containing the target site sgRNA were designed.

[0037] The above primers were synthesized at Sangon Biotech (Shanghai) Co., Ltd. and dissolved in TE to form a 100 μM stock solution. 1 μl of each was added to 98 μl of 0.5×TE and mixed and diluted to 1 μM. The mixed primers were heated at about 90°C for 30 s, moved to room temperature (25°C) and cooled to complete annealing to obtain a fusion product.

[0038] 1) The fusion product was connected to the pBUE411 vector according to the following system: 2 μl of fusion product, 60 ng of pBUE411 plasmid, 1.5 μl of 10×CutSmart Buffer, 1.5 μl of 10 mM ATP, 10 U of Bsa I-HF endonuclease, 35 U T4 ligase, and ddH2O was added to a total volume of 15 μl.

[0039] The enzyme digestion and ligation were performed for 15 cycles using variable temperature cycling: 37°C for 5 min; 10°C for 5 min, 20°C for 5 min; and finally 37°C for 5 min to obtain the ligation product.

[0040] 3) The above ligation product was transformed into E. coli DH5α strain by heat shock method, and then positive clones were screened on LB+Kan solid medium, plasmids were extracted, positive clones were identified by PCR and sent for sequencing to select clones for sequencing verification, and the sequencing primers were SEQ ID NO.10: TTGACTAGCGTGCTGATAATTTGTG and SEQ ID NO.11: GACAGGCGTCTTCTACTGGTGCTAC. The plasmid that was correctly aligned (i.e., the target site sequence in the plasmid was consistent with SEQ ID NO.4) was named gene editing vector CR-TaJAZ7.

[0041] 4) The gene editing vector CR-TaJAZ7 was transferred into Agrobacterium EHA105, and a general genetic transformation method based on immature embryos was used: immature embryos of the wheat variety Fielder that had been fertilized for 14 days were peeled off in a sterile environment, placed in WLS-liq medium, centrifuged for 10 minutes, and Agrobacterium containing the target gene was added for 5 minutes. The immature embryos were placed in WLS-AS medium with the scutellum facing up and cultured in the dark. After 3 days, the embryo axes were removed and transferred to WLS-Res medium and cultured in the dark for 5 days. Subsequently, they were transferred to WLS-P5 medium and cultured for 2 weeks, and then transferred to WLS-P10 medium and cultured in the dark for 3 weeks. After that, they were transferred to LSZ-P5 medium and cultured under continuous light to differentiate into seedlings to obtain transgenic T0 generation wheat plants.

[0042] The above transformation method is a conventional method in the art. This example adopts the method disclosed in the document "Ishida Y, Tsunashima M, Hiei Y, et al. Wheat (Triticum aestivum L.) transformation using immature embryos [M]. Agrobacterium protocols. Springer, New York, NY, 2015: 189-198." The culture medium involved is configured according to the method disclosed in the document. 5) The T0 generation is self-pollinated to obtain the T1 generation, and the T1 generation is self-pollinated to obtain the T2 generation. For T2 generation wheat plants, the forward primer SEQ ID NO.12: CGAGACGAGACGAGAGAACA and the reverse primer SEQ ID NO.13: CAGACATGGAGGAAGCGTTG were used to perform sequence detection on the TaJAZ7-4A gene, the forward primer SEQ ID NO.14: GAGACGAGACAACAAGTGTT and the reverse primer SEQ ID NO.15: TGAACTCAATCTCTGGGCGA were used to perform sequence detection on the TaJAZ7-4B gene, and the forward primer SEQ ID NO.16: CGTCTCCTTCACTCGCCTAA and the reverse primer SEQ ID NO.17: TCCTTCTGAGCGAACCATGA were used to perform sequence detection on the TaJAZ7-4D gene. Homozygous edited plants with TaJAZ7 knockout on chromosomes A, B, and D were screened and named CR-TaJAZ7-11 (hereinafter referred to as 11) and CR-TaJAZ7-15 (hereinafter referred to as 15), respectively. The corresponding gene knockout sequences are shown in Figure 2 As shown in the figure, black letters are targeting sequences, green letters are PAM sequences, and horizontal lines "-" represent base deletions. It can be seen that compared with the recipient material Fielder, the CR-Tajaz7-11 edited plant has a base deletion on chromosomes 4A, 4B, and 4D, and the CR-Tajaz7-15 edited plant has a base deletion on chromosomes 4A and 4D, and 2 base deletions on chromosome 4B.

[0043] Example 2 Application of TaJAZ7 knockout in improving resistance to fusarium head blight in wheat

[0044] The gene-edited wheat plants (11 and 15) obtained in Example 1 were subjected to Fusarium fusarium resistance identification. The pathogen inoculation method was referred to the method disclosed in NY / T2954-2016. The identification method was as follows: a spikelet in the middle and upper part of the ear at the beginning of flowering was selected and inoculated with 10 μl of 1×10 5The spore liquid of Fusarium graminearum (Fg1312, preserved in the applicant's laboratory) was bagged and kept moist for 3 days. The phenotype of the gene-edited strain 15 days after infection with Gibberella is shown in the figure. Figure 3 As shown, Figure 4 The middle shows the statistical results of the number of diseased spikelets, which shows that the resistance level of wheat plants with TaJAZ7 knocked out to Fusarium fusarium has been significantly improved.

[0045] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An application of a substance for knocking out the TaJAZ7 gene in improving the resistance of crops to ergot disease; the TaJAZ7 gene has three homologous genes TaJAZ7-A, TaJAZ7-B, and TaJAZ7-D, and their nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

2. The use according to claim 1, characterized in that: The crops include wheat, barley, oats or corn.

3. The use according to claim 1, characterized in that: The application refers to introducing a vector containing TaJAZ7 knockout gene material or an Agrobacterium strain containing the vector into a host plant cell, tissue or individual to improve the resistance of crops to Fusarium fusarium.

4. The use according to claim 3, characterized in that: The vector containing the TaJAZ7 knockout gene material refers to a gene editing vector containing the TaJAZ7 gene target sequence, and the nucleotide sequence of the target is shown in SEQ ID NO.

4.

5. The use according to claim 4, characterized in that: The specific steps are as follows: 1) Preparation of gene editing vector containing TaJAZ7 gene target sequence The forward primer and the reverse primer are connected to obtain a fusion product, and then the fusion product is connected to the CRISPR / Cas9 system vector to obtain a gene editing vector; The nucleotide sequences of the forward primer and the reverse primer are shown in SEQ ID NO.8 and SEQ ID NO.9 respectively; 2) Transform the gene editing vector obtained in step 1) into Escherichia coli and extract the plasmid; 3) The plasmid obtained in step 2) is transferred into Agrobacterium to obtain transformed bacteria; 4) The transformed bacteria obtained in step 3) are introduced into young embryos of the host plant through genetic transformation to obtain gene-edited plants T0, and the T0 generation is continuously self-pollinated to obtain T2 generation edited plants; genetic testing is performed on the T2 generation edited plants, and homozygous edited plants are selected, and their resistance to ergot disease is improved.

6. The use according to claim 5, characterized in that: Step 1) The CRISPR / Cas9 system vector is the vector pBUE411.

7. The use according to claim 5, characterized in that: The Agrobacterium used in step 3) is Agrobacterium EHA105.

Images