One-step one-pot CRISPR (clustered regularly interspaced short palindromic repeats) nucleic acid detection method based on base mismatch

Abstract

The invention belongs to the field of biochemical analysis, and relates to a one-step one-pot CRISPR (clustered regularly interspaced short palindromic repeats) nucleic acid detection method based on base mismatch, which has a simpler and more convenient signal read-out system, realizes naked eye color and fluorescence dual-mode visualization in one-pot CRISPR reaction for the first time, and has the advantages of high sensitivity and high sensitivity. Compared with a conventional method which only depends on a real-time fluorescence curve monitoring instrument or single-mode fluorescence visualization, the method provided by the invention has further advantages. Besides, the nested RPA is introduced into the one-pot CRISPR reaction for the first time, the efficiency is higher than that of a common RPA activated CRISPR system, and bacteria (101CFU / mL) and viruses (102copies / mu L) can be detected in the whole reaction within 30 minutes. Compared with qPCR, the sensitivity of the research method is improved by 10 times, and the detection time is shortened by 50%. In addition, the equipment dependence is reduced by 75%, and the total cost is reduced by 99.7%.

Description

Technical Field

[0001] The present invention belongs to the field of biochemical analysis, and relates to a one-step one-pot CRISPR nucleic acid detection method based on base mismatch, and specifically relates to a one-step one-pot CRISPR ultra-sensitive nucleic acid analysis method based on base mutation. Background Art

[0002] Early identification of viruses and bacteria and timely measures are crucial for disease prevention and control. Currently, the main method for rapid identification of viral and bacterial infections is through nucleic acid amplification tests (NAAT). Traditional NAAT methods mainly include PCR and real-time fluorescence PCR (qPCR) techniques, which require skilled technicians, expensive temperature control equipment and relatively long detection time. Isothermal NAAT techniques, such as recombinase polymerase amplification (RPA) and loop-mediated isothermal amplification (LAMP), provide friendly reaction temperatures, but are often prone to false positive results. Currently, the emerging clustered regularly interspaced short palindromic repeats CRISPR / Cas system has been widely used in nucleic acid molecular diagnosis to improve the sensitivity and specificity of detection. The principle is that the Cas enzyme with trans-cleavage activity recognizes the target nucleic acid sequence, which can trigger the cis-cleavage activity of the target, and at the same time activate its trans-cleavage activity, non-specifically cut the single-stranded fluorescent reporter probe, thereby completing the signal report. In order to improve the sensitivity of the reaction, the CRISPR / Cas system is usually combined with isothermal NAAT to further activate the nucleic acid cleavage activity of the Cas protein. In order to achieve ultrasensitive detection, the traditional method is mainly to separate the amplification reaction and the cleavage reaction. Classic methods such as Sherlock and DETECTOR achieve detection through two separate steps: first, nucleic acid amplification is performed, and then the lid is opened to transfer the amplification product to the CRISPR cleavage system. The uncapping step of this method increases the complexity of the experiment and is prone to aerosol contamination during the uncapping process. In addition, usually during the transfer process, only a part of the amplification product is used for subsequent CRISPR detection, while most of the amplification product is not effectively utilized, thereby artificially reducing the detection sensitivity of low-concentration targets. Therefore, the most ideal situation is to achieve rapid one-pot detection in a closed tube. However, since the cis-cleavage activity of the Cas protein will cleave the target nucleic acid, and the trans-cleavage will destroy the amplification primer, directly placing the amplification system and the cleavage system in a single tube for reaction will produce a mutual inhibition effect and fail to achieve the expected sensitivity.

[0003] Based on this, the researchers proposed a spatially separated detection method, placing the nucleic acid amplification reagent and the CRISPR cutting system reagent in different areas in a single tube. After the amplification reaction is completed, the two systems are centrifuged and mixed for the next cutting operation. Centrifugation requires a centrifuge to thoroughly mix the two reaction solutions, which increases the complexity of the experiment, and there is also a risk of evaporation when the reagents are placed on the centrifuge tube cap. As an improvement, some researchers proposed adding agarose gel to the reaction, aiming to use agarose gel to separate the two systems to avoid mutual interference at the beginning of the reaction. However, the process requires the preparation and cooling of the gel, which increases the complexity of the experiment. Subsequently, some researchers also proposed the use of glycerol, sucrose concentration gradient-mediated dynamic water multiphase reactions in the detection system to achieve one-pot compatibility. However, these methods require the introduction of additional reagents or materials, which increases the cost of the experiment. In fact, they still rely on spatial isolation to achieve compatibility between the two systems.

[0004] Subsequently, researchers proposed a series of light-controlled activation methods, by hybridizing or modifying light-controlled activation groups on crRNA to inhibit the side cutting system. After the amplification reaction, the cutting system is activated by destroying the protective group by ultraviolet irradiation. Although this method does not require centrifugation and other operations, it introduces an additional step that requires light irradiation, and modification with photoactivatable groups also increases the reagent cost. Some studies have proposed a detection scheme based on suboptimal PAM recognition. The principle is based on the fact that the existing Cas12a enzyme usually recognizes the PAM site (TTTN) for optimal activation. They screened the suboptimal PAM sites (VTTV, TCTV, and TTVV) on the genome and designed crRNA to target the areas near these suboptimal PAM sites. Compatibility with the amplification system was achieved by reducing the cleavage efficiency after Cas12a recognized the suboptimal PAM site. However, this method requires screening suboptimal PAM sites at different positions in the genome, and the ideal amplification site does not necessarily contain a suboptimal PAM site. In addition, the design of the crRNA reported to date is designed by algorithm software for the optimal PAM site. Therefore, screening suboptimal PAM sites without the assistance of relevant software increases the difficulty of design and application. Subsequently, the team also proposed a one-pot compatible solution by modifying the enzyme to reduce its cleavage activity. However, enzyme modification engineering is more difficult, which raises the threshold for using this method. Therefore, it is urgent to invent a simpler, more versatile, and faster method to combine isothermal NAAT with Cas12a to achieve one-step, one-pot sensitive detection to solve the above problems. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the present invention provides a one-step, one-pot CRISPR nucleic acid detection method based on base mismatching, aiming to solve the technical problem in the prior art of lacking a simple, universal, one-pot CRISPR detection method with rapid results and easy judgment.

