Marking method of new RNA in exosome and application

Abstract

The invention discloses a labeling method and application of new RNA in exosomes, and the labeling method comprises the following steps: S1, constructing an animal model of tissue specific expression uracil phosphoribosyltransferase, and then carrying out 4-thiouracil solution administration treatment; s2, collecting plasma exosomes, extracting exosome RNA (Ribonucleic Acid), and then removing ribosome RNA in the exosome RNA to obtain transcriptome RNA; and S3, carrying out sulfydryl-specific biotinylation treatment on the transcriptome RNA, then collecting the biotinylated RNA, and carrying out RNA alkylation treatment on the biotinylated RNA. By adopting the method, the new RNA in the exosome of the liver or fat source in circulation can be marked, the biological information exchange effect between the RNA of the liver or fat source and other organs can be researched, and the method has important significance for promoting the early diagnosis and treatment of metabolic diseases.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a labeling method and application of nascent RNA in exosomes. Background Art

[0002] Metabolic diseases are diseases caused by abnormal metabolism, including obesity, type 2 diabetes, hyperlipidemia, and non-alcoholic fatty liver disease. The etiology is complex and involves multiple factors. It is usually not caused by the lesions of a single organ, but the synergistic effect of multiple organs. When normal physiological conditions change, various organs in the body will release various signal factors to regulate the functions of other organs. The liver and fat are the main organs involved in metabolic diseases. These two organs can regulate the body's glucose and lipid metabolism balance by secreting extracellular vesicles.

[0003] Exosomes are a subclass of extracellular vesicles that are rich in bioactive molecules such as nucleic acids and proteins. They mediate biological signal exchanges between organs by transporting different bioactive substances. At present, most studies on exosomes are done by directly isolating exosomes from tissues or cell supernatants and analyzing the contents therein. Among them, the SYTO-RNASelect dye labeling method is usually used for exosomal RNA labeling. This dye can penetrate the cell membrane and bind to RNA, thereby staining RNA. However, its selectivity for RNA is poor and it is impossible to distinguish between nascent RNA and other nucleic acid molecules in exosomes. Therefore, it is difficult to quickly and accurately identify the tissue-specific origin of exosomes and deeply analyze their contents, which is not conducive to fully understanding the biological information exchange mechanism between organs.

[0004] Based on this, accurately identifying nascent RNA in circulating exosomes of tissue-specific origin has become a difficult problem that needs to be solved urgently. Summary of the invention

[0005] The present invention aims to solve at least one technical problem in the prior art. To this end, the present invention proposes a method for labeling nascent RNA in exosomes, which can label nascent RNA in circulating exosomes derived from liver or fat. This method is helpful to study the biological function of RNA derived from liver or fat between the two organs, as well as its role in the biological information exchange between liver, fat and other organs, which is of great significance for improving the early diagnosis and treatment of metabolic diseases.

[0006] The present invention also proposes a sequencing analysis method for nascent RNA in exosomes.

[0007] The present invention also proposes the application of a labeling method for nascent RNA in exosomes in screening diagnostic markers for metabolic diseases.

[0008] In a first aspect of the present invention, a method for labeling nascent RNA in exosomes is provided, comprising the following steps: S1. Constructing an animal model with tissue-specific expression of uracil phosphoribosyltransferase, and then administering 4-thiouracil solution; S2, collecting plasma exosomes and extracting exosome RNA, and then removing ribosomal RNA from the exosome RNA to obtain transcriptome RNA; S3, performing thiol-specific biotinylation treatment on the transcriptome RNA, and then collecting the biotinylated RNA and performing RNA alkylation treatment; Wherein, the method for labeling nascent RNA in exosomes is used for non-disease diagnosis purposes.

[0009] The method for labeling nascent RNA in exosomes according to an embodiment of the present invention has at least the following beneficial effects: The present invention utilizes the Cre-loxP recombination system to construct a liver-specific expression UPRT (UPRT flox / + Alb-Cre + / - ) or fat-specific expression of UPRT (UPRT flox / + Adipoq-Cre + / - ) transgenic mice, by tissue-specific labeling of nascent RNA, in vivo tracing and separation of nascent RNA in tissue-specific exosomes. Furthermore, through the labeling method of nascent RNA in exosomes and SLAM sequencing analysis in the present invention, the dynamic changes of genes in the liver or fat under pathological conditions can be accurately analyzed, and the targeting of liver or fat-derived exosomes in the circulation can be identified, so as to more accurately explore the signal pathways involved in the labeled RNA in the receptor cells. This will provide a basis for in-depth research on the therapeutic targets of metabolic diseases and is of great significance for promoting early diagnosis and treatment of metabolic diseases.

