Capture oligonucleotide combination, kit and method for nucleic acid amplification

Abstract

The invention relates to a capture oligonucleotide combination, a composition or a kit and a method for nucleic acid amplification. Specifically, the combination comprises a reverse capture oligonucleotide and a forward capture oligonucleotide: 1) the reverse capture oligonucleotide sequentially comprises a first universal sequence (3a) and a first binding capture sequence (2a) from the 5'end to the 3 'end; wherein the first binding capture sequence (2a) is complementary to the 3'terminal sequence of the target molecule; (2) the forward capture oligonucleotide sequentially comprises a second universal sequence (4s) and a second binding capture sequence (1s) from the 5'end to the 3 'end; wherein the second binding capture sequence (1s) is at least partially identical to the 5'terminal sequence of the target molecule, and the capture oligonucleotide further comprises nucleic acid extension blocking modification located at the 3 'terminal of the binding capture sequence (2a / 1s). According to the product and the method, multiple nucleic acid detection with good specificity and high sensitivity can be achieved.

Description

Technical Field

[0001] The present invention relates to the field of detection technology, and in particular to a capture oligonucleotide combination, composition, kit and method for nucleic acid amplification. Background Art

[0002] Nucleic acid amplification has not only driven the development of basic biological theoretical research, but also revolutionized the analytical techniques of clinical science. The applications of these technologies include molecular cloning, nucleic acid sequencing, genotyping and mutation detection and identification, and quantitative detection of gene expression. In clinical research, due to the scarcity of samples, as the scale of the project expands, the detection method of single-reaction reaction is costly and inefficient. Therefore, it is particularly important to develop nucleic acid amplification detection reagents that can be used in clinical practice. However, the current PCR amplification is prone to primer-dimer interactions or the generation of pseudoamplicons generated by two different primers when amplifying multiple targets.

[0003] DNA methylation refers to the covalent bonding of a methyl group to the 5th carbon position of cytosine in the genomic CpG dinucleotide under the action of DNA methyltransferase. It can affect the expression level of genes without changing the DNA sequence, and is one of the important research contents of epigenetics. DNA methylation plays an important role in the occurrence and development of many human diseases, such as tumors, cardiovascular diseases, diabetes, etc., and is one of the hot spots in basic research and clinical application research.

[0004] The significance of early detection of tumors is that it can increase the probability of tumor cure, reduce the mortality rate of tumors, and improve the quality of life. Liquid biopsies represented by ctDNA are the focus of early diagnosis of tumors because they are non-invasive and can be repeated at different stages of the tumor. ctDNA collected from plasma and urine body fluids has increasingly become a source of tumor diagnostic applications. Information derived from tumor cells can be identified by detecting tumor-specific mutations or DNA methylation patterns. However, the content of cfDNA in body fluids is extremely low, and the plasma cfDNA content of healthy people is only about 5-10ng / ml. Therefore, the biggest technical difficulty in cfDNA methylation detection is how to use trace amounts of cfDNA samples to detect very small amounts of abnormally methylated genes.

[0005] At present, the method based on bisulfite conversion is the mainstream choice for cfDNA methylation detection. However, since bisulfite conversion requires strict chemical conditions, there are many shortcomings: 1) Incomplete conversion will lead to false positives; 2) The conversion process will cause DNA degradation and fragmentation, resulting in reduced sensitivity; 3) Since the conversion process will change the base information in the sequence, this will cause the sequence to lose complexity and amplification preference; 4) A cumbersome desulfonation and other purification processes are required for subsequent analysis. In addition, ctDNA also has special problems caused by high fragmentation and low content.

[0006] Therefore, developing a method that is simple, fast, highly sensitive, and highly specific for detecting trace amounts of nucleic acids and their methylation status is a pain point and difficulty that urgently needs to be addressed in this field. Summary of the invention

[0007] The present invention aims to provide a method for detecting trace nucleic acids and their methylation states, which is simple and quick to operate, highly sensitive and highly specific.

[0008] The inventors have developed a nucleic acid detection system that utilizes site-specific cutting nucleases and universal primer-based amplification, which can detect trace amounts of nucleic acid and its methylation status, and has the advantages of simple and fast operation, high sensitivity, and high specificity.

[0009] In a first aspect of the present invention, a capture oligonucleotide for nucleic acid amplification is provided, wherein the capture oligonucleotide comprises a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is complementary to the 3' terminal sequence of the target molecule or is at least partially identical to the 5' terminal sequence of the target molecule, and the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence,

[0010] Optionally, the capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the universal sequence or at the 5' end of the combined capture sequence.

[0011] The universal sequence is independent of the target molecule sequence.

[0012] In another preferred embodiment, the capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the universal sequence or bound to the 5' end of the capture sequence.

