Detection method and kit of 5-hydroxymethylcytosine 5hmC for non-disease diagnosis purpose

Abstract

The invention provides a non-disease diagnosis purpose 5-hydroxymethylcytosine 5hmC detection method and a non-disease diagnosis purpose 5-hydroxymethylcytosine 5hmC detection kit. The detection method comprises the following steps: S1, glycosylation treatment; s2, carrying out enzyme digestion treatment on the GSREs; s3, carrying out APOBEC deamination treatment; s4, carrying out hydroxymethylation detection; the kit comprises a glycosylation reaction kit, a GSREs enzyme digestion reaction kit, an APOBEC deamination reaction kit and a PCR (Polymerase Chain Reaction) kit. The glycosylation reaction kit comprises a CutSmart buffer solution, UDP-Glucose, a T4-BGT enzyme and nuclease-free water, wherein the CutSmart buffer solution, the UDP-Glucose and the T4-BGT enzyme are used as raw materials; the GSREs enzyme digestion reaction kit comprises a GSREs enzyme, an enzyme digestion reaction buffer solution and nuclease-free water, the APOBEC deamination reaction kit comprises APOBEC, BSA (Bovine Serum Albumin), an APOBEC Reactive buffer solution and nuclease-free water; the PCR kit comprises a PCR reaction solution, a primer and a probe. According to the 5-hydroxymethylcytosine 5hmC detection method and kit for non-disease diagnosis purpose provided by the invention, precise quantification of extremely high specificity of 5hmC is realized, and the detection sensitivity is also improved while the specificity of a detection signal is improved.

Description

Technical Field

[0001] The invention relates to a detection method for 5-hydroxymethylcytosine 5hmC for non-disease diagnosis purposes, and belongs to the technical field of biological detection. Background Art

[0002] 5-Methylcytosine (5mC) is one of the most promising tumor markers in recent years and has become a common and abundant signal source in early cancer screening. 5mC is actively demethylated by oxidation in the TET oxygenase family (TET1, TET2, TET3) to form 5-hydroxymethylcytosine (5hmC). Studies have found that 5hmC is not only an intermediate product of demethylation, but is also related to gene expression, maintenance of embryonic stem cell pluripotency, and tumorigenesis.

[0003] In the past 10 years, studies have found that abnormal changes in 5hmC levels in specific gene sequences are associated with tumorigenesis and cancer progression. However, there is currently no particularly effective 5hmC detection method that can be routinely used in large-scale basic life science research and clinical applications, because the quantification of fragment-specific 5hmC faces the challenge of how to truly detect low-abundance 5hmC sites in the context of high-abundance C and 5mC.

[0004] Currently, the most commonly used detection methods for detecting specific 5hmC fragments of specific genes are mainly to distinguish C, 5mC, 5hmC and other modification states by using various treatment methods, such as T4-β glycosyltransferase-specific modification protection, TET protein oxidation and other oxidations (such as potassium perruthenate KRuO 4 ) and bisulfite conversion, followed by sequencing at the whole genome level or at the level of specific related genes. Among these methods, the most common processing step is to convert different modification states of cytosine into different base states through bisulfite conversion. However, bisulfite conversion can cause DNA damage, thereby reducing detection sensitivity.

[0005] In summary, the prior art still lacks a method and kit for detecting 5-hydroxymethylcytosine 5hmC efficiently and specifically. Summary of the invention

[0006] The present invention provides a detection method and a kit for 5-hydroxymethylcytosine 5hmC for non-disease diagnosis purposes, which achieves extremely high specific quantification of 5hmC and improves the specificity of the detection signal.

[0007] To achieve this object, the present invention provides the following technical solutions:

[0008] The first aspect of the present invention provides a method for detecting 5-hydroxymethylcytosine 5hmC for non-disease diagnosis purposes, comprising the following steps:

[0009] S1, glycosylation treatment;

[0010] S2, glycosylated 5hmC (5ghmC)-dependent sensitive restriction endonuclease GSREs digestion;

[0011] S3, apolipoprotein B mRNA editing catalytic polypeptide APOBEC deamination processing;

[0012] S4, hydroxymethylation detection.

