Primer design method for nucleic acid amplification

Abstract

The invention relates to the field of PCR (polymerase chain reaction) amplification, in particular to a primer design method for nucleic acid amplification, which comprises the following steps: S101, designing a first forward primer and a first reverse primer; s102, the annealing temperature of the first forward primer and the annealing temperature of the first reverse primer are calculated; respectively adding a first interface sequence and a second interface sequence to the 5'end of the first forward primer and the 5 'end of the first reverse primer to form a second forward primer and a second reverse primer, and enabling the annealing temperatures of the second forward primer and the second reverse primer to reach 66-82 DEG C; the cytosine content in the first interface sequence and the second interface sequence is at least 50%. Compared with primers with the same or similar annealing temperature designed by other schemes, the primer sequence obtained by the invention can efficiently and specifically amplify a target nucleic acid fragment.

Description

Priority application

[0001] This application claims priority to Chinese invention patent application CN2023112607122 “A method for designing primers for nucleic acid amplification” filed on September 27, 2023, which is incorporated by reference in its entirety. Technical Field

[0002] The invention relates to the field of PCR amplification, and in particular to a primer design method for nucleic acid amplification. Background Art

[0003] PCR (polymerase chain reaction) is an extremely important tool in molecular biology research. PCR amplification needs to be performed on a PCR instrument. The PCR amplification process uses different temperatures to achieve the melting of nucleic acid templates (i.e. denaturation, usually 95°C), primer binding (i.e. annealing, usually 60°C) and extension. There are two commonly used modes for controlling different temperatures:

[0004] The first method: using Peltier to heat up and cool down. The PCR instrument using this principle has a simple structure and strong stability, so it is widely used in laboratories around the world. However, the use of Peltier for temperature control (such as heating and cooling) makes the PCR amplification time longer. Taking the mainstream model 7500 of Applied Biosystems (ABI) commonly used in the market as an example, the running time is as follows (min: minutes; s: seconds):

[0005] As shown in the table above, in the actual operating time of the PCR instrument based on Peltier heating and cooling, at least 50% of the time is spent on heating and cooling. In addition, the heating and cooling efficiency of PCR instruments manufactured by some domestic companies is lower than that of ABI 7500. It takes 87 minutes for a domestic PCR instrument to complete the program in the table above. In other words, it even takes about 65% of the time to heat up and cool down. Therefore, PCR instruments based on Peltier heating and cooling are often considered unsuitable for rapid diagnosis, such as point-of-care testing (POCT).

[0006] The second method: raising and lowering the temperature through an air bath. PCR instruments using this method can use different PCR tube forms, such as the Roche LightCycler capillary heating method; or superimpose centrifugal force and other action methods on this basis to form a POCT test cartridge with sample input and result output, such as a centrifugal disc test cartridge.

[0007] The PCR instrument based on air bath temperature control can quickly raise or lower the ambient temperature around the reaction solution. However, the PCR tube or cartridge is generally made of polypropylene, which is low-cost, easy to form, has good light transmittance, and strong anti-extrusion ability. The poor thermal conductivity of polypropylene (the thermal conductivity coefficient of polypropylene is 0.22W / mK, which is lower than water (0.5-0.7W / mK) and much lower than pure aluminum (237W / mK)) limits the efficiency of thermal conduction between the reaction solution and the environment, which in turn leads to a long time for heating and cooling during the actual PCR amplification process of the PCR instrument based on air bath temperature control. Therefore, the PCR instrument based on air bath temperature control is also considered unsuitable for rapid diagnosis.

[0008] In order to shorten the time required for PCR amplification, Chinese patent application CN103608467A discloses a method for amplifying a template of a nucleic acid target sequence contained in a sample, which is mainly achieved by a special "passive-cooling device", but the method requires the addition of a specific concentration of a nucleic acid destabilizer to reduce the denaturation temperature. Chinese patent application CN104662160A discloses a method for amplifying a target nucleic acid sequence in a biological sample containing eukaryotic genomic DNA during amplification, but the method is also mainly achieved by a PCR instrument capable of achieving a ramp rate of at least 200°C / s. In other words, the prior art for shortening the PCR time is often achieved by changing the hardware conditions of the PCR instrument (which can also be understood as choosing not to heat up and cool down based on Peltier or air bath). At present, in China, there are already a large number of PCR instruments based on Peltier for heating and cooling in laboratories in multiple fields such as medicine and agriculture. Shortening the time of PCR amplification without changing the most popular PCR instrument and without replacing commonly used industrial materials such as cartridges for air bath temperature control is the bottleneck of current PCR technology. Summary of the invention

[0009] In a first aspect, the present invention provides a method for designing primers with a high annealing temperature, characterized in that the method comprises:

[0010] S101, designing a first forward primer and a first reverse primer according to the target nucleic acid fragment, wherein the first forward primer and the first reverse primer specifically bind to the target nucleic acid fragment and the length of the first forward primer and the first reverse primer is a first length;

[0011] S102 calculates the annealing temperature of the first forward primer and the first reverse primer, and when the annealing temperature of the first forward primer and the first reverse primer is less than 66° C., adds a first interface sequence and a second interface sequence to the 5′ end of the first forward primer and the first reverse primer, respectively, to form a second forward primer and a second reverse primer (e.g., Figure 1AAs shown), the annealing temperature of the second forward primer and the second reverse primer reaches 66-82° C., and the length of the first interface sequence and / or the second interface sequence is the second length;

[0012] The first length includes 15-30 bases, the second length is at most 50% of the first length; and the cytosine content in the first interface sequence and the second interface sequence is at least 50%.