[0010] In some embodiments of the present invention, in step S1, the method for constructing an animal model for tissue-specific expression of uracil phosphoribosyltransferase comprises: Cre-loxP technology is used to hybridize transgenic animals expressing uracil phosphoribosyltransferase (UPRT) with transgenic animals expressing Cre enzyme specifically in tissues, and an animal model that specifically expresses the uracil phosphoribosyltransferase in tissues is screened.

[0011] In some embodiments of the present invention, the tissue includes liver or fat. Specifically, the animal model in which the tissue specifically expresses uracil phosphoribosyltransferase includes an animal model in which the liver specifically expresses uracil phosphoribosyltransferase and / or an animal model in which the fat specifically expresses uracil phosphoribosyltransferase.

[0012] In some embodiments of the invention, the animal comprises a mouse.

[0013] In some embodiments of the present invention, the method for constructing the mouse model of liver-specific expression of uracil phosphoribosyltransferase comprises: Will carry CA-GFPstop flox -HA⋅UPRT gene sequence transgenic mice were crossed with hepatocyte-specifically expressed Alb-Cre heterozygous mice to obtain F1 mice; the genotype of the F1 mice was UPRT flox / + Alb-Cre + / - ; Select F1 generation UPRT flox / + Alb-Cre + / - Male mice and UPRT flox / + The female mice were crossed to obtain F2 mice with the genotype of UPRT. flox / + Alb-Cre + / - UPRT flox / + .

[0014] In some embodiments of the present invention, the method for constructing the mouse model of fat-specific expression of uracil phosphoribosyltransferase comprises: Will carry CA-GFPstop flox -HA⋅UPRT gene sequence transgenic mice were crossed with adipocyte-specific Adipoq-Cre heterozygous mice to obtain F1 mice, the genotype of the F1 mice was UPRT flox / + Adipoq-Cre + / - ; Select F1 generation UPRT flox / + Adipoq-Cre + / - Male mice and UPRT flox / + The female mice were crossed to obtain F2 mice with the genotype of UPRT. flox / + Adipoq-Cre + / - UPRT flox / + .

[0015] In some embodiments of the present invention, in step S1, the concentration of the 4-thiouracil solution is 40-60 mg / mL.

[0016] In some embodiments of the present invention, the solvent of the 4-thiouracil solution is corn oil and / or dimethyl sulfoxide. Specifically, the solvent of the 4-thiouracil solution contains 85% to 95% corn oil and 5% to 15% dimethyl sulfoxide.

[0017] In some embodiments of the present invention, the preparation method of the 4-thiouracil solution is: First, prepare a 200 mg / mL 4-thiouracil stock solution with dimethyl sulfoxide, mix well, wrap it in tin foil and store it away from light. Immediately before injection, dilute it with 90% corn oil + 10% DMSO to a working solution with a concentration of 50 mg / mL, and vortex vigorously to mix.

[0018] In some embodiments of the present invention, the administered dose is 300-500 mg / kg.

[0019] In some embodiments of the present invention, the animal model is euthanized 5 to 8 hours after the administration and blood and tissues are collected.

[0020] In some embodiments of the present invention, in step S2, the method for removing ribosomal RNA in the exosomal RNA is a magnetic bead separation method.

[0021] In some embodiments of the present invention, the transcriptome RNA refers to the remaining RNA after removing the ribosomal RNA in the exosomal RNA.

[0022] In some embodiments of the present invention, in step S3, the thiol-specific biotinylation treatment comprises: adding a thiol-specific biotinylation reagent to the transcriptome RNA, incubating, and washing.

[0023] In some embodiments of the present invention, the thiol-specific biotinylation reagent is selected from at least one of biotin-HPDP, SPDP-Biotin, PDEA-Biotin, and Sulfo-NHS-SS-Biotin.

[0024] Specifically, the thiol-specific biotinylation treatment includes: adding the following reagents in order per microgram of RNA into an enzyme-free centrifuge tube: 1 μL 10× biotinylation buffer, 7 μL RNA, 2 μL biotin-HPDP, incubating in the dark for 1.2 to 1.8 hours, precipitating the RNA with isopropanol and purifying the RNA with ethanol, and then resuspending the RNA in enzyme-free water for later use.

