Application of cotton gene GhSWEET14 in prevention and treatment of cotton angular leaf spot

Abstract

The invention relates to application of a cotton gene GhSWEET14 in prevention and treatment of angular leaf spot of cotton, and relates to the technical field of biology. The EBE sequence in the promoter region of the cotton gene GhSWEET14 can be recognized and activated by the cotton angular leaf spot bacteria to cause the occurrence of the cotton angular leaf spot, and the EBE sequence can be used for breeding the cotton capable of resisting the cotton angular leaf spot through site-specific mutagenesis. The GhSWEET14 gene line in cotton involved in the invention is reported as a susceptible gene for the first time, and binding sites of cotton angular leaf spot pathogen effect proteins Tal1 and Tal1b contained in a promoter region of the GhSWEET14 gene line are also reported for the first time. According to the invention, a novel susceptible gene for interaction of cotton and cotton angular leaf spot bacteria is obtained, the acquisition of the gene provides resources for creating cotton disease-resistant varieties by means of molecular biology and genetics, and the gene has great application value.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of cotton gene GhSWEET14 in preventing and controlling cotton angular spot disease. Background Art

[0002] Cotton is one of the most important economic crops in the world, but it is threatened by cotton angular blight. Bacterial Blight of Cotton (BBC) is caused by Xanthomonas citripv.malvacearum (Xcm). Xcm enters host plant cells by secreting transcription activator-like factors (TALE effector proteins), regulates the expression of disease-susceptible genes, and promotes the growth and spread of pathogens. The TALE effector proteins Tal1 and Tal1b of Xcm are typical TALE proteins with conserved nitrogen and carbon ends. The nitrogen end contains a type III secretion system transport signal, and the carbon end contains a nuclear localization signal and an acidic transcription activation domain. In the middle is a 27.5 repeat region (Central Repeat Region, CRR), each repeat consists of 34 amino acids, and the twelfth and thirteenth amino acids of each repeat determine the binding specificity with the host plant DNA. The Xcm effector proteins Tal1 and Tal1b are secreted into cotton cells through the type III secretion system and then localized in the cell nucleus. They specifically bind to the promoter region EBE (effector binding element) of cotton susceptibility genes through the recognition code in the repeat region, thereby activating the expression of susceptibility genes, leading to the formation of water-soaked lesions and the development of angular leaf spot disease in cotton.

[0003] The present invention aims to disclose a new disease-susceptibility gene and target site that affect the development of angular leaf spot disease, thereby cultivating new cotton germplasm with broad-spectrum disease resistance. Summary of the invention

[0004] The purpose of the present invention is to provide the application of cotton gene GhSWEET14 in the prevention and treatment of cotton angular leaf spot. GhSWEET14 gene encodes a type of sugar transport protein, which is involved in the transport of cellular sugar substances. It is identified as an important disease-susceptible gene in cotton by the present invention. Identifying the disease-susceptible gene of cotton, on the one hand, helps to reveal the mechanism of cotton angular leaf spot; on the other hand, the obtained disease-susceptible gene is subjected to site-directed EBE mutation using gene editing technology to block the recognition and binding of TALE protein to the target gene, thereby cultivating new cotton germplasm with broad-spectrum disease resistance.

[0005] The purpose of the present invention can be achieved by the following technical solutions:

[0006] One of the technical solutions of the present invention is to provide an application of cotton gene GhSWEET14 in preventing and controlling cotton angular spot disease.

[0007] The pathogen of angular spot disease is Xanthomonas citri pv.malvacearum, the cotton gene GhSWEET14 includes loci GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02, and the coding nucleotide sequences of the loci GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02 are shown in SEQ ID NOs. 1 to 3,

[0008] Methods for preventing and controlling cotton angular leaf spot include:

[0009] Silencing or knocking out the promoter region bases of any one or more loci GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02 improves cotton resistance to angular leaf spot disease.

[0010] The promoter sequence of the gene locus GhSWEET14A04 is shown as SEQ ID NO.7 or SEQ ID NO.21, the promoter sequence of the gene locus GhSWEET14D04 is shown as SEQ ID NO.11 or SEQ ID NO.22, and the promoter sequence of the gene locus GhSWEET14D02 is shown as SEQ ID NO.14 or SEQ ID NO.25.

