RAB5A-induced targeted recombinant protein exosome preparation system and application thereof in delivery of recombinant biological drugs

Abstract

The invention discloses a preparation system of RAB5A-induced targeted recombinant protein exosomes and application of the preparation system in delivery of recombinant biological drugs. The preparation method comprises the following steps: constructing pIRES-RAB5A-Insulin and pKEX2-alpha-Rt-hst3 plasmids, carrying out co-transfection on cells, and carrying out extraction, so as to obtain the target type exosome. The vesicle gene RAB5A can enable insulin to be expressed on an exosome membrane when early exosome vesicles are formed, the insulin can target insulin receptor cells, KEX2-alpha can be combined with the RAB5A to enable Rt-hst3 to be wrapped into the early exosome vesicles, and the insulin receptor targeted exosome wrapping hst3 protein is formed. Further research finds that the exosome can obviously improve the mitochondrial function. Therefore, the hst3-insulin exosome constructed by the invention realizes targeted delivery of recombinant drugs, and also provides a new way for treatment of diseases related to mitochondrial dysfunction.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a RAB5A-induced targeted recombinant protein exosome preparation system and its application in the delivery of recombinant biological drugs. Background Art

[0002] Mitochondria are double-membrane structures present in most cells, which are mainly responsible for energy production and aerobic respiration. When the mitochondrial membrane is damaged, DNA is damaged, or the respiratory chain is inhibited, energy metabolism disorders, namely mitochondrial dysfunction, will occur. This disorder will reduce mitochondrial membrane potential and respiratory chain enzyme activity, increase oxidative stress, and reduce ATP synthesis. In particular, oxidative damage to mtDNA will further weaken the biosynthetic capacity of mitochondria, aggravate dysfunction, and ultimately may lead to cell apoptosis. Mitochondrial dysfunction is mainly manifested as loss of electron respiratory chain efficiency and reduced ATP synthesis, which is also the main feature of aging and chronic diseases.

[0003] Exosomes are tiny vesicles containing nucleic acids, proteins and lipids secreted by cells. They can be taken up by target cells and transport their contents, so they can be used as drug delivery vehicles. The CD47 protein on the exosome membrane triggers the inhibition of phagocytosis signals by binding to the signal regulatory protein α, avoiding capture by immune cells. Studies have shown that some exosomes have transmembrane domains with functional peptides on their surfaces, such as exosomes containing integrin proteins secreted by M2 macrophages, which can target immune cells. The C1C2 domain of lactadherin on the exosome membrane shows targeting to lymphocytes. However, there are still few reports on the use of exosomes to target mitochondria to treat mitochondrial damage. Therefore, it is of great significance to provide an exosome that can be efficiently secreted, targeted to mitochondria and has better therapeutic effects. Summary of the invention

[0004] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art, and to provide a method for preparing RAB5A-induced targeted recombinant protein exosomes. RAB5A promotes exosome secretion of proteins to enrich insulin molecules on the surface of the plasma membrane of drug-producing cells. At the same time, another recombinant plasmid pFlag-CMV-Kex2-Rt-hst3 was constructed, so that drug-producing cells highly express Rt-hst3 protein and encapsulate it into exosomes. These exosomes carry insulin molecules through membrane fusion during secretion, so that they can target cells with high insulin receptor content, such as liver, brain and other tissues. The exosomes expressing this targeted molecule were applied to mouse liver oxidative stress model cells, and the mitochondrial structural damage and functional decline caused by oxidative stress were significantly improved.

[0005] The second object of the present invention is to provide exosomes prepared by the above preparation method.

[0006] The third object of the present invention is to provide the use of the above-mentioned exosomes in drug delivery.

[0007] The fourth object of the present invention is to provide the use of the above-mentioned exosomes in the preparation of a drug for treating mitochondrial damage.

[0008] A fifth object of the present invention is to provide a medicine containing the above exosomes.

[0009] The above-mentioned object of the present invention is achieved through the following technical solutions: The present invention provides a method for preparing RAB5A-induced targeted recombinant protein exosomes. The preparation method comprises the following steps: co-transfecting mesenchymal stem cells with pIRES-RAB5A-Insulin and pKEX2-α-Rt-hst3 plasmids, extracting and obtaining exosomes with insulin on the surface and recombinant Rt-hst3 inside.

[0010] The present invention transfects pIRES-RAB5A-Insulin and pKEX2-α-Rt-hst3 plasmids into MSC cells. The pIRES-RAB5A-Insulin recombinant plasmid co-expresses RAB5A and insulin genes simultaneously through the internal ribosome entry site (IRES). The expressed RAB5A can promote the formation of a large number of early exosome vesicles (that is, RAB5A can promote the efficient production of exosomes, making the exosome yield higher), and enrich the overexpressed insulin molecules in the plasma membrane of the early vesicles, so that the vesicle surface carries pancreatic secretion when secreted through membrane fusion. Insulin molecules, thus having the function of targeting insulin receptor cells; the plasmid of Rt-hst3 containing the signal peptide KEX2-α introduced at the same time (KEX2-α can promote the secretion and expression of Rt-hst3) can make KEX2-α bind to RAB5A, and when the early exosome vesicles are formed, the expressed recombinant drug Rt-hst3 protein is loaded into the exosome vesicles, and finally the exosomes with insulin on the surface and recombinant Rt-hst3 inside are extracted, that is, exosomes containing Rt-hst3 protein with insulin receptor targeting (hst3-insulin exosomes). Finally, the exosomes encapsulate and carry the Rt-hst3 protein to reach the target cells under the targeting action of Insulin (encoding insulin protein).

