Breeding method of pepper germplasm resistant to tobacco mild green mosaic virus

Abstract

The invention discloses a pepper germplasm breeding method for resisting tobacco mild green mosaic virus. The method comprises the following steps: acquiring disease-resistant and susceptible materials, constructing RIL and F2 populations, and determining that the disease resistance character is regulated by recessive single genes through F2 segregation population construction and phenotype identification analysis. Gene initial localization is completed by utilizing a BSA (Bovine Serum Albumin) technology and a GBS (Gene Based Sequence) technology and is further finely localized between molecular markers P1332A10 and P1332A12, and P1332A11 is a co-separation marker. According to the method, disease-resistant germplasm can be screened in the seedling stage, the cultivation management and virus inoculation identification cost is saved, and important materials and gene resources are provided for antiviral breeding.

Description

Technical Field

[0001] The invention relates to, in particular to a method for breeding pepper germplasm resistant to tobacco mild green mosaic virus. Background Art

[0002] Pepper is the world's most consumed spicy condiment and one of my country's main vegetable crops. It has important economic value and plays a huge role in increasing farmers' income and rural revitalization. However, pepper virus disease has always been the main disease that harms my country's pepper industry. Among them, the main symptoms of pepper caused by tobacco mild green mosaic virus (TMGMV) are mosaic deformity and dwarfing of plants. Some isolates can also cause chlorotic stripes on fruits, which seriously affect the yield and quality of peppers and cause huge economic losses. At present, no effective measures have been found in production to deal with this virus. It is mainly through timely discovery and removal of diseased plants for prevention and control, but the virus is easy to spread through machinery and seeds, and the prevention and control effect is very small. Cultivating virus-resistant pepper varieties is the most economical and effective means, but the resistant germplasm, disease-resistant genes and markers for the virus have been discovered less. Mining new disease-resistant germplasm and antiviral genes, and developing molecular markers closely linked to the virus can provide important materials and gene resources for antiviral breeding. Summary of the invention

[0003] The present invention aims to provide a method for breeding pepper germplasm resistant to tobacco mild green mosaic virus, so as to solve the problems that tobacco mild green mosaic virus causes pepper mosaic deformity and plant dwarfing, seriously affecting pepper yield and quality, causing huge economic losses, lacking effective prevention and control measures, and insufficient discovery of disease-resistant germplasm and genes.

[0004] To achieve the above object, the present invention provides the following technical solution: a method for breeding pepper germplasm resistant to tobacco mild green mosaic virus, comprising the following steps:

[0005] Step 1: Obtain excellent germplasm resources A198 resistant to tobacco mild green mosaic virus and susceptible material A204;

[0006] Step 2: Use the disease-resistant material A198 and the disease-susceptible material A204 to construct RIL populations and F2 populations, and confirm that the F1 generation is susceptible to the disease through phenotypic identification. Phenotypic identification was performed on 152 offspring plants of the F2 population, of which 35 showed resistance and 117 showed susceptible, with a segregation ratio of 3:1, thus proving that the disease resistance trait is regulated by a recessive single gene;

[0007] Step 3: Perform BSA sequencing on the disease-resistant parent, the disease-susceptible parent, the disease-resistant mixed pool DNA composed of 30 disease-resistant RIL individual plants, and the disease-susceptible mixed pool DNA composed of 30 disease-susceptible RIL individual plants to complete the initial positioning of the gene;

[0008] Step 4: Use GBS technology to further sequence and analyze the disease-resistant parents, susceptible parents and RIL populations, and combine the SNP genetic map to locate the disease-resistant gene in a specific interval on the pepper chromosome;

[0009] Step 5: Develop molecular markers based on the positioning results and sequencing data, and locate the gene between molecular markers P1332A10 and P1332A12, where P1332A11 is a co-segregated marker.

[0010] Specifically, the phenotype in step 2 is a TMGMV resistance phenotype, and its identification method comprises the following steps:

[0011] (a) Virus friction inoculation: The material was planted in a 72-hole seedling tray and virus inoculation was performed when it grew about 7 true leaves;

[0012] (b) Post-vaccination virus detection was performed using both RT-qPCR technology and enzyme-linked immunosorbent assay (DAS-ELISA).

[0013] Specifically, step three uses BSA technology to complete the preliminary positioning of the gene.

[0014] Specifically, step five completed further fine positioning based on genotyping of the RIL population and the F2 population.