[0013] In another preferred embodiment, the 3' end of the binding capture sequence is modified with a nucleic acid analog.

[0014] In another preferred embodiment, the nucleic acid analog modification is selected from the following group: peptide nucleic acid, locked nucleic acid, transposed base, Spacer, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine (2'-deoxyuridine), 2-fluoro RNA, 2'-fluoro RNA, or a combination thereof.

[0015] In another preferred embodiment, the nucleic acid extension blocking modification is selected from the following group: Spacer, amino, C6, methyl, azide, phosphoramidite, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or a combination thereof.

[0016] In another preferred embodiment, the binding capture sequence is complementary to the terminal sequence of the target molecule.

[0017] In another preferred embodiment, the binding capture sequence is complementary to the non-5' terminal sequence of the target molecule.

[0018] In another preferred embodiment, the universal primer comprises a sequence identical or partially identical to the 5' end of the capture oligonucleotide.

[0019] In another preferred embodiment, the enzyme recognition label contained in the capture oligonucleotide is selected from the following group: / idsP / , RNA base modification.

[0020] In another preferred embodiment, the enzyme that recognizes the enzyme recognition tag contained in the capture oligonucleotide is selected from one or more of the following: 3'Tth endonuclease, thermostable mismatch repair enzyme and thermostable RNase H.

[0021] In another preferred embodiment, the target molecule is a target molecule with clear sequences at the 3' and 5' ends. Preferably, the target molecule is a cleavage product of a site-specific nuclease, for example, a target molecule with clear sequences at both ends due to cleavage by a site-specific nuclease.

[0022] In another preferred embodiment, the site-specific cutting nuclease is an exonuclease and / or an endonuclease.

[0023] In another preferred embodiment, the site-specific cutting nuclease is selected from the following group: AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), endonuclease (e.g., nucleic acid restriction endonuclease, such as MspⅠ, Xmal, etc.), methylation-dependent nucleic acid restriction endonuclease, methylation-sensitive nucleic acid restriction endonuclease, nickase, giant nuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas system, mismatch repair enzyme, or a combination thereof.

[0024] In another preferred embodiment, the endonuclease is selected from the group consisting of a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

[0025] In another preferred embodiment, the CRISPR-Cas system comprises a guiding short RNA that matches the target DNA fragment and an endonuclease that can recognize and cut a specific sequence, such as a CRISPR-Cas system based on Cas9, Cas12 or Cas13.

[0026] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the following group: Gla I, FspE I, MspJI, LpnPI, or a combination thereof.

[0027] In a second aspect of the present invention, a capture oligonucleotide combination for nucleic acid amplification is provided, the combination comprising a reverse capture oligonucleotide and a forward capture oligonucleotide:

[0028] (1) The reverse capture oligonucleotide comprises a first universal sequence (3a) and a first binding capture sequence (2a) from the 5' end to the 3' end; wherein,

[0029] The first binding capture sequence (2a) is complementary to the 3' end sequence of the target molecule;

[0030] The reverse capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the first binding capture sequence;

[0031] (2) the forward capture oligonucleotide includes a second universal sequence (4s) and a second binding capture sequence (1s) from the 5' end to the 3' end;

[0032] wherein the second binding capture sequence (1s) is at least partially identical to the 5' end sequence of the target molecule;

[0033] The forward capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the second binding capture sequence (1s);

[0034] Optionally,

[0035] The reverse capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the first universal sequence or the 5' end of the first binding capture sequence;

[0036] The forward capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the second universal sequence or the 5' end of the second binding capture sequence;

[0037] The universal sequence is independent of the target molecule sequence.

[0038] In another preferred embodiment, the nucleic acid extension blocking modification is selected from the following group: Spacer, amino, C6, methyl, azide, phosphoramidite, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or a combination thereof.

[0039] In another preferred embodiment, the 3' end of the first binding capture sequence and / or the 3' end of the second binding capture sequence are modified with a nucleic acid analog.

[0040] In another preferred embodiment, the nucleic acid analog modification is selected from the following group: peptide nucleic acid, locked nucleic acid, transposed base, Spacer, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine (2'-deoxyuridine), 2-fluoro RNA, 2'-fluoro RNA, or a combination thereof.

[0041] In another preferred embodiment, the universal primer comprises a sequence identical or partially identical to the 5' end of the capture oligonucleotide.

[0042] In another preferred embodiment, the enzyme recognition label contained in the capture oligonucleotide is selected from the following group: / idsP / , RNA base modification.

[0043] In another preferred embodiment, the enzyme that recognizes the enzyme recognition tag contained in the capture oligonucleotide is selected from one or more of the following: 3'Tth endonuclease, thermostable mismatch repair enzyme and thermostable RNase H.