[0006] The first technical solution provided by the present invention is a reaction system for detecting a target object in a one-pot method, wherein the reaction system includes crRNA, Cas enzyme, primer set, fluorescent reporter probe and reagents for isothermal amplification reaction.

[0007] In one embodiment, the length of the crRNA is not less than 18 nt.

[0008] In one embodiment, the length of the guide crRNA is 18nt to 25nt.

[0009] In one embodiment, the Cas enzyme is Cas12a protein.

[0010] In one embodiment, the primer set is a common primer set or a nested primer set, wherein the common primer set comprises an outer primer and the nested primer set comprises an inner primer and an outer primer.

[0011] In one embodiment, the reporter probe carries a fluorescent group at one end and a quencher group at the other end.

[0012] In one embodiment, the fluorescent group is selected from FAM, VIC, and ROX.

[0013] In one embodiment, the quencher group is selected from the BHQ series, MGB or TAMRA.

[0014] In one embodiment, the isothermal amplification reaction includes RPA amplification and nested RPA amplification.

[0015] In one embodiment, the isothermal amplification reaction reagents include commercial RPA amplification reagents.

[0016] In one embodiment, the amplification reagent includes a recombinase, a DNA polymerase, a single-stranded binding protein, ATP, PEG and magnesium acetate.

[0017] In one embodiment, the amount of the primer used is 0.5 to 3 μL.

[0018] In one embodiment, the ratio of Cas12a to crRNA is 1:0.5-1:5.

[0019] In one embodiment, the concentration of the Cas12a and crRNA complex is 1 μM-10 μM.

[0020] In one embodiment, the amount of PEG used is 5 μl-48.5 μL.

[0021] In one embodiment, the concentration of the reporter probe is 50 μM-300 μM.

[0022] In one embodiment, the inner primer and the outer primer constitute a nested primer, and the target is used as a template to perform nested RPA amplification. The generated activator is recognized by the Cas protein / mismatched base crRNA complex, activating the tangential and lateral cutting activities of the Cas protein, and the high-concentration fluorescent signal probe in the lateral cutting system can generate color visualization and fluorescent visualization signals after cleavage.

[0023] In one embodiment, the target is Salmonella typhimurium.

[0024] In one embodiment, the nucleotide sequence of the mismatched base crRNA is shown in any one of SEQ ID NO.1 to 7.

[0025] In one embodiment, the nucleotide sequence of the nested primer set is SEQ ID NOs. 8-11.

[0026] In one embodiment, the target is Staphylococcus aureus.

[0027] In one embodiment, the nucleotide sequence of the mismatched base crRNA is as shown in SEQ ID NO.12.

[0028] In one embodiment, the nucleotide sequence of the nested primer set is SEQ ID NOs. 13-16.

[0029] In one embodiment, the target is Listeria monocytogenes.

[0030] In one embodiment, the nucleotide sequence of the mismatched base crRNA is as shown in SEQ ID NO.17.

[0031] In one embodiment, the nucleotide sequence of the nested primer set is SEQ ID NOs. 18-21.

[0032] In one embodiment, the target is influenza A (H1N1) pseudovirus.

[0033] In one embodiment, the nucleotide sequence of the mismatched base crRNA is shown in SEQ ID NO.22.

[0034] In one embodiment, the nucleotide sequence of the nested primer set is SEQ ID NOs. 23-26.

[0035] In one embodiment, the nucleotide sequence of the reporter probe is CCCCCC.

[0036] In one embodiment, the 5' end of the reporter probe is modified with a fluorescent reporter group ROX, and the 3' end of the probe is modified with a fluorescent reporter group BHQ.

[0037] The second technical solution provided by the present invention is a one-pot method for detecting target nucleic acid, which uses the reaction system described in the first technical solution to detect the target nucleic acid.

[0038] In one embodiment, the method comprises the following specific steps:

[0039] (1) incubating the Cas12a protein and the mismatched base crRNA in the reaction system at 30-40° C. for 10-20 min;

[0040] (2) adding the sample to be tested, the nested primer set and the fluorescent reporter probe, as well as MgOAC and other reagents for the nested RPA amplification reaction to the mixed solution;

[0041] (3) Incubate at 30-40°C for 20-60 min.

[0042] In one embodiment, the target nucleic acid is obtained after nucleic acid extraction of the sample to be tested.

[0043] In one embodiment, the target nucleic acid is double-stranded DNA.

[0044] In one embodiment, color visualization and fluorescence visualization dual-mode monitoring is performed after the one-pot reaction is completed.

[0045] The third technical solution provided by the present invention is a kit, which contains the reaction system described in the first technical solution.

[0046] The fourth technical solution provided by the present invention is the use of the reaction system described in the first technical solution, or the method described in the second technical solution, or the kit described in the third technical solution in detecting foodborne pathogens.

[0047] In certain embodiments, the foodborne pathogens include Salmonella, Listeria monocytogenes, and Staphylococcus aureus.

[0048] The technical effects of the present invention are as follows:

[0049] (1) The relationship between the number and position of mismatched nucleotides in the crRNA seed region and the different cleavage activities of Cas12a induced by them was systematically studied. On this basis, a simpler solution was proposed, which adopted a simple single nucleotide mismatch strategy to solve the challenge of incompatibility between the nucleic acid amplification system and the CRISPR cleavage system, and achieved higher sensitivity (10% higher) than the traditional matching crRNA-mediated reaction in a one-pot reaction. 4 The one-pot reaction also avoids complicated operation procedures and aerosol contamination and has wide applicability to other nucleic acid targets.