[0013] In some embodiments, the cytosine content in the first interface sequence and the second interface sequence may be 50%, 60%, 70%, 80%, 90% or 100%.

[0014] In some embodiments, the guanine content in the first interface sequence and the second interface sequence is at most 50%.

[0015] In some embodiments, the cytosine content in the first interface sequence and the second interface sequence may be 0, 10%, 20%, 30%, 40% or 50%.

[0016] In some embodiments, the second forward primer and / or the second reverse primer is at most 40 bases in length.

[0017] In some embodiments, the first interface sequence and the second interface sequence are not complementary to the target nucleic acid fragment.

[0018] In some embodiments, the first interface sequence and the second interface sequence are not complementary to a second length of sequence upstream of the 5' end and / or downstream of the 3' end of the target nucleic acid fragment.

[0019] In some embodiments, in the first interface sequence and / or the second interface sequence, guanine or cytosine is used to completely or partially replace adenine, thymine or uracil in the second length sequence upstream of the 5' end and / or downstream of the 3' end of the corresponding target nucleic acid fragment.

[0020] In some embodiments, based on the principle of non-complementarity between primers, in the first interface sequence and / or the second interface sequence, guanine is partially or completely substituted for the cytosine in the second length sequence upstream of the 5' end and / or downstream of the 3' end of the corresponding target nucleic acid fragment.

[0021] In some embodiments, in the first interface sequence and / or the second interface sequence, guanine in the second length of sequence upstream of the 5' end and / or downstream of the 3' end of the corresponding target nucleic acid fragment is partially or completely replaced by cytosine.

[0022] In some embodiments, when the second length is greater than 2 bases, the first interface sequence and / or the second interface sequence may include a repeat of two cytosines.

[0023] In a second aspect, the present invention provides a method for amplifying a target nucleic acid fragment in a sample, characterized in that the method comprises using the second forward primer and / or the second reverse primer designed by the above method to perform PCR amplification, wherein the PCR amplification comprises a first amplification stage and a second amplification stage (such as Figure 1B shown);

[0024] Wherein, the first amplification stage includes contacting the sample with the second forward primer and / or the second reverse primer and amplifying under first amplification conditions to obtain a first amplification product; the second amplification stage includes using the first amplification product as a template and amplifying under second amplification conditions to obtain a second amplification product, and the second amplification conditions include a denaturation temperature of at least 85°C, an annealing temperature of 66-82°C, and a number of cycles of 15-50 in each cycle.

[0025] In some embodiments, the PCR amplification step is performed on a PCR instrument that heats and cools based on Peltier or a PCR instrument that heats and cools in an air bath.

[0026] In some embodiments, the first amplification conditions include a denaturation temperature of at least 90°C and an annealing temperature of 55-65°C in each cycle.

[0027] In some embodiments, the first amplification conditions include a denaturation temperature in each cycle comprising 90-99°C.

[0028] In some embodiments, the difference between the denaturation temperature and the annealing temperature in each cycle of the second amplification condition comprises 8-30°C.

[0029] In some embodiments, the difference between the denaturation temperature and the annealing temperature in each cycle of the second amplification condition comprises 8-15°C.

[0030] In some embodiments, the number of cycles in the first amplification condition comprises 3-15.

[0031] In some embodiments, the PCR amplification system further comprises a probe.

[0032] In some embodiments, the annealing temperature of the second amplification condition differs from the annealing temperature of the first amplification condition by at least 5°C.

[0033] In some embodiments, the annealing time of each cycle in the second amplification condition is ≤30s.

[0034] In some embodiments, the first amplification product includes the first interface sequence, the target nucleic acid fragment, and the second interface sequence from the 5' end to the 3' end.

[0035] In some embodiments, when the target nucleic acid fragment is RNA, the PCR amplification step further includes a step of reverse transcribing the target nucleic acid fragment.

[0036] Beneficial technical effects

[0037] The present invention provides a method for designing primers with a high annealing temperature. By adding an interface sequence of a specific length (i.e., ≤50% of the specific primer sequence) and a specific component (i.e., cytosine content ≥50%) to the 5' end of the specific primer sequence, the overall length of the primer can be kept short (e.g., less than 40 bases) while the annealing temperature is efficiently increased without being restricted by a specific nucleic acid template (e.g., conserved regions of pathogens, GC content). The prior art believes that the contribution of cytosine and guanine to the annealing temperature is similar. Unexpectedly, the present invention has demonstrated through experiments in Examples 1 to 5 and 9 that, compared with primers with the same or similar annealing temperatures designed by other schemes (e.g., Examples 6 to 8), by controlling the length of the interface sequence of the primer to be within 50% of the length of the specific primer sequence, and ensuring that the cytosine content of the interface sequence is controlled to be above 50%, the obtained primer sequence can efficiently and specifically amplify the target nucleic acid fragment without being affected by factors such as the distribution of cytosine and the guanine content in the interface sequence, and will not cause the problem that the higher annealing temperature of the primer often leads to non-specific binding of the primer, which is often believed in the prior art.

[0038] In addition, the present invention finds that the high annealing temperature primer designed by the present invention is combined with the two-stage PCR amplification reaction provided by the present invention, and it is possible to achieve rapid and specific amplification of the target nucleic acid fragment without changing the hardware conditions of the PCR instrument, without adding specific reagents (such as nucleic acid destabilizers) to the reaction system, and even without extending the length of the primer (for example, extending to more than 45 bases). The PCR instrument based on Peltier heating and cooling or the PCR instrument that heats and cools in an air bath can achieve rapid and specific amplification of the target nucleic acid fragment. The high annealing temperature primer designed by the present invention can successfully reduce the temperature difference of denaturation-annealing in the second amplification stage in the above-mentioned two-stage PCR amplification reaction, not only the amplification effect of the target nucleic acid fragment is high, but also the actual running time of the PCR instrument is significantly shortened, and the amplification efficiency of the PCR instrument is improved, so that the specific application scenarios of the PCR instrument based on Peltier heating and cooling or the PCR instrument that heats and cools in an air bath are expanded to rapid diagnosis, such as POCT detection, outpatient clinics, emergency departments, ports or other scenes where test results need to be obtained quickly.