[0011] Rab proteins are members of the small guanosine triphosphatase (GTPase) family and belong to the largest branch of the Ras superfamily. There are 66 Rab genes in the human genome. Rab family proteins can control membrane budding, the formation of transport vesicles, the movement of vesicles on the cytoskeleton, and the fusion between vesicles and organelles through interactions with multiple effector proteins. RAB5 belongs to the RAB GTPases family, which includes three subtypes, namely RAB5A, RAB5B and RAB5C. This family plays an important regulatory role in the cell and is responsible for transporting mature endocytic vesicles from the cell membrane to the early endosome. As a small GTPase, RAB5A protein is involved in the production and release of cellular exosomes. The RAB5A protein is about 22KDa, and the gene CDS region is 606 bp. RAB5A is a gene that promotes vesicle secretion. When the vesicle is formed in the early stage, it is located and expressed on the plasma membrane, and it is conducive to the closely connected and co-expressed proteins to be encapsulated into the vesicle. When the vesicle moves to the cell membrane to form exosomes, it can promote the closely connected and co-expressed proteins to enter the exosomes. Therefore, the present invention uses RAB5A to enter the closely connected and co-expressed proteins into the exosomes.

[0012] Kex2 protease belongs to the subtilisin family and is a Ca 2+ Dependent precursor processing protease, Kex2 signal peptide sequence modification may be an effective way to improve the secretion efficiency of exogenous proteins. In many cases, industrial proteins have been successfully secreted by selected signal peptides. Therefore, screening suitable exogenous signal peptides for different recombinant target proteins is a feasible strategy to improve the secretion expression of recombinant proteins. The α-factor leader sequence based on Saccharomyces cerevisiae is most commonly used as a secretion signal. Therefore, the carboxyl terminus of the α-factor secretion signal of Saccharomyces cerevisiae (LEKR) is used as the guide peptide of the target protein, which contains a Kex2 cleavage site, followed by a spacer peptide (EEAEAEAEPK), and finally linked to the target protein. The sequence of the secretion signal peptide Kex2-α is: LEKREEAEAEAEPK. The secretion signal peptide Kex2-α can guide the fusion expression protein to the endoplasmic reticulum for processing and maturation, which helps the early vesicles to encapsulate the exogenous recombinant protein. Therefore, in theory, Kex2-α can increase the secretion level of the recombinant protein Rt-hst3 and promote the formation of early vesicles while encapsulating the Rt-hst3 protein.

[0013] Rhodosporidium toruloides (R. toruloides) is a commonly used oil-producing red yeast, and its oil content can reach 70% of its dry weight. Among them, R. toruloides contains five Sir2 homologous genes: hst3, hst4, sirtuin1 (sirt1), sirtuin2 (sirt2), and sirtuin4 (sirt4). The Sir2 family genes of R. toruloides are highly homologous to the sirtuin genes of mammals in terms of sequence (as shown in Table 1). Both have highly conserved NAD+ binding domains and catalytic functional domains, which are the key structural basis for them to exert deacetylase activity and improve mitochondrial function. It has been reported that transfection therapy with Rt-sirt1, Rt-sirt2 or Rt-sirt4 genes can significantly improve cell mitochondrial function and improve cell metabolism. NCBI query revealed that the hst3 gene (RHTO_00897) is 1776 bp long and encodes a 63 KDa protein. As one of the five Sir2 homologous genes in R. toruloides, hst3 also has a significant effect on mitochondrial function.

[0014] Table 1 Rhodotorula glutinosus Sir2 family VS SIRT3, SIRT4 and SIRT5

[0015] Furthermore, the pIRES-RAB5A-Insulin plasmid is constructed by using the pIRES2-EGFP plasmid and Insulin to construct pIRES-EGFP-Insulin, and then replacing EGFP with RAB5A to obtain the pIRES-RAB5A-Insulin plasmid.

[0016] Furthermore, the pKEX2-α-Rt-hst3 plasmid is constructed by recombining pFlag-CMV-2-Rt-hst3 with pMD18-T-KEX2-α carrying a secretion signal peptide gene.

[0017] Furthermore, the sequence of KEX2-α is LEKREEAEAEAEPK (SEQ ID No. 1). The signal peptide molecule KEX2-α of pKEX2-α-Rt-hst3 binds to the early vesicle gene RAB5A protein, and when the early exosome vesicles are formed, the expressed recombinant drug Rt-hst3 protein is loaded into the exosome vesicles, forming cell exosomes with insulin on the surface and recombinant Rt-hst3 inside, namely insulin-hst3 exosomes, which have the ability to target insulin receptor cells.

[0018] Preferably, the method comprises constructing pIRES-RAB5A-Insulin and pKEX2-α-Rt-hst3 plasmids. First, pIRES2-EGFP and Insulin are used to construct pIRES-EGFP-Insulin, and then EGFP is replaced with RAB5A to construct pIRES-RAB5A-Insulin. Another plasmid pKEX2-α-Rt-hst3 carrying the Rt-hst3 gene of Rhodotorula glutinosus is also constructed, which is obtained by recombining pFlag-CMV-2-Rt-hst3 with pMD18-T-KEX2-α carrying a secretion signal peptide gene. Then, after the above two plasmids are co-transfected into MSC cells, they can secrete insulin receptor-targeted exosomes that encapsulate Rt-hst3 protein. Finally, the exosomes encapsulate the Rt-hst3 protein and reach the target cells under the targeting action of Insulin.

[0019] As a preferred embodiment, the present invention provides a specific method for preparing the above-mentioned exosomes, comprising the following steps: S1. Design and synthesize the RAB5A gene; S2. Extract pancreatic islet cell mRNA, construct pIRES-EGFP-Insulin plasmid by RT-PCR amplification; then replace EGFP with RAB5A to construct pIRES-RAB5A-Insulin.

[0020] S3. Ligate the KEX2-α fragment with pFlag-CMV-2-Rt-hst3 to construct a new plasmid pKEX2-α-Rt-hst3; S4. co-transfecting the pIRES-RAB5A-Insulin plasmid and the pKEX2-α-Rt-hst3 plasmid into MSC cells, culturing and obtaining cell culture fluid; S5.Exosomes were extracted from cell culture fluid by differential centrifugation.