[0011] In some specific embodiments, the method for preventing and controlling cotton angular leaf spot disease comprises:

[0012] Silencing or knocking out the TALE protein targeting sequence in the promoter region of the gene locus GhSWEET14A04 improves the resistance of cotton to angular spot disease. The TALE protein targeting sequence is an EBE (effector-binding element) sequence bound by the Tal1b protein and / or an EBE sequence bound by the Tal1 protein. The EBE sequence bound by the Tal1b protein of the gene locus GhSWEET14A04 is shown in SEQ ID NO.8, and the EBE sequence bound by the Tal1 protein is shown in SEQ ID NO.9.

[0013] In some specific embodiments, gene editing methods are used to mutate one or more bases in any sequence shown in SEQ ID NO. 8 or 9 to silence or knock out the bases.

[0014] In some specific embodiments, the sequences shown in SEQ ID NO. 8 and 9 are mutated into the sequence shown in SEQ ID NO. 10.

[0015] In some specific embodiments, the method for preventing and controlling cotton angular leaf spot disease comprises:

[0016] Silencing or knocking out the TALE protein targeting sequence in the promoter region of the gene locus GhSWEET14D04 improves the resistance of cotton to angular spot disease. The TALE protein targeting sequence is an EBE (effector-binding element) sequence bound by the Tal1b protein and / or an EBE sequence bound by the Tal1 protein. The EBE sequence bound by the Tal1b protein of the gene locus GhSWEET14D04 is shown in SEQ ID.NO.12, and the EBE sequence bound by the Tal1 protein is shown in SEQ ID.NO.13.

[0017] In some specific embodiments, gene editing methods are used to mutate one or more bases in any sequence shown in SEQ ID NO. 12 or 13 to silence or knock out the bases.

[0018] In some specific embodiments, the sequences shown in SEQ ID NO. 12 and 13 are mutated into the sequence shown in SEQ ID NO. 10.

[0019] In some specific embodiments, the method for preventing and controlling cotton angular leaf spot disease comprises:

[0020] Silencing or knocking out the TALE protein targeting sequence in the promoter region of the gene locus GhSWEET14D02 improves the resistance of cotton to angular spot disease. The TALE protein targeting sequence is an EBE (effector-binding element) sequence bound by the Tal1b protein. The Tal1b protein binding EBE sequence of the gene locus GhSWEET14D02 is shown in SEQ ID NO.15.

[0021] In some specific embodiments, gene editing methods are used to mutate one or more bases in the sequence shown in SEQ ID NO.15 to silence or knock out the bases.

[0022] In some specific embodiments, the sequence shown in SEQ ID NO.15 is mutated into the sequence shown in SEQ ID NO.16.

[0023] The second technical solution of the present invention is to provide a method for breeding angular spot disease-resistant cotton varieties, comprising: preparing a cotton variety containing a promoter region of any one or more of the loci GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02 on the gene GhSWEET14 that is silenced or knocked out, so that the TALE protein targeting sequence in the promoter region of the locus GhSWEET14A04 is as shown in SEQ ID NO.10, the TALE protein targeting sequence in the promoter region of the locus GhSWEET14D04 is as shown in SEQ ID NO.10, and the TALE protein targeting sequence in the promoter region of the locus GhSWEET14D02 is as shown in SEQ ID NO.16.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The gene GhSWEET14 involved in the present invention is disclosed for the first time as a cotton disease susceptibility gene and its promoter region contains the binding sites of cotton angular leaf spot effector proteins Tal1 and Tal1b.

[0026] The present invention creatively discovered that there is an EBE (effector-binding element) sequence in the promoter of the cotton susceptibility gene GhSWEET14 that can be bound by the effector proteins Tal1 and Tal1b of cotton angular leaf spot pathogen. After the binding, the cotton susceptibility gene GhSWEET14 is activated and expressed, resulting in the occurrence of cotton angular leaf spot disease. Gene editing methods can be used to mutate the promoter region of the cotton susceptibility gene GhSWEET14, so that the EBE sequence that binds to the effector proteins Tal1 and Tal1b of cotton angular leaf spot pathogen is silenced or knocked out, thereby obtaining new materials resistant to cotton angular leaf spot pathogen, providing a new technical idea for improving cotton disease resistance.