[0025] In some embodiments of the present invention, in step S3, the method for collecting biotinylated RNA comprises a streptavidin magnetic bead separation method.

[0026] In some embodiments of the present invention, the streptavidin magnetic bead separation method is to contact the mixed solution after the thiol-specific biotinylation treatment with streptavidin magnetic beads to react and remove the non-biotinylated RNA.

[0027] In some embodiments of the present invention, in step S3, the RNA alkylation treatment specifically includes: mixing the biotinylated RNA with an alkylation agent in a solvent, reacting, and washing.

[0028] In some embodiments of the present invention, the volume ratio of the biotinylated RNA to the alkylating agent is 1:0.8-1.2; preferably 1:1.

[0029] In some embodiments of the present invention, the solvent is selected from sodium phosphate buffer and / or dimethyl sulfoxide.

[0030] In some embodiments of the present invention, the alkylating agent is selected from at least one of iodoacetamide, N-ethylmaleimide, methylthiomethanesulfonate, and iodoacetic acid.

[0031] Preferably, the alkylating agent is iodoacetamide.

[0032] In some embodiments of the present invention, the solvent is a mixed solvent of 50 mM sodium phosphate buffer and DMSO.

[0033] A second aspect of the present invention provides a method for sequencing and analyzing nascent RNA in exosomes, wherein the nascent RNA is labeled using the labeling method for nascent RNA in exosomes as described in any one of the first aspects, and then subjected to SLAM sequencing analysis.

[0034] The third aspect of the present invention provides the use of the method for labeling nascent RNA in exosomes as described in any one of the first aspects in screening diagnostic markers for metabolic diseases.

[0035] Other features and advantages of the present invention will be set forth in the description which follows. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 The liver-specific expression of UPRT (UPRT flox / + Alb-Cre + / - ) Schematic diagram of mice; Figure 2 UPRT of the present invention flox / + Alb-Cre + / - PCR validation results in mice; Figure 3 UPRT of the present invention flox / + Alb-Cre + / - Mouse liver Western Blot verification image; Figure 4 This is a Dot Blot verification diagram of the biotinylated RNA of the present invention; Figure 5 The invention constructs adipose-specific expression of UPRT (UPRT flox / +Adipoq-Cre + / - ) Schematic diagram of mice; Figure 6 UPRT of the present invention flox / + Adipoq-Cre + / - PCR validation results in mice; Figure 7 UPRT of the present invention flox / + Adipoq-Cre + / - Western Blot validation of mouse fat. DETAILED DESCRIPTION

[0037] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0038] The words "preferably", "more preferably", etc. in the present invention refer to embodiments of the present invention that may provide certain beneficial effects in certain circumstances. However, other embodiments may also be preferred under the same circumstances or other circumstances. In addition, the description of one or more preferred embodiments does not imply that other embodiments are not applicable, nor is it intended to exclude other embodiments from the scope of the present invention.

[0039] When a numerical range is disclosed herein, the above range is considered to be continuous and includes the minimum and maximum values ​​of the range, as well as every value between such minimum and maximum values. Further, when a range refers to an integer, every integer between the minimum and maximum values ​​of the range is included. In addition, when multiple ranges are provided to describe features or characteristics, the ranges can be combined. In other words, unless otherwise indicated, all ranges disclosed herein should be understood to include any and all subranges included therein.

[0040] In the description of the present invention, the reference term "and / or" includes all and any combinations of one or more of the associated listed items.

[0041] In the description of the present invention, the description with reference to the terms "one embodiment", "some embodiments", "illustrative embodiments", "examples", "specific examples", or "some examples" means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner.

[0042] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0043] Invention concept: The present invention uses Cre-loxP technology to hybridize transgenic mice expressing uracil phosphoribosyltransferase (UPRT) with mice expressing Cre enzyme specifically in liver or fat, respectively, to obtain a mouse model that specifically expresses UPRT in liver or fat. After injecting 4-thiouracil (4-TU) into the hybrid mice, 4-TU can be incorporated into the newly transcribed RNA, thereby covalently labeling the newly generated RNA in liver or fat. After extracting plasma exosome RNA, the labeled newly generated RNA in liver or fat exosomes can be extracted by sulfhydryl-specific biotinylation and pull-down of streptavidin magnetic beads, and then alkylation treatment is performed. Further sequence analysis of newly generated RNA in liver or fat exosomes can provide a basis for finding early diagnostic markers and therapeutic targets for diseases.