[0013] In the present invention, non-disease diagnosis purposes include but are not limited to: 1. Predicting gene expression levels (5hmC, as an important epigenetic marker, can affect gene expression. Studies have shown that the 5hmC content in the genome is positively correlated with gene expression in human tissues, and is superior to the 5mC content in the genome in predicting gene expression levels. This indicates that 5hmC plays an important role in gene expression regulation.); 2. Studying the expression of tissue-specific functional genes (5hmC exhibits tissue-specific distribution characteristics and is related to tissue-specific gene expression and its function.); 3. Prediction of tumor development, etc.

[0014] Preferably, in step S1, the glycosylation reaction system is: DNA to be detected, CutSmart buffer, UDP-Glucose, T4β-glucosyltransferase T4 BGT and nuclease-free water; the glycosylation reaction conditions are: 37-40°C, 10h, 65-70°C, 20-30min inactivation.

[0015] Preferably, in step S2, the GSREs enzyme digestion reaction system is: the product after the glycosylation reaction in step S1, GSREs enzyme, enzyme digestion reaction buffer and nuclease-free water; the GSREs enzyme digestion reaction conditions are: 37-40°C, 15min-1.5h, 65-70°C, 20-30min inactivation.

[0016] Preferably, the enzyme digestion reaction buffer includes 1×CutSmart buffer, 1×Buffer R or 1×Taq buffer, etc.

[0017] Preferably, the GSREs enzyme includes one or a combination of Csp6I, MboI, Mspl, HaeIII, McrBC, TaqαI, and GlaI.

[0018] Preferably, in step S3, the APOBEC deamination reaction system is: the product after the GSREs digestion reaction in step S2, APOBEC, BSA, APOBEC reaction buffer, and nuclease-free water; the APOBEC deamination reaction conditions are: incubation at 37-40°C for 3-3.5 hours, and then incubation at 4-6°C in a thermal cycler.

[0019] In the present invention, C and mC are deaminated in the APOBEC deamination reaction to detect DNA hydroxymethylation. Obviously, the APOBEC deamination reaction includes but is not limited to APOBEC1 (A1), APOBEC2 (A2), APOBEC3A~H (3A, 3B, 3C, 3D, 3E, 3F, 3H) and other specific deamination methods in the prior art.

[0020] Preferably, in step S3, the product after the GSREs digestion reaction in step S2 is further treated as follows: 85-90°C, 10-20 min, and immediately placed on ice after completion.

[0021] Preferably, the hydroxymethylation detection method is PCR amplification technology or other amplification methods such as constant temperature amplification, and the reaction system includes: PCR reaction solution, primers, probes and the product after the APOBEC deamination reaction in step S3.

[0022] In the present invention, the 5hmC detection uses the genomic DNA of human 489 site as the model molecule for 5hmC detection, and the primers include F489-1 with a nucleic acid sequence of SEQ ID NO.2, R489-1 with a nucleic acid sequence of SEQ ID NO.3, and hmc489-probe1 with a nucleic acid sequence of SEQ ID NO.4.

[0023] SEQ ID NO.2CTCAGGGTGTAGCGGTTC;

[0024] SEQ ID NO.3CCTCATTCGTGCGCTCTA;

[0025] SEQ ID NO. 4FAM-ATCCTCCGGCGTTCAG-MGB.

[0026] In the present invention, the 5hmC detection uses the genomic DNA of the human (human brain) 68635 site as the model molecule for 5hmC detection, and the primers include 68635-F1 with a nucleic acid sequence of SEQ ID NO.6, 68635-P1 with a nucleic acid sequence of SEQ ID NO.7, and 68635-R1 with a nucleic acid sequence of SEQ ID NO.8.

[0027] SEQ ID NO.6TATGGTTTATTTTCGTTTTTAGTGT;

[0028] SEQ ID NO.7FAM-CCCGAAACCACAAAAACG-MGB;

[0029] SEQ ID NO. 8CACTACGACTACCCTACACG.

[0030] In the present invention, PCR amplification is preferred, but it can also be replaced by other amplification methods such as constant temperature amplification.

[0031] The second aspect of the present invention provides a 5-hydroxymethylcytosine 5hmC detection kit, comprising a glycosylation reaction kit, a GSREs enzyme cleavage reaction kit, an APOBEC deamination reaction kit and a PCR reaction kit.