[0027] The invention obtains a new disease-susceptibility gene for the interaction between cotton and cotton angular leaf spot pathogen. The acquisition of the gene provides resources for creating disease-resistant cotton varieties by using molecular biology and genetics methods, and has great application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 , EBE sequences bound by Tal1 and Tal1b proteins at cotton loci GhSWEET14A04, GhSWEET14D04, and GhSWEET14D02. Figure 2 , pHB-Tal1 vector map. Figure 3 , pHB-Tal1b vector map. Figure 4, Tal1 and Tal1b proteins of cotton angular leaf spot pathogen can interact with specific sequences of the GhSWEET14 gene promoter and activate the expression of the GhSWEET14 gene. Figure 5 , overexpression of GhSWEET14 gene causes angular leaf spot disease in cotton. Figure 6 , pB-Tal1 vector map. Figure 7 , pB-Tal1b vector map. Figure 8 , pZY-Tal1 vector map. Fig. 9 , pZY-Tal1b vector map. DETAILED DESCRIPTION

[0029] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments. This embodiment is implemented based on the technical solution of the present invention, and provides a detailed implementation method and specific operation process, but the protection scope of the present invention is not limited to the following embodiments.

[0030] In the following embodiments, some of the experiments involved can be referenced to the following sources:

[0031] (1) Using the GUS reporter gene to verify the binding and activation function of TALE protein to the promoter region is a conventional experimental technique. This method has been disclosed in (Antony, G., et al., Rice xa13 Recessive Resistance to Bacterial Blight Is Defeated by Induction of the Disease Susceptibility Gene Os-11N3. Plant Cell, 2010. 22 (11): p. 3864-3876).

[0032] (2) Methods for verifying the interaction between proteins and plant gene promoters by transient expression in Agrobacterium: Antony, G., et al., Rice xa13 Recessive Resistance to Bacterial Blight Is Defeated by Induction of the Disease Susceptibility Gene Os-11N3. Plant Cell, 2010. 22(11): p. 3864-3876.

[0033] (3) Regarding molecular manipulation of gene recombination: Sambrook J, Russell DW, Molelcular cloning, A Laboratory Manual (3 rded), 2001, Spring Harbor Laboratory Press.

[0034] Other raw materials or processing techniques without special description are indicated to be conventional commercially available raw materials or conventional processing techniques in the art.

[0035] Embodiment 1:

[0036] Using transcriptome analysis technology, cotton leaves were inoculated with the cotton angular leaf spot strain XcmXss-V2-18 containing Tal1 and Tal1b proteins. After 24 hours, an appropriate amount of cotton leaves were taken and total RNA was extracted to analyze and screen for upregulated genes. It was found that the expression of the GhSWEET14 gene was significantly upregulated after infection with Xcm Xss-V2-18 (abbreviated as Xcm). In particular, the expression levels of GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02 genes were significantly increased in cotton leaves infected with Xcm.

[0037] The gene GhSWEET14 includes gene loci GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02, the encoding nucleotide sequences of the gene loci GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02 are shown in SEQ ID NOs.1-3, and the amino acid sequences are shown in SEQ ID NOs.4-6.

[0038] The loci GhSWEET14A04, GhSWEET14D04, and GhSWEET14D02 can be found on Phytozome (https: / / phytozome-next.jgi.doe.gov / info / Ghirsutum_v3_1) with the accession numbers Gohir.A04G100600, Gohir.D04G139700, and Gohir.D02G173400, respectively.

[0039] The target genes of Tal1b protein and Tal1 protein in cotton were predicted by using the TALE-NT tool (https: / / tale-nt.cac.cornell.edu / ), and the EBE sequences binding to the target genes were obtained, such as Figure 1As shown. The colored boxes indicate the RVD of each repeat motif of the transcription activator-like effector (TALE), the numbers above each box indicate the position of the RVD within the central repeat region (CRR), each row indicates the EBE sequence corresponding to the GhSWEET14 gene, and the gray highlighted rows indicate the mutated EBE sequence. It was found that Tal1b protein targets the promoter region of the gene loci GhSWEET14A04, GhSWEET14D04, and GhSWEET14D02, while Tal1 protein targets the promoter region of the gene loci GhSWEET14A04 and GhSWEET14D04. The GhSWEET14A04 EBE sequence bound to Tal1b protein is shown in SEQ ID NO.8, the GhSWEET14A04 EBE sequence bound to Tal1 protein is shown in SEQ ID NO.9, the GhSWEET14D04 EBE sequence bound to Tal1b protein is shown in SEQ ID NO.12, the GhSWEET14D04 EBE sequence bound to Tal1 protein is shown in SEQ ID NO.13, and the GhSWEET14D02 EBE sequence bound to Tal1b protein is shown in SEQ ID NO.15.