[0050] (2) Compared with existing studies, the method of this study has a simpler and more convenient signal readout system. For the first time, naked eye color and fluorescence dual-mode visualization was achieved in a one-pot CRISPR reaction, which has further advantages compared with previous methods that only rely on real-time fluorescence curve monitoring instruments or single-mode fluorescence visualization. In addition, the introduction of nested RPA into the one-pot CRISPR reaction for the first time has a higher efficiency than ordinary RPA in activating the CRISPR system. The entire reaction can detect bacteria within 30 minutes (10 1 CFU / mL) and viruses (10 2 Compared with qPCR, the sensitivity of this method was increased by 10 times and the detection time was shortened by 50%. In addition, the equipment dependence was reduced by 75% and the total cost was reduced by 99.7%.

[0051] (3) The present invention can adopt a handheld body temperature heating strategy, and get rid of the dependence on heating equipment through body temperature heating, making the present invention suitable for on-site one-pot instrument-free visual rapid detection of pathogens. Therefore, it realizes a truly practical one-pot POCT and eliminates the dependence on traditional fluorescence monitoring instruments. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 It is a schematic diagram of the mechanism of the present invention.

[0053] Figure 2 To explore the relationship between mismatched nucleotides in the crRNA seed region and cas12a cleavage activity.

[0054] Figure 3 Characterize the cleavage process by poly(acrylamide) gel electrophoresis.

[0055] Figure 4 To establish the nested RPA basic reaction system.

[0056] Figure 5 Optimize the amount of primers.

[0057] Figure 6 Optimize the ratio and dosage of Cas12a and crRNA.

[0058] Figure 7 Optimize the dosage of PEG.

[0059] Figure 8 Optimized for probe type.

[0060] Fig. 9 Optimization of probe length.

[0061] Fig.10 Optimization of probe dosage.

[0062] Fig.11 Comparison of probe labeled fluorescent groups.

[0063] Fig.12 Establishment of a one-pot dual-mode visualization basic reaction system for mismatching.

[0064] Fig.13 Schematic diagram for the comparison between the mismatched one-pot experiment and the traditional one-pot experiment.

[0065] Fig.14 To compare the sensitivity of the mismatch one-pot assay and the traditional one-pot assay, Salmonella typhimurium was used as an example.

[0066] Fig.15 Evaluation of specificity for mismatch one-pot experiments.

[0067] Fig.16 To demonstrate the versatility of the mismatch one-pot experiment, Staphylococcus aureus was used as an example.

[0068] Fig.17 To demonstrate the universality of the one-pot experiment, Listeria monocytogenes is taken as an example.

[0069] Fig.18 To demonstrate the universality of the one-pot mismatch experiment, influenza A virus was used as an example.

[0070] Fig.19 For detection of Salmonella Typhimurium using standard qPCR.

[0071] Fig. 20 For testing actual clinical samples.

[0072] Fig.21 The results of the one-pot experiment of body temperature-driven mismatch on different concentrations of bacteria at different ambient temperatures. DETAILED DESCRIPTION

[0073] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0074] The raw materials used in the embodiment:

[0075] 1. Bacterial genomic DNA extraction kit (DP302) was purchased from Tiangen (China).

[0076] 2. The RPA kit was purchased from Hangzhou Zhongce Biotechnology Co., Ltd., China, and contained recombinase, polymerase, SSB, other co-reaction factors, A buffer (PEG), and B buffer (MgOAC). Lba Cas12a (Cpf1, 100 μM) and NEB buffer 2.1 (10X) were purchased from New England Biolabs (USA).

[0077] 3. Enzyme-free water, plasmids, influenza A (H1N1) pseudovirus, all oligonucleotide sequences, and crRNA) were provided by China Sangon Biotech Co., Ltd.

[0078] 4. Escherichia coli (ATCC 43888), Listeria monocytogenes (ATCC 19115), Vibrio parahaemolyticus (ATCC 17802), Staphylococcus aureus (ATCC 29213) and Salmonella typhimurium (ATCC 14028) were purchased from the American Culture Collection (ATCC).

[0079] 5. DNA Oligos 5x annealing buffer (D0251), RNAeasy TM The instructions for the viral RNA extraction kit (R0035S) were purchased from Biotime Biotech (China).

[0080] 6. IIQ RT SuperMix (R222) was purchased from Novozymes Biopharmaceuticals (China).

[0081] 7. PCR mix (11201ES08, 11205ES08) was purchased from Yisheng Biotechnology Co., Ltd., China.

[0082] Example 1 Screening of mutant bases and establishment of a one-pot reaction system

[0083] like Figure 1As shown, in the traditional one-pot reaction, the cleavage reaction mediated by cas12a competes with the isothermal amplification reaction. Because the matching crRNA-mediated formal cleavage of the target and the trans-cleavage of the single-stranded primer are both very strong, the target template is consumed too much, and the accumulation of the amplicon is unstable and slow, which leads to the trans-cleavage of the fluorescent signal probe slowing down or even failing to effectively cut. In the present invention, the relationship between the number and position of the mismatched nucleotides in the crRNA seed region and the different cleavage activities of Cas12a induced by them is systematically studied. Studies have found that mutations of different numbers and positions of nucleotides can lead to different decreases in the cutting ability of Cas12a. By introducing mutations of a single base in the crRNA seed region, the ability of the cis and trans-cleavage of the single-stranded primer on the target mediated by cas12a is reduced to an appropriate level, thereby promoting the balance to be transferred to isothermal amplification. A good balance is achieved between it and NAAT in a one-pot reaction, and therefore, efficient isothermal amplification further enhances the trans-cleavage reaction mediated by cas12a by providing sufficient amplicon accumulation in a short time, so that lower concentrations of targets can be detected ( Figure 1 ).

[0084] In this embodiment, taking Salmonella typhimurium as an example, base mismatching was explored in a one-pot RPA-CRISPR system. The one-pot RPA-CRISPR reaction system was: Lba Cas12a (2 μM): 0.5 μL, crRNA (4 μM: 0.6 μL, anhydrous 1 μL, pre-assembled at 37 ° C for 20 min, and then mixed with fluorescent probe (10 μM): 0.4 μL. The RPA amplification system is a primer set (20 μM): 1 μL, A buffer (PEG): 25 μL, enzyme-free water: 19.5 μL, shake well to mix. Take 8 μL of RPA system, add 2.5 μL of CRISPR system, 2 μL of target DNA and 1 μL of B buffer (280 mM MgOAC), and fill the total volume to 15 μL per well with enzyme-free water.