[0032] The glycosylation reaction kit includes: CutSmart buffer, UDP-Glucose, T4-BGT enzyme, and nuclease-free water;

[0033] The GSREs enzyme digestion reaction kit includes: GSREs enzyme, enzyme digestion reaction buffer and nuclease-free water;

[0034] The APOBEC deamination reaction kit includes: APOBEC, BSA, APOBEC Reaction buffer, and nuclease-free water;

[0035] The PCR reaction kit includes: PCR reaction solution, primers, and probes.

[0036] Preferably, the enzyme digestion reaction buffer includes 1×CutSmart buffer, 1×Buffer R or 1×Taq buffer, etc.

[0037] In the present invention, APOBEC includes but is not limited to APOBEC1 (A1), APOBEC2 (A2), APOBEC3A~H (3A, 3B, 3C, 3D, 3E, 3F, 3H) and other specific deamination methods in the prior art.

[0038] Preferably, the GSREs enzyme includes one or a combination of Csp6I, MboI, Mspl, HaeIII, McrBC, TaqαI, and GlaI.

[0039] Preferably, the concentration of GSREs enzyme is not less than 10 U / μL, and the volume is not less than 1 μL; APOBEC is not less than 2 μL.

[0040] In summary, the biodeamination based on APOBEC is relatively mild and can effectively protect the integrity of the genome, but relying solely on APOBEC to distinguish 5hmC may have the risk of false positive results. In addition, since the overall level of 5hmC in tumor tissues is generally low, even lower than that in normal tissues, it is more challenging to achieve sufficient sensitivity for 5hmC detection. In addition, 5hmC detection based on simple polymerase chain reaction (PCR) platforms has been developed, such as GSREs combined with qPCR detection based on high specificity and mildness, that is, glucosyl-5-hmC templates can be enriched by digesting non-hydroxymethylated templates and then detected by subsequent amplification processes, which has high sensitivity. However, incomplete digestion of non-hydroxymethylated templates not only poses a serious risk of false positive amplification, but also reduces sensitivity. The experimental results of the present invention show that after the complete 5ghmC template is synergistically treated with glycosylation-GSREs enzyme digestion-APOBEC deamination (T4BGT-GSREs-APOBEC) treatment, most of the detection background of cytosine C and 5' methylated cytosine is first degraded by enzyme treatment, and the base difference produced by APOBEC deamination greatly improves the specificity of the detection, so that the glycosylated 5hmC (5ghmC) dependent sensitive restriction endonuclease and deamination synergistic detection of 5hmC method (EDD-5hmC) achieves extremely high specificity.

[0041] Compared with the prior art, the beneficial effects and significant improvements of the technical solution of the present invention are:

[0042] 1. The present invention provides a method and kit for detecting 5hmC for non-disease diagnosis purposes. The present invention has experimentally confirmed that the method of the present invention can accurately quantify 5hmC with extremely high specificity, thereby improving the specificity of the detection signal.

[0043] 2. The method of the present invention is more gentle in the whole process of biological enzyme treatment, which can effectively avoid DNA degradation. The method of enzyme cleavage combined with deamination solves the non-specific amplification limited by enzyme efficiency when treated alone, greatly improving the specificity of detection while also improving the sensitivity of detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] In order to more clearly illustrate the technical solution of the present invention, the drawings used in the embodiments of the present invention are briefly introduced below.

[0045] Figure 1 The different treatments represented by MboI digestion in Example 1 were 1.7×10 5 / 1.7×10 4 Amplification curve of copies / reaction concentration template;

[0046] Figure 2This is the real-time amplification curve generated by 856, 428, 214, 107 and 53.5 copies / reaction of the 2-fold diluted template for detecting the epidermal growth factor receptor gene 68635 site in Example 2. DETAILED DESCRIPTION

[0047] To make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually based on conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are weight percentages and weight parts. The experimental materials and reagents used in the following examples can be obtained from commercial channels unless otherwise specified.

[0048] Unless otherwise specified, the technical and scientific terms used herein have the same meaning as commonly understood by ordinary technicians in the technical field to which the application belongs. It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments of the present application.

[0049] In order to more fully understand the present invention, the professional terms in the present invention are explained below.

[0050] The APOBEC (Apolipoprotein B mRNA Editing Catalytic Polypeptide-like) family is a class of proteins with cytosine deaminase activity that play diverse and important roles in human health and disease. The human APOBEC family includes 11 major gene products and alternative splicing variants, including APOBEC1, Activation Induced Deaminase (AID), APOBEC2 (A2), APOBEC3A-H (A3A-H) and APOBEC4 (A4) proteins.