[0040] SEQ ID NO.8 (GhSWEET14A04 EBE sequence binding to Tal1b protein, length 29 bp):

[0041] TATATAAATCCCCCCCTCTCACCCCTTC

[0042] SEQ ID NO.9 (GhSWEET14A04 EBE sequence binding to Tal1 protein, length 29 bp):

[0043] TATAAATCCCCCCCTCTCACCCCTTCTT

[0044] SEQ ID NO.12 (GhSWEET14D04 EBE sequence binding to Tal1b protein, length 29 bp):

[0045] TATATAAATCCCCCCTCTCTCACCCCTTC

[0046] SEQ ID NO.13 (GhSWEET14D04 EBE sequence binding to Tal1 protein, length 29 bp):

[0047] TATAAATCCCCCCTCTCACCCCTTCCT

[0048] SEQ ID NO.15 (GhSWEET14D02 EBE sequence binding to Tal1b protein, length 29 bp):

[0049] TATATAAACCCCCCCCTCCCTTTCCCTTC

[0050] Gene Tal1 (nucleotide sequence as shown in SEQ ID NO.17) and gene Tal1b (nucleotide sequence as shown in SEQ ID NO.18) were constructed into pHB vector to obtain pHB-Tal1 xcm and pHB-Tal1b xcm Carrier (such as Figure 2 and 3 ), and introduced into Nicotiana benthamiana to verify its expression, as shown in Figure 4 As shown in AB. Among them, Figure 4 A shows the construction of the recombinant vector: pHB vector is used as the vector, and different gene fragments are added to the CaMV35S promoter, Flag tag, and rbsSPolyA tail. The different gene fragments are: Tal1 xcm , Tal1b xcm , pHB-Tal1 xcm , pHB-Tal1b xcm Recombinant vector. Figure 4 B is the corresponding recombinant vector expression situation.

[0051] Using cotton genomic DNA as a template, primers AD04sp-BamHI-F (SEQ ID NO.19) and AD04sp-PstI-R (SEQ ID NO.20) were used to amplify truncated fragments (SEQ ID NO.21, 22) from the promoter fragments of GhSWEET14A04 and GhSWEET14D04 genes (SEQ ID NO.7, 11), respectively. Primers SW15D02-Oligos-F (SEQ ID NO.23) and SW15D02-Oligos-R (SEQ ID NO.24) were used to amplify a truncated fragment (SEQ ID NO.25) from the promoter fragment of GhSWEET14D02 gene (SEQ ID NO.14).

[0052] The PCR amplification conditions were: 95°C / 5 min, (95°C / 30s+60°C / 30s+72°C / 30s)×30 cycles, 72°C / 10 min.

[0053] After the PCR products were recovered and purified, they were connected to the pCAMBIA1381 vector containing the GUS reporter gene gusA to obtain the pGhSWEET14A04, pGhSWEET14D04, and pGhSWEET14D02 recombinant vectors, respectively. Figure 4 C, and construct a positive control vector: pHB-PthXo1 PX099A ( Figure 4 A, Figure 4 B is the expression of the verified recombinant vector) and the pCAMBIA1381-pOs8N3 recombinant vector containing the Os8N3 gene promoter region (pOs8N3, whose nucleotide sequence is shown in SEQ ID NO.28) Figure 4 C), PthXo1 can recognize pOs8N3 and activate the expression of GUS reporter gene, and NOS is a eukaryotic cell terminator.

[0054] Using the GUS reporter gene to verify the binding and activation function of TALE proteins to the promoter region is a conventional experimental technique. This method has been disclosed in (Antony, G., et al., Rice xa13 Recessive Resistance to Bacterial Blight Is Defeated by Induction of the Disease Susceptibility Gene Os-11N3. Plant Cell, 2010. 22 (11): p. 3864-3876).