[0085] Design of primers and crRNA with different base mutations for the target (Salmonella typhimurium)

[0086] Salmonella typhimurium - fluorescent reporter probe (5'-3'): FAM-CCCCCC-BHQ1

[0087] Salmonella typhimurium upstream primer (5'-3'); CCCAGCCATACGGATAAACTGTGTTATAGCGG (SEQ ID NO. 8).

[0088] Salmonella typhimurium downstream primer (5'-3'); CTCAGGCAATAATTACAACTGACAACTACCTC (SEQ ID NO. 9).

[0089] The Salmonella typhimurium crRNA (5'-3') is shown in the following table;

[0090] Table 1 Mutated crRNA sequences

[0091]

[0092]

[0093] This example systematically explores different situations of target detection after crRNA with different mismatches in the seed region is assembled with Cas12a ( Figure 2 A). First, we investigated the performance of crRNAs with adjacent mismatches and intermittent mismatches of four bases in a one-pot binding experiment with RPA. The results showed that neither the fully complementary crRNA nor the crRNA with mismatched bases produced any positive fluorescence signals. This is because the efficient cleavage activity mediated by the fully complementary crRNA makes it incompatible with the amplification system, making it impossible to accumulate amplicons to activate the generation of positive signals. However, for adjacent and intermittent mismatches of four bases in the seed region ( Figure 2 B), and a complete mismatch of eight base nucleotides (Mis12345678) prevented the effective hybridization of the mismatched crRNA with the target, thereby inhibiting the activation of the fluorescence signal of cutting. This shows that too strong or too weak binding ability between crRNA and target will affect the efficiency of the one-pot reaction. It is crucial to find a balance and a suitable one-pot compatible state. Subsequently, the number of mismatched nucleotides was reduced, and the activation effect of adjacent and spaced mismatches of three nucleotides in the seed region was studied ( Figure 2 C). The results showed that no positive cleavage signal was generated in the one-pot system, indicating that the three-base mismatch in the seed region still significantly weakened the binding of crRNA to the target. Then, the number of mismatched nucleotides was further reduced, and the presence of adjacent and spaced mismatches of two bases in the seed region was explored ( Figure 2 D). At this time, the fluorescence signal begins to appear. This shows that in this case, the crRNA with nucleotide mismatch can still bind to the target to a certain extent, thereby activating the trans-cleavage activity that is relatively weaker than the fully matched crRNA, and preliminarily achieving the compatibility of the Cas12a cleavage system and the RPA amplification system. Then we reduced the number of mismatched nucleotides in the seed region to one ( Figure 2E), the results show that a nucleotide mismatched crRNA can still perform good matching hybridization with the target, thereby activating a relatively high but not as strong cleavage activity as that activated by the fully complementary crRNA. This weakened cleavage activity in the one-pot system reduces its ability to cis-cleave the target and trans-cleave the primer, thereby minimizing the impact of the cleavage system on the RPA amplification system, which allows more RPA products to accumulate in the reaction. The experimental results show that in a one-step one-pot compatible experiment, the base mismatch at the 4th position (mis4) of the crRNA seed region (5'-3') has the most efficient one-pot cleavage effect. Therefore, mis4 crRNA (SEQ ID NO.4) was used for subsequent comparative evaluation.

[0094] Example 2 Matching crRNA and mis4 crRNA-mediated target and single-stranded probe cleavage

[0095] Polyacrylamide gel electrophoresis was used to characterize the cis-cleavage of the target and the trans-cleavage of the single-stranded probe mediated by two different crRNAs (mis4 crRNA and match crRNA). Figure 3 ). The electrophoresis system is as follows: Lba Cas12a (1μM): 1μL, NEB buffer 2.1 (10X): 1μL, crRNA (2μM): 1μL, enzyme-free water: 3μL, pre-assembled at 37°C for 20 minutes. Then mix with the target (1μM, 1μL) and the single-stranded probe (20μM, 3μL) for reaction. After the reaction, add the loading buffer and start polyacrylamide gel electrophoresis at 130V (20%). The experimental results show that the target band of the match crRNA group weakened, and the band of the single-stranded probe disappeared (lane 1), while the target band and single-stranded probe mediated by the mismatched mis4 crRNA were less faded (lane 2). The results show that match crRNA mediated stronger cis-cleavage and trans-cleavage than mis4 crRNA. In contrast, in the absence of crRNA, no cleavage of the target and probe occurred (lane 3). This indicates that the mutant bases in mis4crRNA weaken the ability of Cas12a to cis-cleave targets and trans-cleave single-stranded probes mediated by it. This minor damage ensures sufficient number of gene targets and single-stranded primers in the one-pot system, making it compatible with one pot.

[0096] Example 3 Establishment and optimization of a one-pot CRISPR nucleic acid detection method based on base mismatch

[0097] In this embodiment, taking Salmonella typhimurium as an example, the establishment and optimization of the nucleic acid detection method are carried out. Those skilled in the art can design and optimize crRNA according to conventional technical means.

[0098] 1 Design primers and crRNA for target (Salmonella typhimurium)

[0099] Salmonella typhimurium mismatched crRNA (5'-3'):

[0100] UAAUUUCUACUAAGUGUAGAUAAUGCACAAAGAAAUGUCAUC (SEQ ID NO. 4);

[0101] Salmonella typhimurium - fluorescent reporter probe (5'-3'): FAM-CCCCCC-BHQ1; ROX-CCCCCC-BHQ2

[0102] Salmonella typhimurium - outer upstream primer (5'-3'): CCCAGCCATACGGATAAACTGTGTTATAGCGG (SEQ ID NO. 8);

[0103] Salmonella typhimurium - outer downstream primer (5'-3'); CTCAGGCAATAATTACAACTGACAACTACCTC (SEQ ID NO. 9);

[0104] Salmonella typhimurium - inner upstream primer (5'-3'): TCTGGATATCGCTTTGTTGCCAACT (SEQ ID NO. 10);

[0105] Salmonella typhimurium - inner downstream primer (5'-3'): CGTACCGCAGCATTCCGCTCATTAG (SEQ ID NO. 11).