[0051] Csp6I, a restriction enzyme, recognizes a specific DNA sequence and cuts the DNA at that site. The site recognized by the Csp6I (also known as CviQI) restriction enzyme is G^TAC, and it cuts best in buffer B at 37°C. Isoschizomers of Csp6I include AfaI, CviQI, and RsaNI. The enzyme exhibits 100% activity in the recommended buffer and reaction conditions, and Thermo Scientific restriction enzyme reaction buffers include premixed BSA, which helps enhance the stability of many enzymes and binds contaminants that may be present in DNA preparations.

[0052] MboI is a restriction endonuclease. The site recognized by MboI restriction endonuclease is ^GATC. It cuts best at 37°C and usually completes cutting within 5-15 minutes. MboI can be used for molecular cloning, restriction site mapping, genotyping, Southern blotting, restriction fragment length polymorphism (RFLP) and SNP analysis.

[0053] MspI is a restriction endonuclease. The DNA sequence recognized by MspI is 5'-C^CGG-3' (where "^" indicates the cleavage site), which produces a 5' protruding end. MspI can be used for applications such as DNA methylation analysis, 5-hmC detection and analysis, and rapid cloning.

[0054] HaeIII is a restriction endonuclease produced by Haemophilus aegypticus that can recognize and cut specific DNA sequences.

[0055] McrBC is a specific endonuclease that can recognize and cut DNA containing methylcytosine (5-methylcytosine or 5-hydroxymethylcytosine). It does not act on unmethylated DNA. The site recognized by McrBC consists of two half-sites in the form of (G / A)mC, which can be separated by up to 3kb, but the optimal interval is 55-103 base pairs.

[0056] TaqαI is a restriction endonuclease. The DNA sequence recognized by TaqαI is 5′-T^CGA-3′, where “^” indicates the cleavage site.

[0057] GlaI, a methylation-dependent restriction endonuclease, can recognize and cleave DNA sequences containing 5-methylcytosine. The DNA sequence it mainly recognizes is 5'-GCGC-3' / 3'-CGCG-5', and GlaI has the highest cleavage efficiency when there are two, three or four 5-methylcytosines in the sequence.

[0058] Glycosylation refers to the reaction in which a carbohydrate (or "sugar"), i.e., a glycosyl donor, is linked to the hydroxyl group or other functional group of another molecule (glycosyl acceptor) to form a glycoconjugate. In biology, glycosylation usually refers to an enzyme-catalyzed reaction. Glycosylation is a form of co-translational and post-translational modification that has an important impact on the function and stability of proteins. Glycosylation is mainly divided into the following types: 1. N-linked glycosylation: The sugar chain is covalently linked to the amino group on the asparagine (Asn) residue through N-acetylglucosamine (GlcNAc), which usually occurs in the endoplasmic reticulum and Golgi apparatus. 2. O-linked glycosylation: The sugar chain is covalently linked to the hydroxyl group on the serine (Ser) or threonine (Thr) residue through N-acetylgalactosamine (GalNAc), which mainly occurs in the Golgi apparatus. 3. C-linked glycosylation: The sugar chain is linked to the tryptophan (Trp) residue through a carbon-carbon bond. This type is relatively rare. 4. GPI-anchor glycosylation: The sugar chain is anchored to the protein on the cell membrane through glycosylphosphatidylinositol (GPI).

[0059] Hydroxymethylation is a form of DNA methylation in which the hydrogen atom at the C5 position of cytosine is replaced by a hydroxymethyl group (-CH2OH) to form 5-hydroxymethylcytosine (5-hmC).

[0060] Example 1

[0061] 1.1. Samples and amplified sequences used for 489 loci:

[0062] Sample: 100% C, 5mC and 5hmC DNA standards (all Cs are unmodified C, 5mC or 5hmC)

[0063] Amplified sequence (SEQ ID NO. 1): CTCAGGGTGTAGCGGTTCGGTTTATTGACGACGG GATC AGTACCGACG GTGATATGGGGCAAATGGTGGTCACCATCCTGTCGGCTGTGGCACAGGCTGAACGCCGGAG GATC CTAGAGCGCACGA ATGAGG. The site recognized by the MboI restriction endonuclease is ^GATC, which is underlined.