[0015] Specifically, the plant contains a molecular marker P1332A11, which is co-segregated with a gene for resistance to tobacco mild green mosaic virus.

[0016] Specifically, whether the plant has the antiviral phenotype conferred by the antiviral gene is predicted by detecting the presence of the molecular marker P1332A11.

[0017] Specifically, the method comprises the following steps:

[0018] (a) Extracting DNA samples from pepper plants;

[0019] (b) PCR amplification using molecular marker P1332A11;

[0020] (c) Analyze the PCR products to determine whether the plants have marker P1332A11.

[0021] The principle and beneficial effects of this technical solution:

[0022] (1) Combining RT-qPCR technology and enzyme-linked immunosorbent assay (DAS-ELISA) to perform phenotypic detection after virus inoculation greatly improves the accuracy of phenotypic identification.

[0023] (2) Combining BSA technology and GBS technology to locate the disease resistance gene and develop linkage markers can greatly improve the accuracy of positioning.

[0024] (3) This technology can be used to screen disease-resistant germplasm at the seedling stage, greatly saving the costs of pepper plant cultivation management and virus inoculation and identification. DETAILED DESCRIPTION

[0025] The following embodiments further describe the present invention in detail:

[0026] An excellent germplasm resource A198 with resistance to tobacco mild green mosaic virus (TMGMV) was screened, and the susceptible material A204 was obtained at the same time. The RIL (recombinant inbred line) population and F2 population were constructed using the resistant material A198 and the susceptible material A204. Through phenotypic identification, it was confirmed that the F1 generation was susceptible to the disease. Among the 152 offspring plants in the F2 population, 35 showed resistance and 117 showed susceptible, and the segregation ratio was 3:1 (χ2=0.32, P=0.57), which indicated that the disease resistance trait was regulated by a recessive single gene. This discovery provides important genetic information for subsequent gene mapping.

[0027] In order to complete the initial positioning of the gene, BSA sequencing was performed on the disease-resistant parent, the susceptible parent, the disease-resistant mixed pool DNA consisting of 30 disease-resistant RIL individual plants, and the disease-susceptible mixed pool DNA consisting of 30 susceptible RIL individual plants, and the initial positioning of the gene was successfully completed.

[0028] In order to further improve the accuracy of positioning, GBS technology was used to further sequence and analyze the disease-resistant parents, susceptible parents and RIL populations. Combined with the SNP genetic map, the disease-resistant gene was located in a specific interval on the pepper chromosome.

[0029] On the basis of the initial positioning, genotyping was performed based on the RIL population and the F2 population to complete further fine positioning. Appropriate primers were designed using Primerpremier 5 software, and PCR amplification was performed using the DNA of individual plants in the population as a template. The amplified products were used to construct sequencing libraries and sequenced using the Illumina HiSeq 6000 platform. The sequencing data were aligned to the reference genome using the BWA software, and genotyping was performed using the SAM software. Finally, the disease resistance gene was located between the molecular markers P1332A10 and P1332A12, of which P1332A11 was a co-segregated marker.

[0030] In terms of resistance phenotype identification, the virus friction inoculation method was used. The materials were planted in a 72-hole (6×12) seedling tray, and each strain was planted in a row, with a total of 6 replicates. When the plant grows about 7 true leaves, the virus inoculation is carried out. Water it enough the night before inoculation, put the leaves of the fresh virus source into a mortar, add appropriate amount of carbon powder and 0.1M potassium dihydrogen phosphate virus extraction buffer (pH=7.0) and grind them for later use. When inoculating, remove the two true leaves at the bottom and select 3 consecutive leaves from bottom to top for inoculation. After the inoculation is completed, indicate the inoculation time on the label.

[0031] In order to verify the inoculation effect, RT-qPCR technology and enzyme-linked immunosorbent assay (DAS-ELISA) were used for post-inoculation virus detection. Two weeks after TMGMV inoculation, three consecutive compound leaves below the top of the plant were taken for RT-qPCR detection. The quantitative primers used included: virus primers qPCR-TMGMV-CP-F1 (AACGCGACTCAGAGGGTAGA) and qPCR-TMGMV-CP-R1 (CATGCCAGTTCCACGAACCA), as well as internal reference primers GAPDH-qF3 (GGCTGCCATTAAGGAGGAGTCTG) and GAPDH-qR3 (ACCACTCGCGTGCTGTAACCC). Four weeks after TMGMV inoculation, three consecutive compound leaves below the top of the plant were taken again for DAS-ELISA virus detection. The kit used was the TobaccoMild Green Mosaic Virus (TMGMV)-DAS ELISA Kit produced by Nano Diagnostics, USA.