[0055] The above recombinant vector was expressed by Agrobacterium transient expression method with pHB-Tal1 xcm , pHB-Tal1b xcm The recombinant vectors were co-expressed and the results showed that when pHB-Tal1 xcm Co-expression with pGhSWEET14A04 and pGhSWEET14D04 and pHB-Tal1b xcm When co-expressed with pGhSWEET14A04, pGhSWEET14D04, and pGhSWEET14D02, significant GUS reporter gene expression was observed. Figure 4 As shown in D. This indicates that the promoters of GhSWEET14A04 and GhSWEET14D04 genes can be activated for transcription by Tal1, while the transcription of GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02 genes can be activated for transcription by Tal1b.

[0056] Embodiment 2:

[0057] The EBE sequences of GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02 were mutated, such as Figure 1 The mutant EBE sequences of GhSWEET14A04 and GhSWEET14D04 are shown in SEQ ID NO.10, and the mutant EBE sequence of GhSWEET14D02 is shown in SEQ ID NO.16.

[0058] SEQ ID NO.10 (mutated EBE sequence of GhSWEET14A04 and GhSWEET14D04)

[0059] TATTTAGCTTCTCTCCCTCTCACCCCTTCCTC

[0060] SEQ ID NO.16 (mutated EBE sequence of GhSWEET14D02)

[0061] TTTAGCATCTCTCCCCTCCCTTTCCCTTC

[0062] Based on Example 1, the mutant EBE sequences of GhSWEET14A04 and GhSWEET14D04 and the mutant EBE sequence of GhSWEET14D02 were constructed into the pCAMBIA1381 vector containing the GUS reporter gene gusA, respectively, using the same method. Figure 4 C, and then tobacco was injected with pHB-Tal1 by Agrobacterium xcm , pHB-Tal1b xcm The recombinant vectors were co-expressed and the GUS activity was observed. Figure 4 As shown in D and 4E, the results showed that when the EBE sequences of GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02 were mutated, Tal1 and Tal1b could not bind to GhSWEET14, and thus could not activate gusA gene expression to produce GUS activity.

[0063] Embodiment 3:

[0064] A novel reporter gene system was used to replace the GUS reporter gene gusA in the pCAMBIA1381 vector in Example 1 with the rice resistance gene Xa10 (eg Figure 4 F), and construct the HR positive control vector: pHB-AvrXa10 recombinant vector (such as Figure 4 A, Figure 4B is the expression of the verified recombinant vector) and the pCAMBIA1381-pOsXa10 recombinant vector containing the Xa10 gene promoter region (pOsXa10, whose nucleotide sequence is shown in SEQ ID NO.29) Figure 4 F), pOsXa10 can be activated by AvrXa10 to produce a hypersensitive response and cause cell death, which was used to explore the hypersensitive response (HR) triggered by TALE-EBE binding.

[0065] like Figure 4 The results of G showed that when Tal1b was co-expressed with pGhSWEET14A04::Xa10, pGhSWEET14D04::Xa10, and pGhSWEET14D02::Xa10, and Tal1 was co-expressed with pGhSWEET14A04::Xa10 and pGhSWEET14D04::Xa10, HR-like cell death occurred at the beginning of 36 hours. However, when Tal1 was co-expressed with pGhSWEET14D02::Xa10, HR could not be activated.

[0066] These results further demonstrated that Tal1b and Tal1 could bind to predicted EBEs in the promoter region of three sites of GhSWEET14, GhSWEET14A04, GhSWEET14D04, and GhSWEET14D02, and induce HR.

[0067] Embodiment 4:

[0068] Based on Example 3, in order to further confirm that Tal1b and Tal1 mediate HR in tobacco by activating Xa10, the GUS reporter gene gusA in the pCAMBIA1381 vector in Example 2 was replaced with the rice resistance gene Xa10, that is, the EBE sequences of GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02 were mutated, the mutant sequences of GhSWEET14A04 and GhSWEET14D04 are shown in SEQ ID NO.10, and the mutant sequence of GhSWEET14D02 is shown in SEQ ID NO.16.