[0021] Preferably, the differential centrifugation method is to centrifuge the supernatant at 4°C, 300 / 2000 / 10000g for 10 / 10 / 30min, transfer the supernatant and centrifuge at 4°C, 300 / 2000 / 10000g for 70min, take the precipitate and repeat the centrifugation once, resuspend the precipitate with PBS, and finally filter and sterilize with a 0.22μm pore size filter, divide it into EP tubes and store it at -80°C. Centrifuge the supernatant at 4°C, 300 / 2000 / 10000g for 10 / 10 / 30min, transfer the supernatant and centrifuge at 4°C, 300 / 2000 / 10000g for 70min, take the precipitate and repeat the centrifugation once, resuspend the precipitate with PBS, and finally filter and sterilize with a 0.22μm pore size filter, divide it into EP tubes and store it at -80°C.

[0022] The present invention provides a targeted exosome having insulin on the surface and containing recombinant Rt-hst3, which is prepared by any of the above-mentioned preparation methods.

[0023] The present invention studies show that the present invention co-transfects two plasmids into MSC cells, which can secrete exosomes of Rt-hst3 protein with insulin receptor targeting ability. After incubation with a mouse liver cell model with mitochondrial dysfunction, the obtained exosomes reduce the level of reactive oxygen ROS in the cells, increase the activity of the antioxidant enzyme SOD, increase the mitochondrial membrane potential, increase the content of mitochondrial mtDNA and ATP, increase the expression of key factors of mitochondrial biogenesis, improve the mitochondrial reticular structure and restore the quality. This shows that the application of such exosomes expressing insulin receptor targeting ability (i.e., insulin-hst3 exosomes) to mouse liver oxidative stress model cells can significantly improve the mitochondrial structural damage and functional decline caused by oxidative stress.

[0024] Therefore, the present invention provides the use of the above-mentioned targeted exosomes in drug delivery. The drug can be replaced with a corresponding drug with a therapeutic effect according to different diseases during actual treatment.

[0025] Furthermore, the drug is a recombinant biological drug, that is, in actual treatment, it is replaced with a corresponding recombinant protein with therapeutic effect according to different diseases.

[0026] Preferably, when treating diseases related to mitochondrial dysfunction, the recombinant biological drug is recombinant Rt-hst3 protein.

[0027] The present invention also provides use of the targeted exosomes in preparing a drug for treating mitochondrial damage.

[0028] The present invention also provides a drug for treating mitochondrial damage, which contains any of the above-mentioned targeted exosomes having insulin on the surface and containing recombinant Rt-hst3.

[0029] Furthermore, the medicine also contains pharmaceutically acceptable excipients.

[0030] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a RAB5A-induced targeted recombinant protein exosome preparation system and its application in delivering recombinant biological drugs. The present invention constructs pIRES-RAB5A-Insulin and pKEX2-α-Rt-hst3 plasmids, co-transfects mesenchymal stem cells, and extracts targeted exosomes with insulin on the surface and recombinant Rt-hst3. The vesicle gene RAB5A can express insulin on the exosome membrane during the early exosome vesicle formation, and insulin can target insulin receptor cells, so that the exosome has the function of targeting insulin receptor cells; KEX2-α can combine with RAB5A to encapsulate Rt-hst3 into early exosome vesicles, thereby forming exosomes (hst3-insulin exosomes) with insulin receptor targeting containing Rt-hst3 protein. The present invention has found that hst3-insulin exosomes can significantly improve mitochondrial function. Therefore, the hst3-insulin exosomes constructed by the present invention achieve targeted delivery of recombinant drugs and also provide a new approach for the treatment of diseases related to mitochondrial dysfunction. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is the double enzyme digestion identification of the recombinant plasmid pIRES-RAB5A-Insulin in Example 1. Note: M: DL15000 DNA Marker; Lane 1: Insulin double enzyme digestion; Lane 2: RAB5A double enzyme digestion.

[0032] Figure 2 This is a map of the pIRES-RAB5A-Insulin plasmid construction in Example 1.

[0033] Figure 3 The Western blot in Example 1 detected the expression levels of RAB5A and Insulin proteins for 24 hours.

[0034] Figure 4 The Western Blot assay in Example 1 was used to detect the expression levels of cell and exosome surface markers.

[0035] Figure 5 The exosome concentration was determined by the BCA protein quantification method in Example 1. Note: NS: p>0.05.

[0036] Figure 6 The exosome particle size and yield analysis in Example 1. Note: A: particle size analysis; B: yield analysis; **: p<0.01.

[0037] Figure 7 The morphology of exosomes observed by transmission electron microscopy in Example 1. Note: Scale bar = 100 nm.

[0038] Figure 8 This is the internalization and targeting ability detection of exosomes in Example 1. Note: Scale bar = 5 μm.

[0039] Fig. 9 This is the double restriction enzyme digestion identification of the recombinant plasmid pFlag-CMV-Kex2-α-Rt-hst3 in Example 2. Note: M: DL10000 DNA Marker; Lane 1: pFlag-CMV-Kex2-α-Rt-hst3 double restriction enzyme digestion; Lane 2: pFlag-CMV-Kex2-α.

[0040] Fig.10 This is a diagram showing the sequencing results of the pFlag-CMV-Kex2-α-Rt-hst3 plasmid in Example 2.

[0041] Fig.11 The Western blot in Example 2 was used to detect the expression levels of Rt-hst3, Insulin and RAB5A proteins.

[0042] Fig.12 This is the MDA content detection in Example 3. Note: NS at 12h and 24h is p>0.05.

[0043] Fig.13 The Western blot in Example 3 was used to detect the intracellular expression level of Rt-hst3 protein.

[0044] Fig.14 This is the uptake of PKH26 fluorescently labeled exosomes by cells at 24h and 48h in Example 3. Note: Scale bar = 25 μm.

[0045] Fig.15 This is the determination of intracellular ROS levels in Example 3. Note: NS: p>0.05.

[0046] Fig.16 This is the determination of the intracellular antioxidant enzyme SOD1 activity in Example 3. Note: *: p<0.05.