[0044] Example 1: A method for labeling nascent RNA in liver exosomes 1. Construction of a mouse model with liver-specific expression of UPRT This example constructs a liver-specific UPRT mouse model. The specific steps are as follows: Figure 1 As shown, including the following: Will carry CA-GFPstop flox -HA⋅UPRT gene sequence transgenic mice (genotype: UPRT flox / + , ordered from The Jackson Laboratory) and mice heterozygous for the hepatocyte-specific expression of Alb-Cre (genotype: Alb-Cre + / - , ordered from Shanghai Model Organisms Technology Co., Ltd.) to obtain F1 mice, the genotype of the F1 mice was UPRT flox / + Alb-Cre + / - ; Select F1 generation UPRT flox / + Alb-Cre + / -Male mice and UPRT flox / + The female mice were crossed to obtain F2 mice with the genotype of UPRT. flox / + Alb-Cre + / - UPRT flox / + .

[0045] 2. Identification of transgenic mouse tails and verification of liver Western Blot Take 2.5 mL of 0.1 M NaOH solution into a 15 mL centrifuge tube containing 7.5 mL ultrapure water, add 5.8448 mg EDTA to dissolve, prepare solution A, and set aside. Weigh 1.2113 g Tris and dissolve it in 8 mL ultrapure water, add 1.7 mL 1 M HCl to adjust the pH to 8.8, and obtain 1 M Tris-HCl mother solution with a pH of 8.8. Take 267 µL and dilute to 10 mL to obtain solution B, and set aside.

[0046] Cut off 0.2-0.5 cm of the mouse tail tip and place it in a 1.5 mL centrifuge tube. Add 225 µL of solution A and incubate in a metal bath at 100°C for 1 hour. Add 75 µL of solution B and vortex to mix. Centrifuge at 13,000 × g at 4°C for 15 minutes. Collect the supernatant into a new sterile centrifuge tube for later use and perform the following genotype identification.

[0047] (1) Identification of UPRT flox / + genotype: UPRT flox / + The PCR system for genotype identification is: 2×Taq Plus Master Mix: 10 μL, primers (transgenic primers, wild-type primers) 10 μM each (0.8 μL), genomic DNA 100 ng, add ddH2O to 20 μL. The sequence information of the identification primers (5'-3') is as follows: Transgenic primer-F: 5′-AGTGACAACCCCTCTGGATG-3′ (SEQ ID NO. 1); Transgenic primer-R: 5′-CATCGGATCTAGCAGCATCA-3′ (SEQ ID NO. 2); Wild-type primer-F: 5′-CAAATGTTGCTTGTCTGGTG-3′ (SEQ ID NO. 3); Wild-type primer-R: 5′-GTCAGTCGAGTGCACAGTTT-3′ (SEQ ID NO. 4); The reaction conditions were set as follows: 94°C for 3 minutes; 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 30 seconds; 72°C for 5 minutes, and the number of cycles was 34. The amplified products were subjected to agarose gel electrophoresis, and the identification results are shown in Figure 2 As shown in A, heterozygous (UPRT flox / + ) had two bands of 238 bp and 200 bp, while the wild type had only a single band of 200 bp, which was consistent with expectations.

[0048] (2) Identification of Alb-Cre + / - genotype: The PCR system for Alb-Cre+ / - genotype identification is as follows: 2×Taq Plus Master Mix 10 μL, primers (transgenic primers, wild-type primers, universal primers) 10 μM each (0.8 μL), genomic DNA 100 ng, add ddH2O to 20 μL, and the sequence information of the identification primers (5'-3') is as follows: Wild-type primer: 5′- TGCAAACATCACATGCACAC -3′ (SEQ ID NO. 5); Universal primer: 5′- TTGGCCCCTTACCATAACTG -3′ (SEQ ID NO. 6); Transgenic primer: 5′- GAAGCAGAAGCTTAGGAAGATGG -3′ (SEQ ID NO. 7); The reaction conditions were set as follows: 94°C for 3 minutes; 94°C for 30 seconds, 60°C for 30 seconds, 72°C for 1 second; 72°C for 5 minutes, and the number of cycles was 35. The amplified products were subjected to agarose gel electrophoresis, and the identification results are shown in Figure 2 As shown in B, heterozygous (Alb-Cre + / - ) detected a 390 bp band and a 351 bp band, while the wild type had only a single 351 bp band, which was consistent with expectations.