[0069] like Figure 4The experimental results of G showed that at 2 dpi, compared with leaves co-inoculated with Tal1 and pGhSWEET14A04::Xa10 and pGhSWEET14D04::Xa10, and Tal1b and pGhSWEET14A04::Xa10, pGhSWEET14D04::Xa10, and pGhSWEET14D02::Xa10, respectively, Tal1 and ΔpGhSWEET14::Xa10, respectively, were significantly inhibited by Tal1. There was no obvious HR in the leaves co-inoculated with ΔpGhSWEET14::Xa10 and ΔpGhSWEET14D02::Xa10 and Tal1b, respectively, which indicated that after the EBE sequences of GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02 were mutated, they could not be bound by Tal1 and Tal1b, and thus could not induce HR.

[0070] Embodiment 5:

[0071] By using the suicide vector pKMS1 for cumulative deletion mutation based on the principle of homologous recombination, the tal gene deletion mutants M4 (missing at least 5 TALE genes and retaining Tal1 or Tal1b gene), M5 (missing at least 6 TALE genes and retaining Tal1 or Tal1b gene) and the tal-free mutant M6 with all TALE genes deleted were constructed based on the Xcm Xss-V2-18 strain, and verified by Southern blotting technology. Figure 5 As shown in A, M4, M5, and M6 were all constructed successfully.

[0072] Genomic DNA was extracted from the Xcm Xss-V2-18 strain and digested with BamHI, EcoRI and ApaLI to further isolate the tal gene. The digested DNA was electrophoresed on an agarose gel to separate the DNA fragments. After purification by a gel recovery kit, these DNA fragments that may contain the tal gene were cloned into the pBlueScriptII vector digested with BamHI to construct the pB-TALE series of recombinant vectors. These pB-TALE series of recombinant vectors were transferred into DH5α cells. By in situ hybridization, the PthXo1 fragment (Gene ID: ACD58243) was used as a probe to identify colonies containing the tal gene. Colony PCR was performed to further verify the positive colonies by SphI restriction digestion and using primers TALN18-XF (SEQ ID NO.26) and TALN18-XR (SEQ ID NO.27), and plasmids were extracted and obtained by Sanger sequencing. pB-Tal1 and pB-Tal1b vectors containing Tal1 and Tal1b ( Figure 6 and Figure 7 ).

[0073] The obtained pB-Tal1 and pB-Tal1b recombinant vectors were digested with SphI to release the central repeat region (CRR), and then ligated into the pZY vector linearized with SphI to construct the pZY-Tal1 recombinant vector (eg Figure 8 As shown) and pZY-Tal1b recombinant vector (as Fig. 9 The pZY-Tal1 recombinant vector and the pZY-Tal1b recombinant vector were linearized and connected to the HindIII site of the pHM1 vector, and then transformed into the tal-free mutant M6 strain for immunohybridization, as shown in FIG. Figure 5 As shown in B, the normal expression of the protein was verified, and the M6 ​​strain containing the Tal1 gene and the M6 ​​strain containing the Tal1b gene were constructed.

[0074] When the wild type Xcm Xss-V2-18 and tal gene deletion mutant of cotton angular leaf spot pathogen were injected into cotton, it was found that Figure 5 As shown in Figure C, both M4 and M5 containing Tal1 or Tal1b genes can produce water-soaked lesions, while the tal-free mutant M6 strain cannot produce water-soaked lesions. In addition, compared with the M6 ​​strain, the M6 ​​strain containing Tal1 or Tal1b genes can cause obvious water-soaked lesions on cotton leaves. It can be seen that inducing GhSWEET14 expression can directly lead to the occurrence of cotton angular leaf spot disease, while not inducing GhSWEET14 expression can avoid the occurrence of cotton angular leaf spot disease, which provides great application prospects for the prevention and control of cotton angular leaf spot disease.

[0075] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. An application of cotton gene GhSWEET14 in preventing and treating cotton angular leaf spot, characterized in that: The pathogen of angular spot disease is Xanthomonas citri pv.malvacearum, the cotton gene GhSWEET14 includes loci GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02, and the coding nucleotide sequences of the loci GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02 are shown in SEQ ID NOs. 1 to 3, Methods for preventing and controlling cotton angular leaf spot include: Silencing or knocking out the promoter region bases of any one or more loci GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02 improves cotton resistance to angular leaf spot disease. The promoter sequence of the gene locus GhSWEET14A04 is shown as SEQ ID NO.7 or SEQ ID NO.21, the promoter sequence of the gene locus GhSWEET14D04 is shown as SEQ ID NO.11 or SEQ ID NO.22, and the promoter sequence of the gene locus GhSWEET14D02 is shown as SEQ ID NO.14 or SEQ ID NO.