[0047] Fig.17 This is the determination of the intracellular antioxidant enzyme SOD2 activity in Example 3. Note: *: p<0.05.

[0048] Fig.18 This is a graph showing the fluorescence intensity ratio of mitochondrial membrane potential observed by the JC-1 fluorescent probe in Example 3. Note: NS: p>0.05.

[0049] Fig.19 The Western blot in Example 3 was used to detect the expression levels of key factors for mitochondrial biogenesis.

[0050] Fig. 20 This is the fluorescence staining to observe the mitochondrial network in Example 3. Note: Scale bar = 5 μm.

[0051] Fig.21 The morphology of mitochondria observed under transmission electron microscopy in Example 3. Note: Scale bar = 100 nm.

[0052] Fig. 22 Schematic diagram of improving mitochondrial function after plasmid co-transfection in Example 3. DETAILED DESCRIPTION

[0053] The present invention is further described in detail below in conjunction with the embodiments.

[0054] Example 1 Study on MSC exosomes and targeting of RAB5A combined with Insulin 1 Experimental Materials Anti-CD63 antibody (Lianke Biotechnology), Anti-CD9 antibody (Beijing Bio-biotech); pancreatic islet cells, laboratory storage. DNA extraction kit Bio-Rad Biotechnology (Beijing) Co., Ltd.; RNA extraction kit, Bio-Man (Beijing) Technology Co., Ltd.; reverse transcription PCR kit, TaKaRa One Step RNA Kit; Lipofectamine TM 2000Transfection Reagent Thermo Fisher.

[0055] 2 Experimental methods 2.1 Extraction and amplification of pancreatic islet cell mRNA The extraction and separation of total RNA from pancreatic islet cells were carried out according to the instructions of the RNA extraction kit.

[0056] The mRNA was amplified using RT-PCR, and the steps were as follows: (1) RT-PCR reaction solution.

[0057] 10×One Step RNA PCR Buffer, 5 μL; MgCl2 (25mmol / L), 10 μL; dNTP Mixture (10mmol / L each), 5 μL; RNase Inhibitor (40 U / μL), 1 μL; AMV RTase XL (5U / μL), 1 μL; AMV-optimized Taq (5 U / μL), 1 μL; upstream specific primer (20 μmol / L), 1 μL; downstream specific primer (20 μmol / L), 1 μL; Positive Control RNA or experimental sample (≤1 μg total RNA or mRNA), 1 μL; RNase Free dH2O, 24 μL.

[0058] (2) Perform RT-PCR reaction according to the conditions in Table 2 below.

[0059] Table 2 RT-PCR reaction conditions

[0060] (3) After the reaction is completed, take the PCR reaction solution (5-10 μL) for agarose gel electrophoresis to confirm the RT-PCR reaction product. Store it in a freezer at -20℃.

[0061] 2.2 Construction of RAB5A and plasmid (1) RAB5A primer design According to the RAB5A gene in GeneBank (NM_001292048.2), amplification primers RAB5A-L and RAB5A-R were designed, and an EcoR V restriction site was introduced upstream and an Xho I restriction site was introduced downstream; the primer sequences were: RAB5A-L (5′-3′): ATGGCTAGTCGAGGCGCAACAAGA (SEQ ID No. 2); RAB5A-R (5′-3′): TTAGTTACTACAACACTGATTCCTGGTTG (SEQ ID No. 3).

[0062] (2) PCR PCR was performed to obtain the complete RAB5A gene; the PCR product was recovered and connected with the pGEM-T vector, transformed into Escherichia coli Top10, and the positive clones were screened by the blue-white screening method; after the PCR identification was correct, the plasmid was extracted, and the plasmid was identified by restriction endonuclease digestion and sent for sequencing; (3) Plasmid construction First, restriction sites were introduced at both ends of the gene, NheⅠ and BamHⅠ restriction sites were introduced at both ends of Insulin (Baoriyi Biotechnology (Beijing) Co., Ltd., Beijing, China), and BstXⅠ and NotⅠ restriction sites were introduced at both ends of the RAB5A gene (Baoriyi Biotechnology (Beijing) Co., Ltd., Beijing, China). After the plasmid pIRES2-EGFP (Beijing Zhuangmeng International Biogene Technology Co., Ltd., Beijing, China) was double-digested with the corresponding endonucleases, it was ligated with the target gene Insulin fragment to construct the pIRES-EGFP-Insulin plasmid.

[0063] The amplified RAB5A gene fragment was double-digested with BstXⅠ / NotⅠ and then cloned into pIRES-EGFP-Insulin to replace the EGFP fragment to construct the pIRES-RAB5A-Insulin plasmid.

[0064] The recovery of the above PCR fragments was carried out according to the instructions of the gel recovery kit, while the recovery and purification of DNA fragments were carried out according to the operating instructions of the DNA recovery / quick purification kit.

[0065] (4) Transfection For MSC treatment, the original culture medium was discarded, the culture dish was washed with PBS, and 1 ml of Trypsin was added to digest for 1 minute at 37°C and 5% CO2. Then, serum-containing culture medium was added to terminate the reaction, and the cells were completely dispersed by multiple pipetting and centrifugation, and then centrifuged at 1000 rpm for 5 minutes. After resuspending the cells, the complete culture medium was used to mix well and 0.8×10 6 The cells were divided into culture dishes and cultured in a CO2 incubator. When transfecting cells, the ratio of liposome volume to DNA mass was 1:2. Serum-free medium and DNA were first added to the transfection tube, and then the transfection reagent was added after shaking. After standing for 10-15 minutes, the medium was removed and washed once with serum-free medium. Then the mixture was added and the cells were returned to the incubator for one hour. After that, the mixture was removed and complete medium was added to continue the culture for 48 hours. After 24 hours of transfection, observation and recording were made.