[0064] 1.2、489 site primer sequence list

[0065] name sequence serial number F489-1 CTCAGGGTGTAGCGGTTC SEQ ID NO.2 R489-1 CCTCATTCGTGCGCTCTA SEQ ID NO.3 hmc489-probe1 FAM-ATCCTCCGGCGTTCAG-MGB SEQ ID NO.4

[0066] 1.3 Glycosylation system

[0067]

[0068]

[0069] Reaction procedure: incubate at 37°C overnight, then at 65°C for 20 min.

[0070] 1.4. Enzyme Digestion System

[0071] Components Volume (μL) The products of glycosylation 10 MboI (10U / μL) 1 10xTaq Buffer 0.5 Nuclease-free water 3.5

[0072] Reaction conditions: 37°C, 1h, 65°C, 20min.

[0073] 1.5. Single-chain system

[0074] Preheat the PCR instrument to 85°C for 10 minutes and place on ice immediately after the reaction. The product after the reaction is the deaminated DNA template.

[0075] 1.6. Deamination system

[0076] Components Volume (μL) DNA 15 APOBEC 2 BSA 1 APOBEC Reaction Buffer 0.5 Nuclease-free water 1.5 total 20

[0077] Incubate at 37°C for 3 hours, then store at 4°C in a thermal cycler with the heating cover set to ≥45°C or open. The product after the reaction is the template for hydroxymethylation detection.

[0078] 1.7 Specific experimental steps

[0079] (1) Experimental grouping: Three standard control templates (489-site templates) were used. These three templates were linear dsDNA with exactly the same sequence, containing 100% unmodified C, 5mC or 5hmC respectively.

[0080] The three standard templates were pretreated and grouped in four different ways: glycosylation only (i), glycosylation followed by digestion with glucosyl-5-hydroxymethylcytosine sensitive restriction endonucleases (GSREs) (ii), glycosylation followed by APOBEC deamination (iii), and glycosylation followed by digestion with GSREs and then deamination (iv). The concentration of the three templates tested each time was 1.7×10 5 / 1.7×10 4 Copy / React.

[0081] (2) Hydroxymethylation detection

[0082] The PCR reaction system is as follows:

[0083] Components Use concentration Volume(μL) / test Final concentration DNA 2 <![CDATA[EpiTaq PCR Buffer(Mg 2+ free)]]> 10× 2 1× <![CDATA[MgCl 2 ]]> 25mM 2 2.5mM dNTP Raw Materials 2.5mM 2.4 0.3mM F489-1 (forward primer) 10μM 0.8 0.4μM F489-1 (forward primer) 10μM 0.8 0.4μM hmc489-probe1 (probe) 10μM 0.5 0.25μM TaKaRa EpiTaq Enzyme 5U / μL 0.2 1U / 20μL Nuclease-free water 9.3 Total volume 20

[0084] The PCR amplification procedure is as follows:

[0085]

[0086] PCR reaction method:

[0087] A. Prepare the PCR reaction solution, primers and DNA;

[0088] B. Dispense 18 μL of the prepared reaction solution into 96-well plates and add 2 μL of the treated DNA to each well.

[0089] C. PCR amplification Set up the PCR amplification program according to the table above and run it.

[0090] 1.8 Experimental Results

[0091] In this example, MboI was used to cleave the C and 5mC templates. Figure 1 As shown, only after glycosylation treatment, the amplification curves of C, 5mC, and 5hmC overlap, indicating that the template amounts of the three groups remain close at this time ( Figure 1 A / B(i)). Next, the glycosylated template was digested with MboI ( Figure 1 A / B(ii)), based on the three average Ct values ​​of E5 / E4, the Ct value delay thresholds of C and 5mC shifted by >10 cycles compared to the amplification status in the glycosylation step, while 5hmC barely changed, and the undigested intact template of the target 5ghmC remained intact. This is because the glycosylation treatment only glycosylated 5hmC to 5ghmC, indicating that digestion with MboI would lead to degradation of C and 5mC templates, and digestion treatment would lead to a slower amplification rate (increased Ct value), which would have no effect on 5hmC.