25.

2. The use of the cotton gene GhSWEET14 in preventing and treating cotton angular spot disease according to claim 1, characterized in that: Methods for preventing and controlling cotton angular leaf spot include: Silencing or knocking out the TALE protein targeting sequence in the promoter region of the locus GhSWEET14A04 improves cotton resistance to angular leaf spot disease. The TALE protein targeting sequence is an EBE sequence bound by the Tal1b protein and / or an EBE sequence bound by the Tal1 protein, The EBE sequence bound by the Tal1b protein of the gene locus GhSWEET14A04 is shown in SEQ ID NO.8, and the EBE sequence bound by the Tal1 protein is shown in SEQ ID NO.

9.

3. The use of the cotton gene GhSWEET14 in preventing and treating cotton angular spot disease according to claim 2, characterized in that: Gene editing methods are used to mutate one or more bases in any sequence shown in SEQ ID NO.8 or 9 to silence or knock out the bases.

4. The use of the cotton gene GhSWEET14 in preventing and treating cotton angular spot disease according to claim 3, characterized in that: The sequences shown in SEQ ID NO.8 and 9 were mutated into the sequence shown in SEQ ID NO.

10.

5. The use of the cotton gene GhSWEET14 in preventing and treating cotton angular spot disease according to claim 1, characterized in that: Methods for preventing and controlling cotton angular leaf spot include: Silencing or knocking out the TALE protein targeting sequence in the promoter region of the locus GhSWEET14D04 improves cotton resistance to angular leaf spot disease. The TALE protein targeting sequence is an EBE sequence bound by the Tal1b protein and / or an EBE sequence bound by the Tal1 protein, The EBE sequence bound by the Tal1b protein of the gene locus GhSWEET14D04 is shown in SEQ ID.NO.12, and the EBE sequence bound by the Tal1 protein is shown in SEQ ID.NO.

13.

6. The use of a cotton gene GhSWEET14 in preventing and treating cotton angular leaf spot according to claim 5, characterized in that: Gene editing methods are used to mutate one or more bases in any sequence shown in SEQ ID NO. 12 or 13 to silence or knock out the bases.

7. The use of the cotton gene GhSWEET14 in preventing and treating cotton angular spot disease according to claim 6, characterized in that: The sequences shown in SEQ ID NO. 12 and 13 were mutated into the sequence shown in SEQ ID NO.

10.

8. The use of the cotton gene GhSWEET14 in preventing and treating cotton angular leaf spot according to claim 1, characterized in that: Methods for preventing and controlling cotton angular leaf spot include: Silencing or knocking out the TALE protein targeting sequence in the promoter region of the locus GhSWEET14D02 improves cotton resistance to angular leaf spot disease. The TALE protein targeting sequence is an EBE (effector-binding element) sequence bound by the Tal1b protein. The Tal1b protein binding EBE sequence of the gene locus GhSWEET14D02 is shown in SEQ ID NO.

15.

9. The use of the cotton gene GhSWEET14 in preventing and treating cotton angular leaf spot according to claim 8, characterized in that: A gene editing method is used to mutate one or more bases in the sequence shown in SEQ ID NO.15 to silence or knock out the bases. The sequence shown in SEQ ID NO.15 was mutated into the sequence shown in SEQ ID NO.

16.

10. A method for breeding angular leaf spot resistant cotton varieties, characterized in that: include: A cotton variety containing a promoter region silenced or knocked out of any one or more loci of GhSWEET14A04, GhSWEET14D04 and GhSWEET14D02 on the gene GhSWEET42 is prepared. The TALE protein targeting sequence in the promoter region of the gene locus GhSWEET14A04 is as shown in SEQ ID NO.10, the TALE protein targeting sequence in the promoter region of the gene locus GhSWEET14D04 is as shown in SEQ ID NO.10, and the TALE protein targeting sequence in the promoter region of the gene locus GhSWEET14D02 is as shown in SEQ ID NO.16.

Images