[0066] 2.3 Extraction and identification of MSC exosomes (1) Exosome extraction: The supernatant of MSC cells transfected with pIRES-RAB5A-Insulin plasmid was collected and the exosomes were extracted from the cell culture fluid by differential centrifugation. The supernatant was centrifuged at 4°C, 300 / 2000 / 10000g for 10 / 10 / 30 min, respectively. The supernatant was transferred and centrifuged at 4°C, 300 / 2000 / 10000g for 70 min. The precipitate was centrifuged again once, and the precipitate was resuspended in PBS. Finally, it was sterilized by filtration with a 0.22 μm pore size filter, divided into EP tubes and stored at -80°C.

[0067] (2) Determination of exosome concentration by BCA quantitative method: The protein concentration was determined according to the instructions of the BCA quantitative kit.

[0068] (3) Immunoblotting to detect the protein expression levels of exosome markers CD63, CD9, and ALIX: 20 μL of boiled exosomes were taken for SDS-PAGE protein separation and electrotransferred to PVDF membrane. After nonspecific antigen binding sites were blocked with 5% skim milk powder blocking solution, Anti-CD63 antibody (1:1000), Anti-CD9 (1:1000), Anti-Alix (1:1000), rabbit anti-GM130 (1:1000) and HRP-conjugated goat anti-mouse IgG labeled II antibody (1:500) were added, and ECL luminescent solution was used for color development. The images were imaged in a multifunctional imager and the grayscale analysis of the images was performed using Image J software.

[0069] (4) Nanoparticle size detection: Slowly inject 1 mL of exosome sample into the sample pool of the Nanosight nanoparticle size analyzer, and place the thermometer probe into the copper hole of the laser module. After adjusting the focal length, observe and calculate the particle size of the sample.

[0070] (5) Transmission electron microscopy: 10 μL of exosome sample was added to the copper mesh, and the floating liquid was removed with dust-free paper. 10 μL of phosphotungstic acid was added, and the floating liquid was removed again. Dry at room temperature for 5 min, and imaged with a transmission electron microscope at an operating voltage of 90-120 kV.

[0071] (6) Exosome PKH26 staining: Perform exosome PKH26 staining according to the instructions of the kit.

[0072] (7) Internalization detection of exosomes: The exosome samples stained with PKH26 were diluted to 100 μg / mL with PBS; the exosome samples stained with PKH26 were added to confocal 6-well plates cultured with C57BL / 6J mouse myocardial microvascular endothelial cells, primary hepatocytes, and primary kidney cells (seeding density 1×10 3 / mL), and then washed with PBS three times after 24 hours, each time for 1 min; the internalization of exosomes by the three groups of cells was observed under an inverted laser confocal microscope with a laser at a wavelength of 594 nm.

[0073] 3 Experimental Results 3.1 Identification of plasmid pIRES-RAB5A-Insulin The results of double digestion with BstXⅠ and NotⅠ and NheⅠ and BamHⅠ were as follows Figure 1 As shown in Figure 2, there are bands of about 153 bp and 606 bp in lane 1, whose sizes are consistent with Insulin and RAB5A, respectively, indicating that Insulin and RAB5A fragments were successfully cloned into the plasmid. The plasmid map of pIRES-RAB5A-Insulin is shown in Figure 2. Figure 2 shown.

[0074] 3.2 Transfection of pIRES-RAB5A-Insulin plasmid into MSC cells like Figure 3 As shown, compared with normal MSC cells, cells transfected with pIRES-RAB5A-Insulin plasmid had bands at 22 kDa and 6 kDa, which were consistent with the theoretical values ​​of RAB5A and Insulin proteins, indicating that the pIRES-RAB5A-Insulin plasmid was successfully transfected into cells and could stably express RAB5A and Insulin in MSC cells.

[0075] 3.3 Detection of exosome markers by immunoblotting Western blot analysis results Figure 4 As shown in the figure, compared with the empty plasmid transfection, the Insulin protein band was present in the MSCIns and MSCIns-Exos groups. By comparing normal MSC cells with transformed MSC cells, it was determined that the Insulin protein was successfully transfected into exosomes. Exosome core protein markers, including CD63, CD9, and ALIX, were also detected, and the total protein amount of exosomes was determined. The results are shown in Figure 5 As shown, after adding targeting molecules, there was no significant difference in the composition of exosome markers and the total protein content of exosomes, indicating that targeting molecules would not affect the biological function of exosomes.

[0076] 3.4 Detection of exosome nanoparticle size and yield like Figure 6 As shown in A, the size of exosomes from normal MSC and MSCIns cells is about 100nm. After comparing the curves of the exosome size of the two groups, no significant difference was found. The results show that adding targeting molecules does not affect the size of exosomes. Figure 6As shown in B, the BCA method was used to detect the level of exosomes secreted by cells. The exosomes in the pIRES-RAB5A-Insulin plasmid group in MSC cells were significantly higher than those in the blank plasmid group, and the difference was statistically significant.

[0077] 3.5 Transmission electron microscopy detection of exosomes Transmission electron microscopy results Figure 7 As shown, the morphology of the isolated exosomes showed a generally similar double-layer spherical structure, and there was no significant difference in the morphology of the exosomes between the two groups.

[0078] 3.6 Targeting ability detection of exosomes produced by MSCIns cells like Figure 8 As shown, compared with exosomes derived from normal MSC cells, exosomes secreted from MSCIns cells are more enriched on the surface of the three groups of cells, and the degree of enrichment is primary hepatocytes > myocardial microvascular endothelial cells > primary kidney cells. Based on this result, it can be determined that pancreatic islet proteins are successfully transferred from the MSCIns cell membrane to the outer membrane of exosomes. 1 Experimental Materials

[0079] 1.1 Cells and plasmids E. coli DH5α, R. toruloides, preserved in our laboratory; MSC cells, Guangzhou Saiye Biotechnology Co., Ltd.; pFlag-Rt-hst3, preserved in our laboratory.