[0049] After PCR identification, the screening genotype was UPRT flox / + Alb-Cre + / - The liver of mice was further verified by Western Blot. The results are as follows Figure 3 As shown, the results were consistent with expectations, and the corresponding mice were then used as test mice for subsequent experiments.

[0050] 3. Preparation and injection of 4-TU solution Weigh 200 mg of 4-TU powder (Sigma, catalog number: 440736), prepare 200 mg / mL 4-TU stock solution with 1 mL of dimethyl sulfoxide (DMSO), mix well and wrap in tin foil to protect from light, dilute to 50 mg / mL working solution with 90% corn oil and 10% DMSO immediately before injection, vortex mix vigorously, and inject intraperitoneally into mice at a dose of 400 mg / kg. Six hours after administration, euthanize the mice, collect blood into blood collection tubes containing anticoagulants, and collect various tissues and organs.

[0051] 4. Extraction of plasma exosomes Mix the blood collection tube up and down 5 to 8 times, and let it stand at room temperature for 10 minutes. Centrifuge at 4°C and 1800×g for 10 minutes, and collect the supernatant into a new sterile centrifuge tube. Centrifuge at 4°C and 3000×g for 15 minutes, and collect the supernatant into a new sterile centrifuge tube to obtain plasma.

[0052] The exosomes in plasma were extracted using a mouse plasma exosome extraction kit (Thermo Scientific, Cat. No. 4484450). The specific steps are as follows: S1. Take 300 µL of plasma, centrifuge at 2000 × g for 20 minutes at room temperature, aspirate the supernatant into a new sterile centrifuge tube, centrifuge at 10000 × g for 20 minutes at room temperature, aspirate the supernatant into a new sterile centrifuge tube, add 150 µL of phosphate-balanced saline (PBS) into the centrifuge tube, and vortex to mix; S2. Add 90 µL of total exosome isolation reagent to the above centrifuge tube, vortex thoroughly to mix the plasma and exosome isolation reagent, incubate at room temperature for 10 minutes, centrifuge the sample at 10,000 × g for 5 minutes at room temperature, aspirate and discard all the supernatant with a pipette, and retain the precipitate; S3. Add 100 µL PBS to the above precipitate and pipette up and down to resuspend the exosomes to obtain the plasma exosome resuspension.

[0053] The exosome collection method of this embodiment can obtain a high yield of exosomes from plasma, ensuring the subsequent demand for exosome RNA isolation.

[0054] 5. Extraction and purification of plasma exosome RNA (1) Extraction of exosome RNA: RNA extraction kit (purchased from NORGEN, catalog number: 58000) was used to extract RNA from exosomes. The specific method is as follows: Take 100 µL of the above plasma exosome resuspension, add 150 µL of lysis buffer A and 18.75 µL of lysis additive B, vortex mix for 10 seconds, and incubate at room temperature for 10 minutes. Add 250 µL of anhydrous ethanol and vortex mix for 10 seconds. Pipette 500 µL of the mixture into a mini spin column and put it into a collection tube. Centrifuge at 3300×g for 1 minute at room temperature and discard the liquid. Add 300 µL of wash buffer A, centrifuge at 3300×g for 30 seconds at room temperature, and discard the bottom liquid. Spin the spin column at 13000×g for 1 minute at room temperature and discard the collection tube. Transfer the spin column to 1.7 mL of elution medium, add 50 µL of elution buffer A, centrifuge at 400×g for 1 minute at room temperature, and then centrifuge at 5800×g for 2 minutes at room temperature. Transfer the eluted buffer back to the chromatographic column, let it stand at room temperature for 2 minutes, centrifuge it at 400×g for 1 minute at room temperature, and then centrifuge it at 5800×g for 2 minutes at room temperature to obtain 50 µL RNA solution, which was stored at -80°C.

[0055] The exosome RNA extraction method of the present invention can extract RNA with high purity, remove most impurities, and facilitate downstream qPCR precision analysis.

[0056] (2) Removal of ribosomal RNA: RiboMinus Transcriptome Isolation Kit (Cat. No: K1550-02) was used to remove ribosomal RNA. The specific method is as follows: S1. Add the following reagents to a sterile, RNase-free 1.5 mL centrifuge tube to hybridize the total RNA sample: <20 µL total RNA (2-10 µg), 8 µL RiboMinus™ Probe (100 pmol / µL), 300 µL Hybridization Buffer (B5). Incubate the centrifuge tube at 70-75°C for 5 minutes to denature the RNA. Place the centrifuge tube in a 37°C water bath and cool the sample to 37°C within 30 minutes.