[0106] 2. Nucleic Acid Extraction

[0107] The genomic DNA of Salmonella typhimurium was extracted using a nucleic acid extraction kit.

[0108] 3 One-pot CRISPR reaction system based on base mismatch

[0109] The CRISPR cutting system is: Lba Cas12a (3μM): 0.5μL, crRNA (3μM): 0.6μL, MgOAC (280mM): 1μL, pre-assembled at 37℃ for 20min, and then mixed with poly C6 (6 cytosines) probe (250μM): 0.4μL. The nested RPA amplification system is: outer primer set (20μM): 2μL, inner primer set (20μM): 2μL, A buffer (PEG): 25μL, enzyme-free water: 13.5μL, mix well. Take 8μL of the nested RPA system, add 2.5μL of the CRISPR system, 2μL of target DNA and 1μL of B buffer (280mM MgOAC), and fill the total volume to 15μL per well with enzyme-free water. Then start a one-pot reaction for 30 minutes.

[0110] 4 Optimization of reaction system

[0111] A common fluorescent quantitative PCR instrument is used to perform preliminary reaction system optimization in order to obtain a one-pot reaction system with strong specificity and high sensitivity: the reaction system is as shown in step 3, and the parameters that need to be optimized are adjusted under the conditions of step 3.

[0112] (1) Establishment of a nested RPA-CRISPR basic reaction system

[0113] In order to further improve the reaction efficiency, a nested RPA system was introduced into the one-pot reaction system mediated by Mis4 crRNA ( Figure 4 ). Nested RPA is achieved by introducing two additional primers (inner primers) into the original RPA amplification region, allowing more amplification products to be produced in the same time frame. Experimental results show that when there are only two original outer primers in the system, the primer concentration is directly doubled (2X), and the positive fluorescence signal increases slightly. When the total concentration of all primers in the system is still 2X, but the primer set consists of 1X inner primer and 1X outer primer, a nested RPA reaction can be formed. In the one-pot system, there is a significant enhancement in the positive fluorescence signal. This suggests that more binding sites can produce more amplification products in a shorter time, thereby activating a faster and more efficient one-pot reaction.

[0114] (2) Optimization of primer dosage

[0115] The reaction system is the same as in step 3, only the amount of primer is adjusted to 0.5μL, 1μL, 2μL, 3μL, 4μL and 5μL for 20μM. The results are as follows Figure 5 As shown, when the primer dosage is 2 μL, the real-time fluorescence curve and the end-point fluorescence signal value both reach the strongest, with a signal intensity of about 10,000, so the optimal primer dosage is 2 μL.

[0116] (3) Optimization of the ratio of Cas12a and crRNA

[0117] The reaction system is the same as in step 3, only the dosage ratio of cas12a and crRNA is adjusted to 1:0.5, 1:1, 1:2, 1:3, 1:4 and 1:5. The results are as follows Figure 6 As shown in (A), when the ratio of Cas12a to crRNA is 1:1, both the real-time fluorescence curve and the endpoint fluorescence signal value reach the strongest, with a signal intensity of about 11,000, so the optimal ratio is 1:1.

[0118] (4) Optimization of Cas12a and crRNA concentration and dosage

[0119] The reaction system was the same as in step 3, except that the dosage of cas12a and crRNA complex was adjusted to 1 μM, 2 μM, 3 μM, 4 μM, 5 μM, 7.5 μM and 10 μM. The results were as follows Figure 6 As shown in (B), when the dosage of Cas12a and crRNA complex is 3 μM, the real-time fluorescence curve and the endpoint fluorescence signal value both reach the strongest signal intensity of about 13,000, so the optimal dosage of cas12a and crRNA complex is 3 μM.

[0120] (5) Optimization of PEG dosage

[0121] The reaction system was the same as in step 3, except that the amount of PEG was adjusted to 0 μL, 5 μL, 15 μL, 25 μL, 35 μL and 48.5 μL. The results were as follows: Figure 7 As shown, when the amount of PEG is 25 μL, the real-time fluorescence curve and the end-point fluorescence signal value both reach the strongest, with a signal intensity of about 14,000, so the optimal amount of PEG is 25 μL.

[0122] (6) Optimization of probe types

[0123] The reaction system is the same as in step 3, only the probe types are adjusted to poly C6, poly A6, poly T6 and polyG6. The results are as follows Figure 8 As shown, when the probe type is poly C6, the real-time fluorescence curve and the end-point fluorescence signal value both reach the strongest signal intensity of about 14,000, so the best probe type is poly C6.

[0124] (7) Probe length optimization

[0125] The reaction system is the same as in step 3, only the probe length is adjusted to poly C3, poly C6, poly C12, polyC18, poly C24. The results are as follows Fig. 9As shown, when the probe type is poly C6, the real-time fluorescence curve and the end-point fluorescence signal value both reach the strongest signal intensity of about 14,000, so the optimal probe length is still poly C6.

[0126] (8) Probe concentration optimization

[0127] The reaction system was the same as in step 3, except that the probe concentration was adjusted to 10 μM, 50 μM, 100 μM, 150 μM, 200 μM, 250 μM, and 300 μM. The results were as follows: Fig.10 As shown, when the probe concentration is poly C6, both the real-time fluorescence curve and the endpoint fluorescence signal value reach the strongest, with a signal intensity of about 120,000, so the optimal probe concentration is 250 μM.