[0080] 1.2 Experimental Reagents Fetal bovine serum, Gibco; Lipofectamine TM 3000, Invitrogen, USA; Anti-Flag specific antibody, Sigma Anti-Insulin primary antibody, Millipore; total protein extraction kit, Shanghai Solebao Biotechnology Co., Ltd.; horseradish peroxidase (HRP), Beyotime Biotechnology; Kpn I restriction endonuclease, EcoRⅠ restriction endonuclease, Bio-Rad Biotechnology.

[0081] 2 Experimental methods 2.1 Construction of recombinant protein Rt-hst3 expression vector plasmid The plasmid pMD18-T-KEX2-α (constructed by Sangon Biotech Co., Ltd.) and pFlag-CMV-2-Rt-hst3 (constructed by Shanghai Jikai Gene Co., Ltd.) were digested and purified by restriction endonucleases EcoRI / KpnI, and the primers used for Rt-hst3 (RHTO_00897) were as follows: upstream primer: 5'-3' ATGCAGACTGTCCGATTGG (SEQ ID No.4), downstream primer: 5'-3' TCAGAGCTCAGGCGAGATAA (SEQ ID No.5), and then the KEX2-α fragment (sequence LEKREEAEAEAEPK (SEQ ID No.1)) was connected with the pFlag-CMV-2-Rt-hst3 fragment to construct the plasmid pKEX2-α-Rt-hst3. The plasmids were transformed, extracted, gel electrophoresed and identified by EcoRI / KpnI double digestion.

[0082] The enzyme digestion reaction system is as follows: recombinant plasmid pIRES2-KEX2-α-Rt-hst3-EGFP, 7.5μL; 10×QuickCut Buffer, 2μL; QuickCut Kpn I, 0.5μL; QuickCut EcoRⅠ, 0.5μL; sterile water is added to 20μL, carefully mixed and centrifuged instantly, and the entire reaction is reacted at a constant temperature of 30°C overnight. The pIRES2-KEX2-α-Rt-hst3-EGFP recombinant plasmid with correct enzyme digestion verification was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing.

[0083] 2.2 Co-transfection of pKEX2-α-Rt-hst3 and pMCP-RAB5A-Insulin plasmids into MSC cells The above verified recombinant plasmids (pKEX2-α-Rt-hst3 and pMCP-RAB5A-Insulin) were co-transfected into MSC cells according to the instructions of Lipofectamine 3000 liposome transfection kit. Some cells were used for expression identification of target genes, and the rest of the cells were cultured in mesenchymal stem cell complete medium.

[0084] 2.3 Extraction and identification of target proteins in cells After the stably co-transfected cells were washed with PBS buffer solution, 4 mL of collagenase preheated at 37°C was taken for cell digestion; when most cells were observed to float, centrifuged at 12,000 rpm for 5 minutes and the precipitate was retained; RIPA lysis buffer was added, and then shaken for 30 minutes to allow the lysis buffer to fully contact the cells, and lysed on ice for 20 minutes; then centrifuged at 12,000 rpm for 20 minutes at 4°C, the supernatant was collected, and the protein concentration was determined using the BCA protein quantification method. Western Blot verification, in which the primary antibody used Anti-Flag specific antibody (1:1000), Anti-Insulin (1:1000), Anti-RAB5A antibody (1:1000), and the secondary antibody used HRP (1:500), and the ECL luminescent solution was used for development after incubation.

[0085] 2.4 Extraction and identification of target proteins in exosomes The method of extracting exosomes refers to the experimental steps of 2.3 in Example 1, and hst3-insulin exosomes are extracted. After extraction, 100 μL RIPA lysis buffer is used to lyse the precipitate, and the mixture is repeatedly blown on ice; vortexed for 30 s every 5 min at 4°C, and repeated 5 times to fully lyse the exosomes; the exosome lysate is centrifuged at 4°C and 10000×g for 5 min, and the supernatant is the total protein of the exosomes. The concentration of the target protein in the exosomes is determined by the BCA quantitative method. Western blot is used to identify the target protein in the exosomes, and the primary antibody uses the Anti-Flag specific antibody (1:1000) and the secondary antibody uses HRP (1:500).

[0086] 3 Experimental Results 3.1 Identification of pFlag-CMV-Kex2-Rhst3 plasmid (1) Enzyme digestion verification of pFlag-CMV-Kex2-Rhst3 plasmid The results of colony PCR identification were as follows Fig. 9 As shown, a band at 1776 bp was found in lane 1, and its size was consistent with Rt-hst3. The results of double enzyme digestion identification showed that there were bands of about 1776 bp and 4720 bp in lane 1, and their sizes were consistent with Rt-hst3 and pFlag-CMV-Kex2, respectively, indicating that the Rt-hst3 fragment was successfully cloned into the plasmid.

[0087] (2) Sequencing of pFlag-CMV-Kex2-Rhst3 plasmid The gene sequencing results of pFlag-CMV-Kex2-Rhst3 are as follows Fig.10As shown, it was found that the Kex2-EK and Rt-hst3 gene sequences had been loaded into the pFlag -CMV-2 plasmid, indicating that the constructed pFlag -CMV-Kex2-Rhst3 plasmid was correct.