[0039] It should also be emphasized that the primers designed by the method provided by the present invention and the PCR amplification method are suitable for detecting target nucleic acid fragments from various sources, and are suitable for rapid detection of target nucleic acid fragments from various sources.

[0040] As used herein, "nucleic acid" refers to DNA, RNA or DNA / RNA hybrid molecules in single-stranded or double-stranded form. In certain embodiments, nucleic acid samples can be separated from cells or viruses. In certain embodiments, nucleic acid samples can include chromosomal DNA, plasmid DNA, recombinant DNA, messenger RNA, ribosomal RNA, transfer RNA, double-stranded RNA or other RNA present in cells or viruses. The source of nucleic acid includes biological sources (such as body fluid samples, including urine, blood, serum, plasma, lymph, cyst fluid, pleural fluid, ascites fluid, peritoneal fluid, amniotic fluid, epididymal fluid, cerebrospinal fluid, bronchoalveolar lavage fluid, breast milk, tears, saliva, sputum, nasal or lung aspirates, tissue samples or cells) and non-biological sources (such as drinking water, seawater, river water and reagents for laboratory tests).

[0041] As used herein, "target nucleic acid" or "template nucleic acid" refers to a single-stranded or double-stranded DNA or RNA fragment or sequence that is desired to be selectively amplified. The target nucleic acid can be a fragment contained in a longer double-stranded or single-stranded nucleic acid or can be an entire double-stranded or single-stranded nucleic acid.

[0042] As used herein, "denaturation" refers to the use of high temperature to dissociate all or part of the two complementary strands of a nucleic acid duplex. As used herein, "annealing" refers to the sequence-specific binding of a primer to a single-stranded nucleic acid template. A primer may bind only to its complementary sequence on one template strand and not to other regions of the template.

[0043] As used herein, "primer" refers to a single-stranded nucleic acid or oligonucleotide that can bind to a single-stranded region on a target nucleic acid in a sequence-specific manner, which allows replication of the target nucleic acid that depends on a polymerase. In certain embodiments, the target nucleic acid can be a double-stranded nucleic acid such as double-stranded DNA, or a single-stranded nucleic acid such as single-stranded RNA or DNA. If the target nucleic acid is double-stranded, it can be denatured by heating or using an enzyme to form a single-stranded template or template region required for DNA polymerase activity and amplification. The present invention has no specific restrictions on the length of the target nucleic acid. In certain embodiments, the length of the target nucleic acid is less than 1000bp, for example, less than 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100bp.

[0044] In some embodiments, the primers for nucleic acid amplification include forward primers and reverse primers. In some embodiments, the forward primer includes a first interface sequence and a first forward primer, and the reverse primer includes a second interface sequence and a first reverse primer, wherein the first forward primer and the first reverse primer can specifically bind to the target nucleic acid (including complete complementarity or substantial complementarity), and the first interface sequence and the second interface sequence are not complementary to the target nucleic acid and the first interface sequence and the second interface sequence are not complementary. In some embodiments, the first interface sequence and / or the second interface sequence are not complementary to the upstream and / or downstream of the target nucleic acid. The general understanding of "non-complementary" in the present invention is that it is completely non-complementary, unless otherwise stated. In some embodiments, the length of the forward primer and the reverse primer is ≤40 bases. In some embodiments, the length (i.e., the first length) of the first forward primer and / or the first reverse primer is ≤30 bases. The present invention has no restrictive requirements on the specific sequence of the interface sequence, as long as the length of the first interface sequence and the second interface sequence (i.e., the second length) is ≤ 50% of the first length, the content of cytosine is at least 50%, and the Tm values ​​of the forward primer and the reverse primer are in the range of 66-82°C. In some embodiments, the second length of the first interface sequence and the second length of the second interface sequence may be the same or different. In some embodiments, the content of guanine in the first interface sequence and the second interface sequence may be 0-50%.

[0045] As used herein, "amplification reaction mixture" refers to the material conditions required for PCR amplification reaction, such as buffer, Mg 2+ , enzymes, dNTPs, etc. In some embodiments, the amplification reaction mixture also includes a probe.

[0046] It should be noted that in the present invention, when describing the annealing temperature of a "primer", the specific annealing temperature of a specific primer refers to the theoretical Tm value corresponding to the specific sequence of the specific primer, and the theoretical Tm value can be obtained by primer design software known in the art, such as Primer-BLAST, Primer3, Primer Premier5, OLIGO, etc. When describing the "denaturation temperature" and "annealing temperature" of the "amplification conditions" in the PCR amplification step, the specific denaturation temperature and / or annealing temperature of the specific amplification conditions refers to the setting value in the PCR instrument. In some embodiments, the "annealing temperature" of the "amplification conditions" is approximately the annealing temperature of the "primer".

[0047] As used herein, Peltier (also known as cooling sheet, semiconductor cooling sheet, thermoelectric semiconductor cooling component) refers to a type of temperature control method based on keeping the PCR temperature control module stationary for heating and cooling.

[0048] As used herein, an air bath refers to a temperature control method that heats the air to increase the temperature and removes the heated air to reduce the temperature.