[0128] (9) Screening of probe-labeled fluorescent groups

[0129] The reaction system was the same as in step 3, except that the probes were labeled with FAM, ROX, and VIC. The results were as follows: Fig.11 As shown. The positive samples and negative samples were tested for comparison, and the ratio of the two was analyzed using the RGB color model. The experimental results show that in the color visualization system, the ROX probe group analyzed by the R / (R+G+B) algorithm is the group with the highest signal-to-noise ratio. At the same time, we also analyzed the signal-to-noise ratio in the fluorescence mode. The results show that in the fluorescence visualization mode, the strongest signal-to-noise ratio was observed using the ROX probe under the G / (R+G+B) algorithm. The above results indicate that the best probe marker is the ROX probe. Therefore, the ROX probe can be used to develop a one-pot dual-mode visualization system.

[0130] (10) Establishment of a dual-mode visualization reaction system

[0131] In the naked eye color visualization system, the R / (R+G+B) algorithm was used for evaluation, and in the fluorescence visualization system, the G / (R+G+B) algorithm was used for evaluation. Using the optimized reaction conditions, a basic reaction system for dual-mode visualization was established. When the system does not contain any of the components such as the nested RPA system, Cas12a, target, crRNA and probe, no cleavage reaction occurs, and there is no change in color and fluorescence signal. Only when all components are present can the entire reaction proceed normally, resulting in changes in color and fluorescence signals. The experimental results show that a one-pot dual-mode visualization system was successfully established ( Fig.12 ).

[0132] Furthermore, the optimal system for the one-pot CRISPR nucleic acid detection method based on base mismatch is: the primer dosage is 2 μL. The ratio of Cas12a and crRNA is 1:1, the dosage of cas12a and crRNA complex is 3 μM, and the dosage of PEG is 25 μL. The probe is polyC6 (six cytosine bases), the probe concentration is 250 μM, and the label is ROX label.

[0133] The optimal CRISPR cutting system is: Lba Cas12a (3μM): 0.5μL, crRNA (3μM): 0.6μL, MgOAC (280mM): 1μL, pre-assembled at 37℃ for 20min, and then mixed with poly C6 (6 cytosines) probe (250μM): 0.4μL. The nested RPA amplification system is: outer primer set (20μM): 2μL, inner primer set (20μM): 2μL, A buffer (PEG): 25μL, enzyme-free water: 13.5μL, mix well. Take 8μL of the nested RPA system, add 2.5μL of the CRISPR system, 2μL of target DNA and 1μL of B buffer (280mM MgOAC), and fill the total volume to 15μL per well with enzyme-free water. Then start a one-pot reaction for 30 minutes.

[0134] Example 4: Mismatched one-pot assay for detecting gradient dilutions of Salmonella typhimurium and comparison with conventional one-pot assay

[0135] The sensitivity of the one-pot system mediated by crRNA mismatch and the one-pot system mediated by conventional crRNA perfect match (match crRNA) was compared. Fig.13 ). In the mismatch one-pot experiment, the binding affinity of crRNA to the target is reduced, resulting in a decrease in the efficiency of the CRISPR cutting system. At this point, the CRISPR cutting system and the RPA reaction reach a balance and compatibility, thereby achieving sensitive naked eye and fluorescence dual-mode output. For the traditional crRNA matching one-pot system, after the amplification reagent and the CRISPR cutting reagent are added simultaneously in one step, the strong binding force between the matching crRNA and the target leads to high cutting efficiency of the CRISPR system, resulting in tangential target and obvious template degradation, and at the same time, a stronger destructive effect on single-stranded primers in the system. Therefore, when the two systems are simply combined together, compatibility is challenging. At this point, the signals of both color and fluorescence visualization are very weak, making it difficult to achieve a one-pot visualization reaction. The experimental results show that for the crRNA mismatch one-pot system, the detection limit based on the color visualization signal readout is 10 3 CFU / mL( Fig.14 A), this sensitivity can meet the requirements of initial sample screening. In the fluorescence visualization mode, the detection limit can reach 10 1 CFU / mL( Fig.14C), the sensitivity is 100 times that of the color mode. For the traditional one-pot system of crRNA matching, the detection limit of the color method is 10 6 CFU / mL( Fig.14 B), the detection limit of fluorescence display is 10 5 CFU / mL( Fig.14 D). These experimental results further show that compared with the traditional fully matched optimal crRNA, the mismatched crRNA showed better compatibility and higher sensitivity in the one-step one-pot reaction, which is 10,000 times that of the traditional fully matched crRNA-mediated CRISPR one-pot cutting method. The present invention does not require multi-step operation, additional reagents, and complex uncapping steps. It only requires RPA and a one-step one-pot reaction based on Cas12a cutting to achieve color and fluorescence dual-mode visualization, avoiding aerosol contamination, making it more suitable for POCT applications.

[0136] Example 5 Specificity evaluation of mismatch one-pot assay

[0137] In order to investigate the specificity of this method, Salmonella Typhimurium ATCC 14028, Escherichia coli ATCC43888, Vibrio parahaemolyticus ATCC 17802, Staphylococcus aureus ATCC 29213 and Listeria monocytogenes ATCC 19115 were selected for specificity evaluation. Fig.15 ). The sample containing the above-mentioned bacteria was detected using the optimal method established in Example 3. The experimental results show that the present invention has good selectivity. Only the centrifuge tube containing the target bacteria produced visible color and fluorescence signal changes, indicating a positive result. The centrifuge tube without Salmonella typhimurium had no color and fluorescence changes, which indicates that other bacteria will not interfere and cause false positive signals. The specific design of the amplification primers and the mismatched crRNA enables it to specifically detect the desired target.

[0138] Example 6 Evaluation of the universality of the mismatch one-pot experiment, taking Staphylococcus aureus and Listeria monocytogenes as examples

[0139] In order to demonstrate the versatility of the system, the present invention was used for the detection of Staphylococcus aureus and Listeria monocytogenes. The one-step one-pot reaction mediated by mismatched crRNA and fully matched crRNA was compared. The experimental results show that under one-pot conditions, the present invention has higher compatibility and sensitivity for the detection of Staphylococcus aureus and Listeria monocytogenes.