[0092] To explore the effect of APOBEC deamination, three sets of templates were deaminated after glycosylation, such as ( Figure 1 A / B(iii)) shows the amplification state with only glycosylation treatment ( Figure 1 Compared with A / B(i), the Ct value delay threshold of C and 5mC at E5 / E4 concentrations shifted by >11 / 10 and >9 / 7 cycles, respectively. This indicates that APOBEC deamination will cause C and 5mC templates to be deaminated to U, resulting in a decrease in the affinity of primer-template hybridization, which in turn slows down the amplification of C and 5mC (increase in Ct value), while 5ghmC is not affected.

[0093] Although enzyme cleavage and deamination do significantly reduce the amplification of C and mC, there is still non-specific amplification of non-cleaved or non-deaminated templates, and the higher the concentration, the more significant this non-specific amplification is. In real samples, the common low-level 5hmC exists in the background of a large amount of high-concentration C and mC. Obviously, the current non-specific amplification seriously affects the accurate quantification of 5hmC. Therefore, in order to further explore the effect of glycosylation combined with enzyme cleavage and deamination on detection. The glycosylated template was digested with MboI and then deaminated, as shown in ( Figure 1 As shown in A / B(iv)), the Ct values ​​of C and 5mC at E5 / E4 concentrations shifted more than 17 / 23.

[0094] The results showed that after T4BGT-MboI-APOBEC synergistically treated the intact 5ghmC template, part of the C and 5mC background was first degraded by enzyme treatment, and the base differences produced by APOBEC deamination greatly improved the specificity of the detection, making EDD-5hmC achieve extremely high specificity. It is worth noting that the amplification of the glycosylated 5hmC amplification fragment alone was similar to the Ct value of the amplification fragment of the same copy number treated with glucosyl-5-hydroxymethylcytosine sensitive restriction endonuclease digestion-APOBEC deamination. This shows that under EDD-5hmC conditions, 5hmC remains intact, confirming the necessity of βGT to effectively protect 5hmC.

[0095] Example 2

[0096] 2.1. Samples and amplified sequences used for locus 68635:

[0097] Sample: Human brain genome

[0098] Amplified sequence: EGFR (epidermal growth factor receptor), (chr7: 55082610-55082724, referred to as 68635)

[0099] CATGGTTCATTTCGCTCCAGTGTAGACATACAATAGACCACTCGTCCCTGTGGCT CCGG GCAGCAGCCTCATC TGAGACCCTCCTGAGACATCTCGTGCAGGGCAGCCGTAGTG (SEQ ID NO. 5).

[0100] Restriction site: The site recognized by MspI restriction endonuclease is ^CCGG, which is underlined. When the outer C base of the CCGG sequence is methylated, MspI cannot cut it. When the inner C base is methylated, MspI can still cut it, but it cannot cut the glycosylated (C5ghmCGG).

[0101] 2.2. Primer sequence list for site 68635

[0102] name sequence serial number 68635-F1 TATGGTTTATTTTCGTTTTAGTGT SEQ ID NO.6 68635-P1 FAM-CCCGAAACCACAAAAACG-MGB SEQ ID NO.7 68635-R1 CACTACGACTACCCTACACG SEQ ID NO.8

[0103] 2.3. Preparation and testing according to the experimental scheme of Example 1

[0104] 2.4 Experimental Results

[0105] The experimental results are as follows Figure 2 As shown, the real-time amplification curves for detecting epidermal growth factor receptor gene 68635 site generated by 2-fold diluted templates of 856, 428, 214, 107 and 53.5 copies / reactions prove that the method of the present invention can effectively detect samples with 53.5 copies.

[0106] The applicant declares that, in the description of the above specification:

[0107] The descriptions of the terms "this embodiment", "an embodiment of the present invention", "as shown in...", "further", "a further improved technical sub-scheme", etc., mean that the specific features, structures, materials or characteristics described in the embodiment or example are included in at least one embodiment or example of the present invention; in this specification, the schematic expressions of the above terms are not necessarily for the same embodiment or example, and the specific features, structures, materials or characteristics described may be combined or combined in a suitable manner in any one or more embodiments or examples; in addition, a person of ordinary skill in the art may combine or combine the different embodiments or examples and the features of the different embodiments or examples described in this specification without causing any contradiction.

[0108] Finally, it should be noted that:

[0109] The above embodiments are only used to illustrate the technical solutions of the present invention, but not to limit them.

[0110] Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some or all of the technical features therein, and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention. The non-essential improvements, adjustments or replacements made by those skilled in the art based on the contents of this specification are all within the scope of protection required by the present invention.