[0049] As used herein, qPCR is the abbreviation of Quantitative Real-time PCR, which is a method for measuring the total amount of products after each polymerase chain reaction (PCR) cycle using fluorescent chemicals in a DNA amplification reaction. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings required for use in the embodiments or the prior art descriptions are briefly introduced below. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, each element or part is not necessarily drawn according to the actual scale. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can also be obtained based on these drawings without paying creative labor.

[0051] Figure 1A is a schematic structural diagram of the second forward primer and the second reverse primer of the present invention;

[0052] Figure 1B A schematic diagram of the first amplification stage and the second amplification stage of the present invention;

[0053] Figure 2 This is a graph showing the qPCR results of influenza B virus in Example 1;

[0054] Figure 3 This is a graph showing the qPCR results of adenovirus in Example 2;

[0055] Figure 4 This is the electrophoresis verification diagram of the amplified product of β-actin gene in Example 3;

[0056] Figure 5 This is an electrophoresis verification diagram of the amplified product of respiratory syncytial virus in Example 4;

[0057] Figure 6 The novel coronavirus (10 5 copies / mL)+β-actin qPCR result diagram;

[0058] Figure 7 This is an electrophoresis verification diagram of the amplified product of the parainfluenza virus in Example 6;

[0059] Figure 8 This is a graph showing the qPCR results of influenza B virus in Example 7;

[0060] Fig. 9 This is a graph showing the qPCR results of adenovirus in Example 8;

[0061] Fig.10 This is a fluorescence amplification curve diagram of the combined detection of influenza A virus, influenza B virus, and respiratory syncytial virus in Example 9. DETAILED DESCRIPTION

[0062] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0063] In this document, the directions or positional relationships indicated by the terms "upper", "lower", "inner", "outer", "front", "rear", "one end", "the other end", etc. are based on the directions or positional relationships shown in the drawings, and are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the devices or elements referred to must have a specific direction, be constructed and operate in a specific direction, and therefore cannot be understood as limiting the present invention. In addition, the terms "first" and "second" are used for descriptive purposes only and cannot be understood as indicating or implying relative importance.

[0064] Herein "and / or" includes any and all combinations of one or more of the associated listed items.

[0065] Herein, "plurality" means two or more than two, ie, it includes two, three, four, five, etc.

[0066] It should be noted that, in this article, the terms "include", "comprises" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, an element defined by the sentence "comprises a ..." does not exclude the existence of other identical elements in the process, method, article or device including the element.

[0067] As used in this specification, the term "about" is typically expressed as + / -5% of the value, more typically + / -4% of the value, more typically + / -3% of the value, more typically + / -2% of the value, even more typically + / -1% of the value, even more typically + / -0.5% of the value. In some specific embodiments, the "annealing temperature" of the "amplification conditions" is + / -5% of the annealing temperature of the "primer", more typically + / -4% of the annealing temperature of the "primer", more typically + / -3% of the annealing temperature of the "primer", more typically + / -2% of the annealing temperature of the "primer", even more typically + / -1% of the annealing temperature of the "primer", even more typically + / -0.5% of the annealing temperature of the "primer".

[0068] In this specification, certain embodiments may be disclosed in a format of being in a certain range. It should be understood that such description of "being in a certain range" is merely for convenience and brevity, and should not be interpreted as a rigid limitation on the disclosed range. Therefore, the description of the range should be considered to have specifically disclosed all possible sub-ranges and independent numerical values ​​within this range. For example, the description of the range 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as individual numbers within this range, such as 1, 2, 3, 4, 5 and 6. Regardless of the breadth of the range, the above rules apply.

[0069] Example 1: Amplification of influenza B virus nucleic acid

[0070] Target nucleic acid: influenza B virus (AACATGACCACAACACAAATTGAGGTAGGTCCGGGAGCAACCAATGCCACCATAAAC TTTGAAGCAGGAATTCTGGAGTGCTATGAAAGGCTTTCATGGCAAAGA, SEQ ID NO: 23);

[0071] Target nucleic acid type: virus;

[0072] Target nucleic acid length: about 105 bp;

[0073] The sequence information used in this example is: Note: The underlined capital letters in the primer sequence represent the interface sequence, and the ordinary capital letters represent the sequence that binds to the target nucleic acid (i.e., the specific primer sequence). Tm represents the Tm value of the entire primer sequence (or probe sequence), L1 represents the length of the specific primer sequence in the primer sequence, L2 represents the length of the interface sequence in the primer sequence, L2 / L1 represents the ratio of the length of the interface sequence to the length of the specific primer sequence, L2 C represents the content of C (cytosine) in the interface sequence, and L2 G represents the content of G (guanine) in the interface sequence, the same below.

[0074] Amplification system: Serial number name Final concentration 1 Primer F1 200mM 2 Primer R1 200mM 3 Promega: TaqMan Fast Virus One-Step Master Mix 1× 4 Probe P1 150mM Note: Nucleic acid source: RNA extracted from influenza B virus culture medium, culture medium concentration 1×10 6 copies / mL, 1×10 5 copies / mL, and two PCR reactions were tested each.

[0075] PCR instrument: ABIQ5

[0076] In this embodiment, PCR amplification is performed according to the above amplification system according to the following procedure:

[0077] The first amplification stage: 50°C for 120 seconds, 95°C for 5 seconds, 1 cycle; 92°C for 1 second, 60°C for 10 seconds, 5 cycles;

[0078] The second amplification stage: 92°C for 1 second, 70°C for 10 seconds (collecting fluorescence), for 40 cycles.