[0140] The details are as follows:

[0141] The detection systems for Staphylococcus aureus and Listeria monocytogenes were both detected using the optimal system described in Example 3.

[0142] Among them, the Staphylococcus aureus sequence is as follows:

[0143] Sau-Match-RNA:

[0144] UAAUUUCUACUAAGUGUAGAUUACAUUAAUUUAACCGUAUCACC;

[0145] Sau-Mis4-RNA (SEQ ID NO.12):

[0146] UAAUUUCUACUAAGUGUAGAUUACUUUAAUUUAACCGUAUCACC;

[0147] Sau-RPA F2 (SEQ ID NO. 13): TAACTTTAGTTTGTAGTTTCAAGTCT;

[0148] Sau-RPA F1 (SEQ ID NO. 14): GCTCAGCAAATGCATCACAAACAGATAACGGCG;

[0149] Sau-RPA R1 (SEQ ID NO. 15): CAGGTGTATCAACCAATAATAGTCTGAATGTCA;

[0150] Sau-RPA R2 (SEQ ID NO. 16): AGGACCATATTTCTCTACACCTTTT.

[0151] The sequence used for Listeria is as follows:

[0152] Lis-Mis4-RNA (SEQ ID NO.17):

[0153] UAAUUUCUACUAAGUGUAGAUUUGAAUAAGCAAUGGGAACU;

[0154] Lis-Match-RNA:UAAUUUCUACUAAGUGUAGAUUUGUAUAAGCAAUGGGAACU;

[0155] Lis-RPA F1 (SEQ ID NO. 18): TTCTTCCTTCAAAGCCGTAATTTACGGAGG;

[0156] Lis RPA F2 (SEQ ID NO. 19): TCATCGACGGCAACCTCGGAGACTT;

[0157] Lis-RPA-R2 (SEQ ID NO. 20): GTTGTTTTTAATAACAGCTAATTCA;

[0158] Lis-RPA-R1 (SEQ ID NO. 21): ACGTATCCTCCAGAGTGATCGATGTTAATT.

[0159] For Staphylococcus aureus, the sensitivity is 10 3 CFU / mL( Fig.16 A), the sensitivity in fluorescence mode is 10 1 CFU / mL ( Fig.16 C). In contrast, the color of the matching crRNA-mediated reaction ( Fig.16 B) and fluorescence mode ( Fig.16 D) Sensitivity is 10 6 CFU / mL. For Listeria monocytogenes, the sensitivity of the present invention in color mode is 10 3 CFU / mL( Fig.17 A), the sensitivity in fluorescence mode is 10 2 CFU / mL( Fig.17 C). In contrast, the one-pot method based on matching crRNA 6 CFU / mL only showed a weak fluorescence signal ( Fig.17 D) with no visible color change ( Fig.17 B). The experimental results show that the present invention has good versatility. Mismatched crRNA shows better performance than matched crRNA in a one-pot reaction, indicating that the replacement and mismatched crRNAs replacing different primers can detect various DNA targets in one step and one pot.

[0160] Example 7 Evaluation of the universality of the mismatch one-pot experiment, taking influenza A virus as an example

[0161] Nucleic acid targets include DNA and RNA, and detecting RNA targets is of great significance for preventing and controlling viral infections. Influenza A (FluA) virus was selected as the target, and the extracted target RNA was reverse transcribed. Subsequently, the effect of the one-pot detection of FluA by the present invention and the fully matched crRNA was compared.

[0162] Influenza A (H1N1) pseudovirus (Shanghai Sangon Biotechnology, China) was used as RNA detection template. TMRNA was extracted according to the instructions of the viral RNA extraction kit (R0035S, Bio-Tech, China), and then Q RTSuperMix requirements (R222, Novozymes, China) were used for reverse transcription and preparation. A one-step one-pot reaction system was used for the reaction: CRISPR cutting system: Lba Cas12a (3μM): 0.5μL, crRNA (3μM): 0.6μL, MgOAC (280mM): 1μL, pre-assembled at 37℃ for 20min, and then mixed with poly C6 (6 cytosines) probe (250μM): 0.4μL. Nested RPA amplification system: outer primer set (20μM): 2μL, inner primer set (20μM): 2μL, A buffer (PEG): 25μL, enzyme-free water: 13.5μL, mixed well. Take 8 μL of the nested RPA system, add 2.5 μL of the CRISPR system, 2 μL of the target and 1 μL of buffer B (280 mM MgOAC), and fill the total volume to 15 μL per well with enzyme-free water. Then start a one-pot reaction for 30 minutes.

[0163] The sequences used for influenza virus are as follows:

[0164] FluA-Mis4-RNA (SEQ ID NO.22):

[0165] UAAUUUCUACUAAGUGUAGAUGCCUUUCCAUGAGAGCCUCA;

[0166] FluA-Match RNA: UAAUUUCUACUAAGUGUAGAUGCCAUUCCAUGAGAGCCUCA;

[0167] FluA-F1 (SEQ ID NO. 23): ACCGAGGTCGAAACGTACGTTTCTTTCTATC;

[0168] FluA-F2 (SEQ ID NO. 24): CCGTCAGGCCCCCTCAAAGC;

[0169] FluA-R2 (SEQ ID NO.25): GCGTGAACACAAATCCTAAA;

[0170] FluA-R1 (SEQ ID NO. 26): TCTACGCTGCAGTCCTGCTCACTGGGCAC.

[0171] Using the color visualization mode, the present invention can detect 10 4 copies / μL ( Fig.18A), while the fluorescence visualization mode is 10 2 copies / μL ( Fig.18 C). In contrast, using the fluorescence mode, the sensitivity of the fully matched crRNA-mediated one-pot system for detecting influenza A was 10 6 copies / μL ( Fig.18 D), the color change is negligible ( Fig.18 B). Therefore, the present invention can also detect viral nucleic acid quickly and sensitively, providing a more convenient tool compared with previous methods.