Claims

1. A method for detecting 5-hydroxymethylcytosine 5hmC for non-disease diagnosis purposes, characterized in that: The following steps are involved: S1, glycosylation treatment; S2, glycosylation 5hmC-dependent sensitive restriction endonuclease GSREs digestion treatment; S3, apolipoprotein B mRNA editing catalytic polypeptide APOBEC deamination processing; S4, hydroxymethylation detection.

2. The method for detecting 5-hydroxymethylcytosine 5hmC for non-disease diagnosis purposes according to claim 1, characterized in that: In step S1, the glycosylation reaction system is: DNA to be detected, CutSmart buffer, UDP-Glucose, T4β-glucosyltransferase T4 BGT and nuclease-free water; the glycosylation reaction conditions are: 37-40°C, 10h, 65-70°C, and inactivation for 20-30min.

3. The method for detecting 5-hydroxymethylcytosine 5hmC for non-disease diagnosis purposes according to claim 1, characterized in that: In step S2, the GSREs enzyme digestion reaction system is: the product after the glycosylation reaction in step S1, GSREs enzyme, enzyme digestion reaction buffer and nuclease-free water; the GSREs enzyme digestion reaction conditions are: 37-40°C, 15min-1.5h, 65-70°C, 20-30min inactivation.

4. The method for detecting 5-hydroxymethylcytosine 5hmC for non-disease diagnosis purposes according to claim 3, characterized in that: The GSREs enzyme includes one or a combination of Csp6I, MboI, Mspl, HaeIII, McrBC, TaqαI, and GlaI.

5. The method for detecting 5-hydroxymethylcytosine 5hmC for non-disease diagnosis purposes according to claim 1, characterized in that: In step S3, the APOBEC deamination reaction system is: the product after the GSREs digestion reaction in step S2, APOBEC, BSA, APOBEC reaction buffer, and nuclease-free water; the APOBEC deamination reaction conditions are: incubation at 37-40° C. for 3-6 hours, and then stored in a thermal cycler at 4-6° C.

6. The method for detecting 5-hydroxymethylcytosine 5hmC for non-disease diagnosis purposes according to claim 5, characterized in that: In step S3, the product after the GSREs digestion reaction in step S2 is further treated as follows: 85-90°C, 10-20 min, and immediately placed on ice after completion.

7. The method for detecting 5-hydroxymethylcytosine 5hmC for non-disease diagnosis purposes according to claim 1, characterized in that: The 5-hydroxymethylation detection method adopts amplification technology, and the amplification system includes: PCR reaction solution, primers, probes and the product after the APOBEC deamination reaction in step S3.

8. A detection kit for 5-hydroxymethylcytosine 5hmC, characterized in that: Including glycosylation reaction kit, GSREs enzyme digestion reaction kit, APOBEC deamination reaction kit and PCR reaction kit; The glycosylation reaction kit includes: CutSmart buffer, UDP-Glucose, T4-BGT enzyme, and nuclease-free water; The GSREs enzyme digestion reaction kit includes: GSREs enzyme, enzyme digestion reaction buffer and nuclease-free water; The APOBEC deamination reaction kit includes: APOBEC, BSA, APOBEC Reaction buffer, and nuclease-free water; The PCR reaction kit includes: PCR reaction solution, primers, and probes.

9. A 5-hydroxymethylcytosine 5hmC detection kit according to claim 8, characterized in that: The GSREs enzyme includes one or a combination of Csp6I, MboI, Mspl, HaeIII, McrBC, TaqαI, and GlaI.

10. A 5-hydroxymethylcytosine 5hmC detection kit according to claim 8, characterized in that: The 5hmC detection uses the genomic DNA of the human 489 site as the model molecule for 5hmC detection, and the primers include F489-1 with a nucleic acid sequence of SEQ ID NO.2, R489-1 with a nucleic acid sequence of SEQ ID NO.3, and hmc489-probe1 with a nucleic acid sequence of SEQ ID NO.4; or, the 5hmC detection uses the genomic DNA of the human brain 68635 site as the model molecule for 5hmC detection, and the primers include 68635-F1 with a nucleic acid sequence of SEQ ID NO.6, 68635-P1 with a nucleic acid sequence of SEQ ID NO.7, and 68635-R1 with a nucleic acid sequence of SEQ ID NO.8.

Images