[0079] Figure 2 The amplification curve of one PCR reaction tube detecting one target is shown. Two samples of different concentrations are detected, and two reactions are detected for each sample. The two S-shaped amplification curves on the left (the presence of an S-shaped amplification curve indicates that the pathogen corresponding to the primer probe can be detected in the sample. The closer the S-shaped curve is to the front, the greater the concentration of the pathogen in the sample) are 1×10 6 copies / mL influenza B virus amplification curve. The two S-shaped amplification curves on the right are 1×10 5 copies / mL influenza B virus amplification curve. The experimental results are as follows Figure 2 As shown, this embodiment successfully amplified influenza B virus nucleic acid by using primers containing an interface sequence (wherein L2 / L1 of primer F1 and primer R1 is <30% and the cytosine content in the interface sequence of primer F1 and primer R1 is 50.0% and the guanine content is 0) and two amplification stages of PCR reaction. The qPCR results further show that this embodiment can reduce the actual running time to 27 minutes while maintaining a high level of detection sensitivity.

[0080] Example 2: Amplification of adenovirus nucleic acid

[0081] Target nucleic acid: Adenovirus (TGTGCTAACTTTGGAGAGTTCGTCTTCGCAGCCCCGCTCAGGCGGCATTGGAACTCTCCAGTTTGTGGAGGAGTTTACTCCCTCTGTCTACTTTAACCCCTTCTCCG, SEQ ID NO: 24);

[0082] Target nucleic acid type: virus;

[0083] Target nucleic acid length: approximately 107 bp;

[0084] The sequence information used in this example is:

[0085] Amplification system: Serial number name Final concentration 1 Primer F2 200mM 2 Primer R2 200mM 3 Promega: TaqMan Fast Virus One-Step Master Mix 1× 4 Probe P2 150mM Note: Sample source: DNA extracted from adenovirus culture medium, virus culture medium concentration: 1×10 5 copies / mL, 1×10 4 One PCR reaction was tested for each copy / mL.

[0086] PCR instrument: Biori 96

[0087] In this embodiment, PCR amplification is performed according to the above amplification system according to the following procedure:

[0088] The first amplification stage: 98°C for 30 seconds, 1 cycle; 92°C for 1 second, 62°C for 10 seconds, 5 cycles;

[0089] The second amplification stage: 92°C for 1 second, 72°C for 10 seconds (collecting fluorescence), for 40 cycles.

[0090] Figure 3 The amplification curve of one PCR reaction tube detecting one target is shown. Two samples with different concentrations are tested, and one reaction is tested for each sample. The S-shaped amplification curve on the left is 1×10 5 copies / mL adenovirus amplification curve, the S-shaped amplification curve on the right is 1×10 4 copies / mL adenovirus amplification curve. The experimental results are as follows Figure 3As shown, this embodiment successfully amplified the adenovirus fragment by using primers containing an interface sequence (wherein L2 / L1 of primer F2 and primer R2 <20% and the interface sequence of primer F2 and primer R2 has a cytosine content of 75.0% and a guanine content of 0) and two amplification stages of PCR reaction. The qPCR results further showed that this embodiment can reduce the actual running time to 36 minutes while maintaining a high level of detection sensitivity.

[0091] Example 3: Amplification of β-actin

[0092] Target nucleic acid: β-actin (, SEQ ID NO: 25);

[0093] Target nucleic acid type: human gene;

[0094] Target nucleic acid length: approximately 742 bp;

[0095] The sequence information used in this example is:

[0096] Amplification system: Serial number name Final concentration 1 Primer F3 200mM 2 Primer R3 200mM 3 <![CDATA[Thermo Scientific TM DreamTaq TM DNA polymerase]]> 1× Note: Sample source: DNA (10ng) extracted from 293T cells.

[0097] PCR instrument: Hongshi 96P

[0098] In this embodiment, PCR amplification is performed according to the above amplification system according to the following procedure:

[0099] The first amplification stage: 95°C for 30 seconds, 1 cycle; 95°C for 5 seconds, 62°C for 60 seconds, 5 cycles;

[0100] The second amplification stage: 95°C for 5 seconds, 75°C for 60 seconds, for 30 cycles.

[0101] After PCR amplification is complete, the amplified product is visualized using ethidium bromide. Figure 4 As shown, an amplified product of about 742 bp can be clearly observed, which is consistent with the expected length. The above experiments show that this embodiment successfully amplified the β-actin gene sequence by using primers containing an interface sequence (wherein L2 / L1 of primer F3 and primer R3 is <30% and the cytosine content in the interface sequence of primer F3 and primer R3 is 100.0% and the guanine content is 0) and a PCR amplification reaction in two amplification stages, and the actual running time is only 63 minutes.

[0102] Example 4: Amplification of respiratory syncytial virus nucleic acid

[0103] Target nucleic acid: Respiratory syncytial virus (TAAGGAGAGACATAAGATGAAAGATGGGGCAAATACAAAAATGGCTCTTAGCAAAGTCAAGTTGAATGATACACTCAACAAAGATCA, SEQ ID NO: 26);

[0104] Target nucleic acid type: virus;

[0105] Target nucleic acid length: about 80 bp;

[0106] Primer information used in this example:

[0107] Amplification system: Serial number name Final concentration 1 Primer F4 200mM 2 Primer R4 200mM 3 <![CDATA[Thermo Scientific TM DreamTaq TM DNA polymerase]]> 1× Note: Sample source: RNA extracted from respiratory syncytial virus culture medium, culture medium concentration: 1×10 3 copies / mL.