[0057] S2. While the samples are cooling, prepare the RiboMinus™ beads. Resuspend the RiboMinus™ beads by vortexing thoroughly and pipette 500 µL of the beads into a sterile, RNase-free 1.5 mL centrifuge tube. Place the centrifuge tube with the beads on a magnetic stand for 1 minute, then gently pipette and discard the supernatant. Add 500 µL of sterile, RNase-free water to the beads to resuspend them. Place the centrifuge tube on a magnetic stand for 1 minute, then gently pipette and discard the supernatant. Repeat once.

[0058] S3. Resuspend the magnetic beads in 500 µL of Hybridization Buffer (B5), place the centrifuge tube on the magnetic stand for 1 minute, then gently aspirate and discard the supernatant. Then resuspend the magnetic beads in 200 µL of Hybridization Buffer (B5) and maintain the magnetic beads at 37°C until use.

[0059] S4. Transfer the cooled RNA sample to the prepared RiboMinus™ magnetic bead tube and mix thoroughly. Incubate in the centrifuge tube at 37°C for 15 minutes. During the incubation, gently mix the contents occasionally. Place the centrifuge tube on the magnetic stand for 1 minute to precipitate the rRNA-probe complex. Transfer approximately 528 µL of the supernatant to a centrifuge tube with a capacity 3 times the volume of the supernatant. Continue concentrating using the RiboMinus™ Concentration Module.

[0060] S5. Transfer the purified RNA sample to a sterile, RNase-free 2 mL centrifuge tube. Add the following reagents to the RNA sample: 1 µL of Glycogen (20 µg / µL), 3 M sodium acetate (0.1× sample volume), and 100% ethanol (2.5× sample volume). After thorough mixing, incubate at -20°C for at least 30 minutes, and centrifuge the tube at 12,000×g at 4°C for 15 minutes. Carefully discard the supernatant. Add 500 µL of 70% cold ethanol. Centrifuge the tube at 12,000×g at 4°C for 5 minutes. Carefully discard the supernatant without disturbing the pellet. Add 500 µL of 70% cold ethanol again, centrifuge the tube at 12,000×g at 4°C for 5 minutes, and discard the supernatant. Air dry the pellet for about 5 minutes (do not completely dry the pellet). Resuspend the RNA pellet in about 10~30 µL of RNase-free water to obtain transcriptome RNA, which is then stored at -80℃ for future use.

[0061] 6. Labeling and sequencing analysis of nascent RNA in exosomes (1) Thiol-specific biotinylation: Add reagents to the above transcriptome RNA in the following order (per μg RNA): 1 μL 10× Biotinylation Buffer, 7 μL RNA (containing 1 μg RNA and nuclease-free HO), 2 μL biotin-HPDP (1 mg / mL DMF), and finally add biotin-HPDP and mix immediately by pipetting.

[0062] Incubate at room temperature with rotation for 1.5 hours (wrap the centrifuge tube with tin foil to protect from light), add an equal amount of chloroform to mix. Incubate for 2-3 minutes until the liquid begins to separate and bubbles begin to disappear. Centrifuge at 20,000 × g for 5 minutes at 4°C. Carefully transfer the upper aqueous phase to a new tube. Add an equal amount of chloroform again, mix vigorously, and incubate for 2-3 minutes until the liquid begins to separate and bubbles begin to disappear. Centrifuge at 20,000 × g for 5 minutes at 4°C. Carefully transfer the upper aqueous phase to a new tube. Add 1 / 10 volume of 5 M NaCl and an equal volume of isopropanol to the aqueous phase. Centrifuge at 20,000 × g for 20 minutes at 4°C. Discard the supernatant. Add an equal volume of 75% ethanol, centrifuge at 20,000 × g for 10 minutes at 4°C, and discard the supernatant. Centrifuge quickly and remove residual ethanol with a 200 μL pipette. Centrifuge quickly again and remove residual ethanol with a 20 μL pipette. Resuspend the RNA in 50-100 μL enzyme-free water and mix well by pipetting up and down 5-6 times to obtain biotinylated RNA.