[0172] Example 8 The present invention and the fluorescence quantitative qPCR method and comparison

[0173] Taking Salmonella typhimurium as an example, the fluorescence quantitative PCR (qPCR) method was used for detection, and the results were as follows: Fig.15 shown.

[0174] Sal-qPCR-Up(5'-3'):GCGGCGTTGGAGAGTGATA;

[0175] Sal-qPCR-Down(5'-3'):AGCAATGGAAAAAGCAGGATG;

[0176] Sal-qPCR-probe(5'-3'): FAM-CATTTCTTAAACGGCGGTGTCTTTCCCT-TAMRA;

[0177] Configure the reaction system and set up the reaction program according to the instructions of the industry standard (SN / T 1870-2016).

[0178] The experimental results showed that the sensitivity of the qPCR method was 10 2 CFU / mL( Fig.19 ), the method of the present invention is 10 times more sensitive than it. More importantly, the present method has the advantages of simple operation (one-step one-pot constant temperature reaction), no need for expensive instruments (previously required a thermal cycler), short detection time (only 30 minutes), and ability to achieve color fluorescence dual-mode visualization, without the need for a fluorescence curve monitoring instrument such as qPCR. Table 2 summarizes the performance comparison of the present invention and the standard qPCR method.

[0179] Table 2 Comparison between the invention and the standard qPCR method

[0180]

[0181] Example 9 The present invention is used for actual sample detection

[0182] Foodborne pathogens pose a significant risk of transmission in the food chain. Therefore, the feasibility of actual sample detection was evaluated using the optimal detection conditions established in Example 3, and 64 meat samples (poultry and pork) from the retail market were collected. The standard qPCR method (SN / T1870-2016) was used as a control method. The results showed that the present invention and the standard qPCR method had a high consistency in detecting Salmonella DNA in food samples. The present invention detected 11 Salmonella-positive samples and 53 negative samples, and the results were consistent with the standard qPCR method ( Fig. 20 ). And the naked eye color mode of the present invention provides a convenient instrument-free method to achieve preliminary screening of samples, while the fluorescence mode provides a powerful tool to further ensure accuracy. This shows that the present invention has great potential in practical applications.

[0183] Example 10 Body temperature driven mismatch one-pot experiment to detect different concentrations of Salmonella typhimurium at different ambient temperatures

[0184] To facilitate field applications, the possibility of using a handheld body temperature-activated crRNA mismatch one-pot reaction for nucleic acid template detection was investigated ( Fig.21 At different ambient temperatures (4°C, 10°C, 25°C and 37°C), Salmonella typhimurium DNA was used as the detection target, and the fist method was used as a heat source to amplify low-concentration templates (10 4 CFU / mL and 10 1 CFU / mL, and a negative control was used as a comparison. The experimental results showed that although different signal intensities were generated at different ambient temperatures, low concentration templates (10 1 CFU / mL). Therefore, the present invention can further reduce the dependence on heating equipment under limited resources. It is more suitable to meet the needs of POCT.

[0185] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A one-pot reaction system for detecting a target object, characterized in that: The reaction system includes mismatched base crRNA, Cas12a protein, nested primer set, fluorescent reporter probe and nested RPA isothermal amplification reaction reagent; Using the target as a template, nested RPA amplification is performed using a nested primer set. The generated activator is recognized by the Cas12a protein / mismatched base crRNA complex, activating the forward and side cutting activities of the Cas12a protein. The high-concentration fluorescent signal probe in the side cutting system can produce color visualization and fluorescent visualization signals after cleavage.

2. The reaction system according to claim 1, characterized in that The target is Salmonella typhimurium; The nucleotide sequence of the mismatched base crRNA is shown in any one of SEQ ID NOs. 1 to 7; the nucleotide sequence of the nested primer set is SEQ ID NOs. 8 to 11.

3. The reaction system according to claim 1, characterized in that The target is Staphylococcus aureus, the nucleotide sequence of the mismatched base crRNA is shown in SEQ ID NO.12, and the nucleotide sequence of the nested primer set is SEQ ID NO.13-16; Or the target is Listeria monocytogenes, the nucleotide sequence of the mismatched base crRNA is shown as SEQ ID NO.17, and the nucleotide sequence of the nested primer set is SEQ ID NO.18-21; Alternatively, the target is influenza A pseudovirus, the nucleotide sequence of the mismatched base crRNA is shown as SEQ ID NO.22, and the nucleotide sequence of the nested primer set is SEQ ID NOs.23-26.

4. The reaction system according to any one of claims 1 to 3, characterized in that: One end of the reporter probe carries a fluorescent group, and the other end carries a quenching group; the nucleotide sequence of the reporter probe is CCCCCC.

5. The reaction system according to any one of claims 1 to 4, characterized in that: The amount of the primer is 0.5 to 3 μL; The ratio of Cas12a to crRNA is 1:0.5-1:5; The concentration of the Cas12a and crRNA complex is 1 μM-10 μM; The amount of PEG is 5 μl-48.5 μL; The concentration of the reporter probe is 50 μM-300 μM.

6. A one-pot method for detecting a target nucleic acid, characterized in that: The method is to detect the nucleic acid of the target object using the reaction system described in any one of claims 1 to 4, and the target object includes Salmonella typhimurium, Staphylococcus aureus, Listeria monocytogenes, and influenza A pseudovirus.

7. The method according to claim 6, characterized in that The specific steps of the method are as follows: (1) Incubate Cas12a protein and mismatched base crRNA at 30-40°C for 10-20 minutes; (2) adding the sample to be tested, the nested primer set and the fluorescent reporter probe, as well as MgOAC and other reagents for the nested RPA amplification reaction to the mixed solution; (3) Incubate at 30-40°C for 20-60 min.

8. A kit, characterized in that: The kit contains the reaction system according to any one of claims 1 to 5.

9. Use of the reaction system according to any one of claims 1 to 5, or the method according to claim 6 or 7, or the kit according to claim 8 in detecting foodborne pathogens.

10. The use according to claim 9, characterized in that: The foodborne pathogens include Salmonella, Escherichia coli, and Staphylococcus aureus.

Images