[0108] PCR instrument: ABI 7500

[0109] In this embodiment, PCR amplification is performed according to the above amplification system according to the following procedure:

[0110] The first amplification stage: 50°C for 120 seconds, 95°C for 30 seconds, 1 cycle; 95°C for 1 second, 60°C for 30 seconds, 5 cycles;

[0111] The second amplification stage: 90°C for 5 seconds, 82°C for 30 seconds, for 35 cycles.

[0112] After PCR amplification is complete, the amplified product is visualized using ethidium bromide. Figure 5 As shown, an amplified product of about 110 bp can be clearly observed, which is consistent with the expected length. The above experiments show that this embodiment successfully amplifies respiratory syncytial virus nucleic acid by using primers containing interface sequences (wherein L2 / L1 of primer F4 and primer R4 is ≤50% and the cytosine content in the interface sequence of primer F4 and primer R4 is 53.8% and 61.5% respectively and the guanine content is 53.8% and 15.4% respectively) and two amplification stages of PCR reaction, and the actual running time is only 38 min.

[0113] Example 5: Amplification of novel coronavirus + β-actin

[0114] Target nucleic acid: SARS-CoV-2 and β-actin (SARS-CoV-2: GTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATC, SEQ ID NO: 27; β-actin: ACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGGATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGACGA, SEQ ID NO: 28);

[0115] Sequence information involved in this embodiment:

[0116] Amplification system: Serial number name Final concentration 1 Primer F5 200 mM 2 Primer R5 200mM 3 Promega: TaqMan Fast Virus One-Step Master Mix 1× 4 Primer F6 200mM 5 Primer R6 200mM 6 Probe P4 150mM 7 Probe P5 150mM Note: Sample source: Nucleic acid extracted from oropharyngeal swabs positive for novel coronavirus; Concentration: dilute the novel coronavirus in oropharyngeal swabs to 1×10 5 copies / mL and 250copies / mL, and tested after nucleic acid extraction.

[0117] Instrument used: Biori FQD-96C

[0118] In this example, the novel coronavirus is divided into 10 5 copies / mL and perform PCR amplification according to the above amplification system according to the following procedures:

[0119] The first amplification stage: 50°C for 120 seconds, 95°C for 30 seconds, 1 cycle; 95°C for 1 second, 60°C for 30 seconds, 5 cycles;

[0120] The second amplification stage: 95°C for 1 sec, 66°C for 15 sec, for 40 cycles.

[0121] Figure 6 This shows the amplification curves of two targets detected simultaneously in a PCR reaction tube. Of the two S-shaped amplification curves, the left one is 1×10 5 The amplification curve of the new coronavirus is shown in Figure 1, and the amplification curve of β-actin is shown on the right. Figure 6As shown, the qPCR results further show that this embodiment uses primers containing interface sequences (wherein L2 / L1 of primer F5 and primer R5 is <10%, and the cytosine content in the interface sequence of primer F5 and primer R5 is 100.0% and 50.0%, respectively, and the guanine content is 0 and 50.0%, respectively; L2 / L1 of primer F6 and primer R6 is <15%, and the cytosine content in the interface sequence of primer F6 and primer R6 is 50.0% and 66.7%, respectively, and the guanine content is 50.0% and 33.3%, respectively) and two amplification stages of PCR reaction, and is further verified by qPCR reaction, that this embodiment can reduce the actual running time to 48 minutes while maintaining a high level of detection sensitivity.

[0122] Example 6: Amplification of parainfluenza virus nucleic acid

[0123] Target nucleic acid: Parainfluenza virus (CCAAAAGTTCCACCGTCAAAGAACGAAGAGTCAGCAGCCACTCCAAAGAACAACAACCACAGAAAAACAAGATACACAAACAATGCAAACAACAACACAAAAAGTCCACCAACTCCCGAACACGACGCAACC, SEQ ID NO: 29);

[0124] Sequence information involved in this embodiment:

[0125] Amplification system: Serial number name Final concentration 1 Primer F7 200mM 2 Primer R7 200mM 3 Promega: TaqMan Fast Virus One-Step Master Mix 1× Note: Sample source: RNA extracted from parainfluenza virus culture medium, culture medium concentration: 10 4 copies / mL.

[0126] Instrument used: ABI7500

[0127] In this embodiment, PCR amplification is performed according to the above amplification system according to the following procedure:

[0128] The first amplification stage: 50°C for 120 seconds, 95°C for 30 seconds, 1 cycle; 95°C for 5 seconds, 56°C for 30 seconds, 5 cycles;

[0129] The second amplification stage: 95°C for 5 seconds, 80°C for 30 seconds, 40 cycles.

[0130] The experimental results are as follows Figure 7 As shown, when the length L2 of the interface sequence in the primer sequence (primer F7 and primer R7) is greater than 50% of the specific primer sequence L1, amplification fails and no band is observed in electrophoresis.

[0131] Example 7: Amplification of influenza B virus nucleic acid

[0132] Target nucleic acid: Influenza B virus (AACATGACCACAACACAAATTGAGGTAGGTCCGGGAGCAACCAATGCCACCATAAACTTTGAAGCAGGAATTCTGGAGTGCTATGAAAGGCTTTCATGGCAAAGA, SEQ ID NO: 23);

[0133] Target nucleic acid type: virus;

[0134] The sequence information used in this example is: Note: The difference between F8 and R8 of this embodiment and F1 and R1 of the first embodiment is only L2.

[0135] Amplification system: Note: Nucleic acid source: RNA extracted from influenza B virus culture medium, culture medium concentration 1×10 6 copies / mL, 1×10 5 copies / mL, and two PCR reactions were tested each.