[0032] Through the breeding method provided by the present invention, the screening of disease-resistant germplasm can be completed at the seedling stage, thereby greatly saving the costs required for pepper plant cultivation management and virus inoculation identification. At the same time, the phenotypic detection after virus inoculation is carried out by combining RT-qPCR technology and enzyme-linked immunosorbent assay (DAS-ELISA), which greatly improves the accuracy of phenotypic identification. In addition, the positioning of disease-resistant genes and the development of linkage markers are carried out by combining BSA technology and GBS technology, which also greatly improves the accuracy of positioning.

[0033] The above is only an embodiment of the present invention, and the common knowledge such as the known specific technical solutions or characteristics in the solution is not described in detail here. For those skilled in the art, without departing from the technical solution of the present invention, several modifications and improvements can be made, which should also be regarded as the protection scope of the present invention, and these will not affect the effect of the implementation of the present invention and the practicality of the patent. The scope of protection required by this application shall be based on the content of its claims, and the specific implementation methods and other records in the specification can be used to interpret the content of the claims.

Claims

1. A method for breeding pepper germplasm resistant to tobacco mild green mosaic virus, characterized in that: The following steps are involved: Step 1: Obtain excellent germplasm resources A198 resistant to tobacco mild green mosaic virus and susceptible material A204; Step 2: Use the disease-resistant material A198 and the disease-susceptible material A204 to construct RIL populations and F2 populations, and confirm that the F1 generation is susceptible to the disease through phenotypic identification. Phenotypic identification was performed on 152 offspring plants of the F2 population, of which 35 showed resistance and 117 showed susceptible, with a segregation ratio of 3:1, thus proving that the disease resistance trait is regulated by a recessive single gene; Step 3: Perform BSA sequencing on the disease-resistant parent, the disease-susceptible parent, the disease-resistant mixed pool DNA composed of 30 disease-resistant RIL individual plants, and the disease-susceptible mixed pool DNA composed of 30 disease-susceptible RIL individual plants to complete the initial positioning of the gene; Step 4: Use GBS technology to further sequence and analyze the disease-resistant parents, susceptible parents and RIL populations, and combine the SNP genetic map to locate the disease-resistant gene in a specific interval on the pepper chromosome; Step 5: Develop molecular markers based on the positioning results and sequencing data, and locate the gene between molecular markers P1332A10 and P1332A12, where P1332A11 is a co-segregated marker.

2. The method for breeding pepper germplasm resistant to tobacco mild green mosaic virus according to claim 1, characterized in that: The phenotype in step 2 is a TMGMV resistance phenotype, and its identification method comprises the following steps: (a) Virus friction inoculation: The material was planted in a 72-hole seedling tray and virus inoculation was performed when it grew about 7 true leaves; (b) Post-vaccination virus detection was performed using both RT-qPCR technology and enzyme-linked immunosorbent assay (DAS-ELISA).

3. The method for breeding pepper germplasm resistant to tobacco mild green mosaic virus according to claim 1, characterized in that: Step three uses BSA technology to complete the preliminary positioning of the gene.

4. The method for breeding pepper germplasm resistant to tobacco mild green mosaic virus according to claim 1, characterized in that: Step five completed further fine positioning by genotyping based on the RIL population and F2 population.

5. The method for breeding pepper germplasm resistant to tobacco mild green mosaic virus according to claim 1, characterized in that: The plant contains a molecular marker P1332A11, which is co-segregated with a disease resistance gene for tobacco mild green mosaic virus.

6. The method for breeding pepper germplasm resistant to tobacco mild green mosaic virus according to claim 1, characterized in that: By detecting the presence of molecular marker P1332A11, it is predicted whether the plant has the antiviral phenotype conferred by the antiviral gene.

7. The method for breeding pepper germplasm resistant to tobacco mild green mosaic virus according to claim 6, characterized in that: The method comprises the following steps: (a) Extracting DNA samples from pepper plants; (b) PCR amplification using molecular marker P1332A11; (c) Analyze the PCR products to determine whether the plants have marker P1332A11.