[0088] 3.2 Identification of target proteins in drug-producing cells and exosomes After 36 h of co-transfection, the Western blot results of total cell protein were as follows: Fig.11 As shown, MSC cells transfected with pKEX2-α-Rt-hst3 and pIRES-RAB5A-Insulin plasmids highly expressed Rt-hst3 and Insulin proteins ( Fig.11 A in the figure), while normal MSC cells did not express the two proteins, indicating that the two plasmids were successfully transfected into the cells and could be stably expressed in the cells. Western blot analysis of the total protein of MSC cell exosomes revealed target bands at 63kDa and 6kDa ( Fig.11 A in the figure), whose size is consistent with the theoretical value of Rt-hst3 and Insulin, indicating that Rt-hst3 and Insulin proteins can be stably expressed in cells and can also be successfully encapsulated and carried out by exosomes; RAB5A and RAB5A-KEX2-α binding proteins were observed in the pIRES-RAB5A-Insulin single transfection and co-transfection groups, respectively ( Fig.11 (B) The results show that the signal peptide KEX2-α can bind to RAB5A. 1 Experimental methods

[0089] 1.1 Establishment of hydrogen peroxide-induced oxidative stress model in mouse liver cells Hydrogen peroxide (H2O2) was used to establish an oxidative stress model. Malondialdehyde (MDA) is a marker of oxidative stress. The optimal concentration and duration of H2O2 can be determined by detecting the content of MDA in cells. The cells were divided into 6 groups, H2O2 groups (10, 50, 100, 200 and 300 μmol / L) and blank groups. The content of MDA in the cells was measured after stimulation for 1, 3, 6, 12 and 24 h, respectively, to screen out the most appropriate H2O2 solution stimulation concentration and time. The MDA level was determined according to the instructions of the MDA detection kit.

[0090] 1.2 Effects of exosomes on oxidative stress cell models (1) The hst3-insulin exosomes obtained in Example 2 were co-incubated with oxidative stress model cells When the oxidative stress model cells were cultured to 80%, the H2O2 solution was thoroughly washed away with PBS buffer, and the cells were inoculated in a 24-well plate with a cell slide after low-speed centrifugation, with 2×10 5 cells and cultured them in a constant temperature incubator at 37°C and 5% CO2 overnight. When the cells attached to the wall, 1 mL of 200 μg / mL exosomes containing Rt-hst3 protein was added to each well and cultured in a constant temperature incubator at 37°C and 5% CO2 for 12 h.

[0091] (2) Extraction and identification of target proteins in oxidative stress model cells After the oxidative stress model cells were incubated with exosomes for 12 h, the total cell protein was extracted and the expression of Rt-hst3 protein was determined by Western blot.

[0092] (3) Determination of ROS levels using DCFH-DA probe The DCFH-DA solution was diluted with serum-free culture medium at a ratio of 1:1000; the oxidative stress model cells were washed twice, 100 μL of DCFH-DA diluent was added, and the cells were cultured at 37°C for 30 min; the oxidative stress model cells were washed three times with serum-free culture medium to remove the DCFH-DA that did not enter the cells, and fresh culture medium was added to culture for another 30 min; the cells were collected by centrifugation, and the cells were resuspended with an appropriate amount of DCFH-DA diluent solution; a total of 10,000 cells were counted by flow cytometry, the fluorescence intensity of each group of cells was detected, and the average fluorescence intensity was calculated; and the cells were observed under a fluorescence microscope after UV excitation.

[0093] (4) Effect of intracellular antioxidant enzyme SOD activity The test was performed according to the instructions of the kit: the cells were washed three times with phosphate buffer, and the cells were collected by centrifugation at 8000 rpm for 5 min at 4°C; the extract was added at a ratio of 1000:1, ultrasonically crushed, centrifuged at 8000 rpm for 10 min at 4°C, the supernatant was collected, and stored on ice; the SOD enzyme activity was measured according to the instructions of the kit.

[0094] (5) Determination of mitochondrial membrane potential (JC-1 method) The cells were cleared with PBS, and then 1 mL of cell culture medium was added; 0.5 ml of JC-1 staining solution was added and incubated at 37°C for 2 min; the five-fold JC-1 staining solution was diluted to one-fold and stored on ice; at the end of the incubation, the precipitate was retained and the cells were washed twice with JC-1 staining buffer; 2 ml of cell culture medium was added to the washed cells for detection of mitochondrial membrane potential.

[0095] (6) mtDNA determination Extract cell DNA and quantify mtDNA according to the RT-PCR kit instructions. The specific steps are as follows: 1) Primer design ND1 upstream primer 5'-TAATGCTTACCGAACGAAA-3' (SEQ ID No.6), downstream primer 5'-AGGGTGATGGTGGATGTG - 3' (SEQ ID No.7); β-actin upstream primer 5'-GAG TG GT GCT CT CT GAA TAAG GT T - 3' (SEQ ID No.8), downstream primer 5'-GAAAGAGGCAGTTCCATAGATGACA-3' (SEQ ID No.9), were used to amplify mtDNA for ND1 and nDNA for β-actin, respectively, and RT-PCR was performed.

[0096] 2) PCR reaction system 10 μM upstream primer 10 μL; 10 μM downstream primer 0.8 μL; 2 × TSING KE ®Master qPCR Mix 0.8 μL; Template DNA 1 μL; ddH2O to make up to 20 μL.

[0097] 3) PCR reaction conditions, see Table 3 Table 3 PCR reaction conditions

[0098] 4) Quantitative calculation The relative content of mtDNA was calculated according to the formula.

[0099] (7) Determination of biogenesis transcription factors The expression levels of mitochondrial biogenesis-related transcription factors PGC1α, NRF1, and NRF2 were detected by Western Blot, and the primary antibodies were Anti-PGC1α, Anti-NRF1, and Anti-NRF2, respectively.

[0100] (8) Mitochondrial morphology observation Take an appropriate amount of cell culture medium to cover the coverslip for slide culture, and incubate the cells in Mito-TrackerRed working solution (1mM) at 37°C for 30 minutes; finally, replace the staining solution with fresh culture medium and observe under a fluorescence microscope.

[0101] 2 Experimental Results 2.1 Establishment of hydrogen peroxide-induced oxidative stress model in mouse liver cells like Fig.12As shown in the figure, with the increase of H2O2 concentration, the MDA content in the cells also gradually increased. When the H2O2 concentration was 200 μmol / L, the MDA content was significantly higher than that in other groups, and the best effect was also achieved at 12 h, indicating that the hydrogen peroxide-induced oxidative stress cell model was successfully established. Therefore, in subsequent experiments, 200 μmol / L hydrogen peroxide solution was selected for induction for 12 h as the model construction scheme.