[0136] PCR instrument: ABIQ5

[0137] In this embodiment, PCR amplification is performed according to the above amplification system according to the following procedure:

[0138] The first amplification stage: 50°C for 120 seconds, 95°C for 5 seconds, 1 cycle; 92°C for 1 second, 60°C for 10 seconds, 5 cycles;

[0139] The second amplification stage: 92°C for 1 second, 70°C for 10 seconds (collecting fluorescence), for 40 cycles.

[0140] Figure 8 The figure shows the amplification curve of one PCR reaction tube detecting one target. Two samples of different concentrations were tested, and two reactions were tested for each sample. The two S-shaped amplification curves on the left are 1×10 6 copies / mL influenza B virus amplification curve. The two S-shaped amplification curves on the right are 1×10 5 copies / mL influenza B virus amplification curve. The experimental results are as follows Figure 8As shown, although the influenza B virus fragment was successfully amplified in this example, the qPCR results showed that when the content of cytosine in the interface sequence of primers F8 and R8 was less than 50%, the amplification effect was significantly weaker than that of F1 and R1 in Example 1.

[0141] Example 8: Amplification of adenovirus nucleic acid

[0142] Target nucleic acid: Adenovirus (TGTGCTAACTTTGGAGAGTTCGTCTTCGCAGCCCCGCTCAGGCGGCATTGGAACTCTCCAGTTTGTGGAGGAGTTTACTCCCTCTGTCTACTTTAACCCCTTCTCCG, SEQ ID NO: 24);

[0143] Target nucleic acid type: virus;

[0144] The sequence information used in this example is:

[0145] Amplification system: Serial number name Final concentration 1 Primer F9 200mM 2 Primer R9 200mM 3 Promega: TaqMan Fast Virus One-Step Master Mix 1× 4 Probe P2 150mM Note: Sample source: DNA extracted from adenovirus culture medium, virus culture medium concentration: 1×10 5 copies / mL, 1×10 4 One PCR reaction was tested for each copy / mL.

[0146] PCR instrument: Biori 96

[0147] In this embodiment, PCR amplification is performed according to the above amplification system according to the following procedure:

[0148] The first amplification stage: 98°C for 30 seconds, 1 cycle; 92°C for 1 second, 62°C for 10 seconds, 5 cycles;

[0149] The second amplification stage: 92°C for 1 second, 72°C for 10 seconds (collecting fluorescence), for 40 cycles.

[0150] Fig. 9 The amplification curve of one PCR reaction tube detecting one target is shown. Two samples with different concentrations are tested, and one reaction is tested for each sample. The S-shaped amplification curve on the left is 1×10 5 copies / mL adenovirus amplification curve, the S-shaped amplification curve on the right is 1×10 4 copies / mL adenovirus amplification curve. The experimental results are as follows Fig. 9As shown, although the adenovirus fragment was successfully amplified in this example, the qPCR results showed that when the cytosine content in primers F9 and primers R9 was less than 50%, even if the guanine content was greater than 50%, the amplification effect was still significantly weaker than that of F2 and R2 in Example 2.

[0151] Example 9: Amplification of multiple viral nucleic acids

[0152] Target nucleic acid: influenza A virus (abbreviated as: influenza A, GAGAACAGAATGGTTTTGGCCAGCACTACAGCTAAGGCTATGGAGCAAATGGCTGGATCAAGTGAGCAGGCAGCGGAGGCCATGGAGATTGCTAGTCAGGCCAGGCAGATGGTGCAGGCAATGAGAGCCATTGGGACTCATCCTAGTTCCAGTAC, SEQ ID NO: 30), influenza B virus (abbreviated as: influenza B, TCTGCTGGAATTGAAGGGTTTGAGCCATACTGTATGAAAAATTCCTCAAATAGCAACTGTCCAAACTGCAATTGGACCGATTACCCTCCAACACCAGGAAA, SEQ ID NO: 31), respiratory syncytial virus (abbreviated as: syncytial, CACAAAACCAAAGGAAGTACTCACTACCAAGCCTACAGGAAAGTCAACCATCAACACCACTAAAACAAACATCAGAACTACACTGCTCACCTCCAACACCAAAGGAAATCCAGAACA, SEQ ID NO:32) and RNaseP (CTGCGCGGACTTGTGGAGACAGCCGCTCACCTTGGCTATTCAGTTGTTGCTATCAATCATATCGTTGACTTTAAGGAAAAGAAACAGGAAATTGAAAAACCAGTAGCTGTTTCTGAACTCTT, SEQ ID NO:33)

[0153] Sequence information involved in this embodiment:

[0154] Amplification system 1: Serial number name Final concentration 1 Primer F10 200mM 2 Primer R10 200mM 3 Promega: TaqMan Fast Virus One-Step Master Mix 1× 4 Probe P3 150mM 5 Primer F13 200mM 6 Primer R13 200mM 7 Probe P8 150mM Note: Sample source: RNA extracted from throat swabs of people who were positive for influenza A virus.

[0155] Amplification system 2: Serial number name Final concentration 1 Primer F11 200mM 2 Primer R11 200mM 3 Promega: TaqMan Fast Virus One-Step Master Mix 1× 4 Probe P6 150mM 5 Primer F13 200mM 6 Primer R13 200mM 7 Probe P8 150mM Note: Sample source: RNA extracted from throat swabs of people who tested positive for influenza B virus.

[0156] Amplification system 3: Serial number name Final concentration 1 Primer F12 200mM 2 Primer R12 200mM 3 Promega: TaqMan Fast Virus One-Step Master Mix 1× 4 Probe P7 150mM 5 Primer F13 200mM 6 Primer R13 200mM 7 Probe P8 150mM Note: Sample source: RNA extracted from throat swabs of people positive for respiratory syncytial virus.