[0063] (2) Isolation of biotinylated RNA: Biotinylated RNA was isolated using the μMACS streptavidin kit (Miltenyi Biotec, Waltham, MA, USA), which included the following steps: Denature the biotinylated RNA sample by heating it at 65°C for 10 minutes, then place it on ice immediately before placing the µMACS column in the magnetic stand. Heat the wash buffer to 65°C in a water bath. Pre-equilibrate the µMACS column with 1 mL of room temperature wash buffer. Meanwhile, add 100 µL of streptavidin beads to 50 µL of biotinylated RNA and incubate at room temperature with rotation for 15 minutes. Wash three times with 0.9 mL of room temperature wash buffer, discard free, non-biotinylated RNA, add 100 µL of 100 mM 2-mercaptoethanol to the column, and elute and collect the labeled RNA with 25 μL of enzyme-free water.

[0064] Dot Blot verification was performed on the separated biotinylated RNA. The verification results were as follows: Figure 4 As shown, the results are consistent with expectations.

[0065] (3) RNA alkylation and SLAM sequencing analysis: The biotinylated RNA samples collected above were treated with an equal volume of 10 mM iodoacetamide (IAA) in 50 mM sodium phosphate buffer / 50% DMSO for 15 minutes (at 50°C) for alkylation. The alkylation reaction was terminated with 20 mM DTT, and then the RNA samples were purified by ethanol precipitation. The obtained RNA samples were used for SLAM sequencing to analyze the differential expression of circulating RNA under pathological and physiological conditions.

[0066] In the present invention, biotinylated RNA is alkylated by reacting with IAA to cause chemical modification, and the conversion ratio of TC is detected during sequencing, and then the labeled nascent RNA is sequenced and analyzed. This method helps to reduce the signal background of unlabeled RNA and improve the labeling effect.

[0067] Example 2: A method for labeling nascent RNA in adipose exosomes 1. Construction of a mouse model with fat-specific expression of UPRT This example constructs a fat-specific UPRT mouse model. The specific steps are as follows: Figure 5 As shown, including the following: Will carry CA-GFPstop flox -HA⋅UPRT gene sequence transgenic mice (genotype: UPRT flox / + , ordered from The Jackson Laboratory) and adipocyte-specific Adipoq-Cre heterozygous mice (genotype: Adipoq-Cre + / - , ordered from Shanghai Model Organisms Technology Co., Ltd.) to obtain F1 mice, the genotype of the F1 mice was UPRT flox / + Adipoq-Cre + / - ; Select F1 generation UPRT flox / + Adipoq-Cre + / - Male mice and UPRT flox / + The female mice were crossed to obtain F2 mice with the genotype of UPRT. flox / + Adipoq-Cre + / - UPRT flox / + .

[0068] 2. Identification of transgenic mouse tails and verification of fat Western Blot Take 2.5 mL of 0.1 M NaOH solution into a 15 mL centrifuge tube containing 7.5 mL ultrapure water, add 5.8448 mg EDTA to dissolve, prepare solution A, and set aside. Weigh 1.2113 g Tris and dissolve it in 8 mL ultrapure water, add 1.7 mL 1M HCl to adjust the pH to 8.8, and get pH = 8.8 to get 1 M Tris-HCl mother solution, take 267 µL and dilute to 10 mL to get solution B, and set aside.

[0069] Cut off 0.2-0.5 cm of the mouse tail tip and place it in a 1.5 mL centrifuge tube. Add 225 µL of solution A and incubate in a metal bath at 100°C for 1 h. Add 75 µL of solution B and vortex to mix. Centrifuge at 13,000 × g for 15 min at 4°C. Collect the supernatant into a new sterile centrifuge tube for later use and perform the following genotype identification.

[0070] (1) Identification of UPRT flox / + genotype: Please refer to Example 1 for the specific method.

[0071] (2) Identification of Adipoq-Cre+ / - genotype: The PCR system for Adipoq-Cre+ / - genotype identification is: 2×Taq Plus Master Mix 10 μL, primers (transgenic primers, wild-type primers) 10 μM each (0.8 μL), genomic DNA 100 ng, add ddH2O to 20 μL. The sequence information of the identification primers (5'-3') is as follows: Transgenic primer-F: 5′- ACGGACAGAAGCATTTTCCA -3′ (SEQ ID NO. 8); Transgenic primer-R: 5′- GGATGTGCCATGTGAGTCTG -3′ (SEQ ID NO. 9); Wild-type primer-F: 5′- CTAGGCCACAGAATTGAAAGATCT -3′ (SEQ ID NO. 10); Wild-type primer-R: 5′-GTAGGTGGAAATTCTAGCATCATCC-3′ (SEQ ID NO. 11).