[0102] 2.2 Identification of target proteins in oxidative stress model cells After the exosomes from MSC cells with targeting molecules were co-incubated with oxidative stress model cells, the Western blot results were as follows Fig.13 As shown in the figure, under the detection of Anti-Flag specific antibody, Rt-hst3 protein has a target band at 63kDa. This result identifies that the exosomes derived from MSC cells with targeted molecules can express Rt-hst3 protein in oxidative stress model cells. At the same time, the results of PKH26 fluorescently labeled exosomes being taken up by cells are shown in the figure. Fig.14 As shown, according to the fluorescence intensity, the uptake efficiency of exosomes by cells at 48 h was higher than that at 24 h.

[0103] 2.3 Determination of ROS levels in oxidative stress model cells Hydrogen peroxide induction increases ROS levels in senescent cell models. Fig.15 As shown. The intracellular ROS level induced by H2O2 increased significantly. Compared with the H2O2 group, the ROS level in the Rt-hst3 group cells was significantly reduced. At the same time, at 48h, the ROS level of cells treated with Rt-hst3 was not significantly different from that of the normal group, indicating that Rt-hst3 exosomes can significantly reduce the oxidative stress level in the aging cell model.

[0104] 2.4 Effect of exosomes containing Rt-hst3 protein on SOD activity in oxidatively stressed cells like Fig.16 and Fig.17 As shown, compared with the normal group, the intracellular SOD activity of the oxidative stress model cells was lower. After co-incubation with exosomes containing Rt-hst3, the SOD antioxidant enzyme activity in the oxidative stress model cells was significantly increased. At the same time, at 48 h, the SOD antioxidant enzyme activity of cells treated with Rt-hst3 was significantly different from that of the model cell group, indicating that Rt-hst3 can significantly increase the SOD antioxidant enzyme activity in the aging cell model.

[0105] 2.5 Determination of mitochondrial membrane potential In normal cells, the mitochondrial membrane potential is maintained at a high level. Since H2O2 destroys the mitochondrial function of cells, the mitochondrial membrane potential is reduced. After the transfer of Rt-hst3 into cells, the reduced mitochondrial membrane potential can be increased. This shows that the role of Rt-hst3 rescues the decrease in mitochondrial membrane potential induced by H2O2. Fig.18 The fluorescence intensity ratio can also reflect this point intuitively.

[0106] 2.6 Effects of Rt-hst3 on mitochondrial DNA Compared with the normal group, the mtDNA content of cells induced by H2O2 was reduced, and there was a significant difference between the two, suggesting that there was an obvious defect in mitochondrial biogenesis in cells induced by H2O2. The transfection of Rt-hst3 significantly increased the mtDNA content in the cells, indicating that Rt-hst3 can significantly enhance mitochondrial biogenesis in cells and improve mitochondrial function in cells.

[0107] 2.7 Rt-hst3 promotes the expression of key factors for mitochondrial biogenesis The experimental results are as follows Fig.19 As shown, compared with the H2O2 group, the expression levels of three proteins, PGC-1α, NRF1 and NRF2, in the MSCIns-hst3-Exo group cells increased to varying degrees, but their expression levels were still lower than those in the normal group, indicating that Rt-hst3 can promote mitochondrial biogenesis in cells by upregulating the expression of the main regulatory factors of mitochondrial biogenesis.

[0108] 2.8 Mitochondrial morphology observation Laser confocal microscopy was used to observe Fig. 20 The results showed that in the normal group of cells, the mitochondria were connected to form a network, while after H2O2 induction, the mitochondrial structure of the cells was obviously fragmented, vacuoles were produced, the mitochondria became shorter, and the mitochondrial cristae disappeared, indicating that the mitochondrial network was destroyed. After MSCIns-hst3-Exo transfection, it can be seen that Rt-hst3 greatly improved the mitochondrial structure and quality of the damaged cells. In addition, Fig.21 As shown in the figure, it was observed under transmission electron microscopy that the treatment of Rt-hst3 caused a significant change in mitochondrial morphology. Compared with the mitochondria in the H2O2 group, the mitochondrial membrane in the MSCIns-hst3-Exo group was smoother and the mitochondrial cristae were more complete. Therefore, the above results all show that the hst3-insulin exosomes extracted by co-transfection of pIRES-RAB5A-Insulin and pKEX2-α-Rt-hst3 plasmids can effectively improve mitochondrial function. The mechanism of action is as follows Fig. 22 shown.

Claims

1. A method for preparing RAB5A-induced targeted recombinant protein exosomes, characterized in that: The preparation method comprises the following steps: co-transfecting pIRES-RAB5A-Insulin and pKEX2-α-Rt-hst3 plasmids into mesenchymal stem cells, extracting and obtaining exosomes with insulin on the surface and recombinant Rt-hst3 inside.

2. The preparation method according to claim 1, characterized in that: The pIRES-RAB5A-Insulin plasmid is constructed by using the pIRES2-EGFP plasmid and Insulin to construct pIRES-EGFP-Insulin, and then replacing EGFP with RAB5A to obtain the pIRES-RAB5A-Insulin plasmid.

3. The preparation method according to claim 1, characterized in that: The pKEX2-α-Rt-hst3 plasmid is constructed by recombining pFlag-CMV-2-Rt-hst3 with pMD18-T-KEX2-α carrying a secretion signal peptide gene.

4. The preparation method according to claim 3, characterized in that: The sequence of KEX2-α is LEKREEAEAEAEPK.

5. A targeted exosome having insulin on the surface and containing recombinant Rt-hst3, prepared by the preparation method according to any one of claims 1 to 4.

6. Use of the targeted exosomes according to claim 5 in drug delivery.

7. Use of the targeted exosomes according to claim 5 in the preparation of a drug for treating mitochondrial damage.

8. A drug for treating mitochondrial damage, characterized in that: The drug contains the targeted exosomes having insulin on the surface and containing recombinant Rt-hst3 as described in claim 5.

9. The therapeutic drug according to claim 8, characterized in that: It also contains pharmaceutically acceptable excipients.

Images