[0157] Instrument used: Centrifugal air bath temperature controlled qPCR instrument

[0158] In this example, after extracting nucleic acid from influenza A virus-positive throat swabs, influenza B virus-positive throat swabs, and respiratory syncytial virus-positive throat swabs, PCR amplification was performed according to the above-mentioned amplification system and the following procedures:

[0159] The first amplification stage: 50°C for 120 seconds, 95°C for 30 seconds, 1 cycle; 95°C for 1 second, 60°C for 30 seconds, 5 cycles;

[0160] The second amplification stage: 90°C for 5 seconds, 70°C for 20 seconds (collecting fluorescence), for 45 cycles.

[0161] The experimental results are as follows Fig.10 As shown, Fig.10The amplification curves of detecting one pathogen + RNaseP (internal standard) in three independent PCR reaction tubes on one PCR reaction plate are shown, from left to right: influenza A virus nucleic acid amplification curve, respiratory syncytial virus nucleic acid amplification curve, influenza B virus nucleic acid amplification curve, internal standard amplification curve in respiratory syncytial virus-positive samples, internal standard amplification curve in influenza A virus-positive samples, and internal standard amplification curve in influenza B virus-positive samples. In this embodiment, primers containing interface sequences are used (wherein the L2 / L1 of primer F10 and primer R10 is less than 20%, and the cytosine content of the interface sequence of primer F10 and primer R10 is 50.0% and 100.0%, and the guanine content is 25.0% and 0, respectively; the L2 / L1 of primer F11 and primer R11 is less than 30%, and the cytosine content of the interface sequence of primer F11 and primer R11 is 60.0% and 50.0%, and the guanine content is 20.0% and 16.7%, respectively; the L2 / L1 of primer F12 and primer R12 is less than 30%, and the cytosine content of the interface sequence of primer F12 and primer R12 is less than 20%. The cytosine content in the interface sequence of primers F13 and primer R13 was 50.0% and 60.0%, and the guanine content was 25.0% and 20.0%, respectively; L2 / L1 of primer F13 and primer R13 was <30%, and the cytosine content in the interface sequence of primers F13 and primer R13 was 50.0% and 60.0%, and the guanine content was 25.0% and 20.0%, respectively) and a PCR reaction in two amplification stages. Influenza A virus, influenza B virus, respiratory syncytial virus and RNaseP nucleic acids were successfully amplified in different PCR reaction tubes on one PCR reaction plate through a centrifugal air bath temperature-controlled qPCR instrument, and the amplification time was controlled within 30 minutes.

[0162] The embodiments of the present invention are described above in conjunction with the accompanying drawings, but the present invention is not limited to the above-mentioned specific implementation modes, which are merely illustrative rather than restrictive. Under the guidance of the present invention, ordinary technicians in this field can also make many forms without departing from the scope of protection of the present invention and the claims, all of which are within the protection of the present invention.

Claims

1. A method for designing primers with a high annealing temperature, characterized in that: The method comprises: S101, designing a first forward primer and a first reverse primer according to the target nucleic acid fragment, wherein the first forward primer and the first reverse primer specifically bind to the target nucleic acid fragment and the length of the first forward primer and the first reverse primer is a first length; S102 calculating the annealing temperatures of the first forward primer and the first reverse primer, and when the annealing temperatures of the first forward primer and the first reverse primer are less than 66° C., adding a first interface sequence and a second interface sequence to the 5′ ends of the first forward primer and the first reverse primer to form a second forward primer and a second reverse primer, respectively, so that the annealing temperatures of the second forward primer and the second reverse primer reach 66-82° C., and the length of the first interface sequence and / or the second interface sequence is a second length; The first length includes 15-30 bases, the second length is at most 50% of the first length; and the cytosine content in the first interface sequence and the second interface sequence is at least 50%.

2. The method according to claim 1, characterized in that The guanine content in the first interface sequence and the second interface sequence is at most 50%.

3. The method according to claim 1, characterized in that The length of the second forward primer and / or the second reverse primer is at most 40 bases.

4. The method according to claim 1, characterized in that The first interface sequence and the second interface sequence are not complementary to the target nucleic acid fragment.

5. The method according to claim 1, characterized in that The first interface sequence and the second interface sequence are not complementary to a second length of sequence upstream of the 5' end and / or downstream of the 3' end of the target nucleic acid fragment.

6. A method for amplifying a target nucleic acid fragment in a sample, characterized in that: The method comprises performing PCR amplification using the second forward primer and the second reverse primer designed by the method according to any one of claims 1 to 5, wherein the PCR amplification comprises a first amplification stage and a second amplification stage; Wherein, the first amplification stage includes contacting the sample with the second forward primer and the second reverse primer and amplifying under first amplification conditions to obtain a first amplification product; the second amplification stage includes using the first amplification product as a template and amplifying under second amplification conditions to obtain a second amplification product, and the second amplification conditions include a denaturation temperature of at least 85°C, an annealing temperature of 66-82°C, and a number of cycles of 15-50 in each cycle.

7. The method according to claim 6, characterized in that The PCR amplification step is performed on a PCR instrument that heats and cools based on Peltier or a PCR instrument that heats and cools in an air bath.

8. The method according to claim 6, characterized in that The first amplification conditions include a denaturation temperature of at least 90° C., an annealing temperature of 55-65° C., and a number of cycles of 3-15 in each cycle.

9. The method according to claim 6, characterized in that The difference between the denaturation temperature and the annealing temperature in each cycle in the second amplification condition includes 8-30°C.

10. The method according to claim 6, characterized in that The difference between the annealing temperature of the second amplification condition and the annealing temperature of the first amplification condition is at least 5°C.

Images