[0072] Reaction conditions: 94℃ 3 minutes; 94℃ 30 seconds, 60℃ 30 seconds, 72℃ 1 minute; 72℃ 5 minutes, the number of cycles is 35. The amplified product was subjected to agarose gel electrophoresis, and the identification results are shown in Figure 6 As shown, heterozygous (Adipoq-Cre + / -) had two bands of 200 bp and 324 bp, while the wild type had only a single band of 324 bp, which was consistent with expectations.

[0073] After PCR identification, the screening genotype was UPRT flox / + Adipoq-Cre + / - The liver of mice was further verified by Western Blot. The results are as follows Figure 7 As shown, the results were consistent with expectations, and the corresponding mice were then used as test mice for subsequent experiments.

[0074] 3. 4-TU solution injection and plasma exosome RNA extraction, labeling and sequencing analysis The nascent RNA labeling and sequencing methods of adipose exosomes in the adipose-specific expression UPRT mouse model of this embodiment are specifically referred to the above-mentioned Example 1, and the RNA labeling results show that it can obtain a labeling effect equivalent to that of Example 1.

[0075] The above is a detailed description of the embodiments of the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A method for labeling nascent RNA in exosomes, characterized in that: The following steps are involved: S1. constructing an animal model with tissue-specific expression of uracil phosphoribosyltransferase, and then administering 4-thiouracil solution; S2, collecting plasma exosomes and extracting exosome RNA, and then removing ribosomal RNA from the exosome RNA to obtain transcriptome RNA; S3, performing thiol-specific biotinylation treatment on the transcriptome RNA, and then collecting the biotinylated RNA and performing RNA alkylation treatment; Wherein, the method for labeling nascent RNA in exosomes is used for non-disease diagnosis purposes.

2. The method for labeling nascent RNA in exosomes according to claim 1, characterized in that: In step S1, the method for constructing an animal model for tissue-specific expression of uracil phosphoribosyltransferase comprises: Using Cre-loxP technology, a transgenic animal expressing uracil phosphoribosyltransferase is hybridized with a transgenic animal expressing Cre enzyme specifically in tissues, and an animal model that specifically expresses the uracil phosphoribosyltransferase in tissues is screened; Preferably, the tissue comprises liver or fat; Preferably, the animal comprises a mouse.

3. The method for labeling nascent RNA in exosomes according to claim 1, characterized in that: In step S1, the concentration of the 4-thiouracil solution is 40-60 mg / mL.

4. The method for labeling nascent RNA in exosomes according to claim 3, characterized in that: The solvent of the 4-thiouracil solution is corn oil and / or dimethyl sulfoxide; Preferably, the dosage of administration is 300-500 mg / kg.

5. The method for labeling nascent RNA in exosomes according to claim 1, characterized in that: In step S2, the method for removing ribosomal RNA in the exosomal RNA is magnetic bead separation method.

6. The method for labeling nascent RNA in exosomes according to claim 1, characterized in that: In step S3, the thiol-specific biotinylation treatment comprises: adding a thiol-specific biotinylation reagent to the transcriptome RNA, incubating, and washing; Preferably, the thiol-specific biotinylation reagent is selected from at least one of biotin-HPDP, SPDP-Biotin, PDEA-Biotin, and Sulfo-NHS-SS-Biotin.

7. The method for labeling nascent RNA in exosomes according to claim 1, characterized in that: In step S3, the method for collecting biotinylated RNA includes a streptavidin magnetic bead separation method; Preferably, the streptavidin magnetic bead separation method is to contact the mixed solution after the thiol-specific biotinylation treatment with streptavidin magnetic beads to react and remove the non-biotinylated RNA.

8. The method for labeling nascent RNA in exosomes according to claim 1, characterized in that: In step S3, the RNA alkylation treatment specifically includes: mixing the biotinylated RNA with an alkylation agent in a solvent, reacting, and washing; Preferably, the solvent is selected from sodium phosphate buffer and / or dimethyl sulfoxide; Preferably, the alkylating agent is selected from at least one of iodoacetamide, N-ethylmaleimide, methylthiomethanesulfonate and iodoacetic acid.

9. A method for sequencing and analyzing nascent RNA in exosomes, characterized in that: The nascent RNA is labeled using the method for labeling nascent RNA in exosomes as described in any one of claims 1 to 8, and then subjected to SLAM sequencing analysis.

10. Use of the method for labeling nascent RNA in exosomes according to any one of claims 1 to 8 in screening diagnostic markers for metabolic diseases.

Images