[0044] In another preferred embodiment, the target molecule is a target molecule with clear sequences at the 3' and 5' ends. Preferably, the target molecule is a cleavage product of a site-specific nuclease, for example, a target molecule with clear sequences at both ends due to cleavage by a site-specific nuclease.

[0045] In another preferred embodiment, the site-specific cutting nuclease is an exonuclease and / or an endonuclease.

[0046] In another preferred embodiment, the site-specific cutting nuclease is selected from the following group: AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), endonuclease (e.g., nucleic acid restriction endonuclease, such as MspⅠ, Xmal, etc.), methylation-dependent nucleic acid restriction endonuclease, methylation-sensitive nucleic acid restriction endonuclease, nickase, giant nuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas system, mismatch repair enzyme, or a combination thereof.

[0047] In another preferred embodiment, the endonuclease is selected from the group consisting of a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

[0048] In another preferred embodiment, the CRISPR-Cas system comprises a guiding short RNA that matches the target DNA fragment and an endonuclease that can recognize and cut a specific sequence, such as a CRISPR-Cas system based on Cas9, Cas12 or Cas13.

[0049] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the following group: Gla I, FspE I, MspJI, LpnPI, or a combination thereof.

[0050] The third aspect of the present invention provides a composition or a kit for nucleic acid amplification, wherein the composition or the kit comprises the capture oligonucleotide according to the first aspect of the present invention or the capture oligonucleotide combination according to the second aspect of the present invention.

[0051] In another preferred embodiment, the capture oligonucleotide is the capture oligonucleotide described in the first aspect of the present invention or the capture oligonucleotide in the capture oligonucleotide combination described in the second aspect of the present invention.

[0052] In another preferred embodiment, the capture oligonucleotide is the reverse capture oligonucleotide and / or the forward capture oligonucleotide in the capture oligonucleotide combination described in the second aspect of the present invention.

[0053] In another preferred embodiment, the composition or kit is a composition or kit for nucleic acid detection.

[0054] In another preferred embodiment, the composition or kit includes a capture oligonucleotide and a universal primer, and the capture oligonucleotide includes a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is complementary to the 3' terminal sequence of the target molecule or is at least partially identical to the 5' terminal sequence of the target molecule, and the capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence.

[0055] In another preferred embodiment, the capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the universal sequence or at the 5' end bound to the capture sequence.

[0056] In another preferred embodiment, the composition or kit further comprises a target molecule pre-sequence pretreatment reagent.

[0057] In another preferred embodiment, the target molecule pre-sequence pretreatment reagent includes a site-specific cutting nuclease.

[0058] In another preferred embodiment, the composition or kit further comprises a site-specific cutting nuclease.

[0059] In another preferred embodiment, the site-specific cutting nuclease is selected from the following group: exonuclease, endonuclease, or a combination thereof.

[0060] In another preferred embodiment, the site-specific cutting nuclease is selected from the following group: AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), endonuclease (e.g., nucleic acid restriction endonuclease, such as MspⅠ, Xmal, etc.), methylation-dependent nucleic acid restriction endonuclease, methylation-sensitive nucleic acid restriction endonuclease, nickase, giant nuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas system, mismatch repair enzyme, or a combination thereof.

[0061] In another preferred embodiment, the endonuclease is selected from the group consisting of a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

[0062] In another preferred embodiment, the CRISPR-Cas system comprises a guiding short RNA that matches the target DNA fragment and an endonuclease that can recognize and cut a specific sequence, such as a CRISPR-Cas system based on Cas9, Cas12 or Cas13.

[0063] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the following group: Gla I, FspE I, MspJI, LpnPI, or a combination thereof.

[0064] In another preferred embodiment, the composition or kit further comprises DNA polymerase, dNTP, Mg 2+ , or a combination thereof.

[0065] In another preferred embodiment, the composition or kit further comprises an enzyme digestion buffer and / or a PCR buffer.

[0066] In another preferred embodiment, the composition or kit further comprises a universal primer,

[0067] (1) The universal primer is unrelated to the target molecule sequence; and

[0068] (2) the universal primer comprises a sequence identical or partially identical to the capture oligonucleotide (5' end);

[0069] Preferably, the first universal primer is identical or partially identical to the 5' end sequence of the reverse capture oligonucleotide, or the second universal primer is identical or partially identical to the 5' end sequence of the forward capture oligonucleotide.

[0070] In another preferred embodiment, the composition or kit further comprises a universal primer and / or a detection probe.

[0071] In another preferred embodiment, the composition or kit further comprises a detection probe.

[0072] In another preferred embodiment, the detection probe is labeled with a fluorescent group and / or a quencher group.

[0073] In another preferred embodiment, the fluorescent group is labeled at the 5' end of the detection probe; and the quencher group is labeled at the 3' end of the detection probe.

[0074] In another preferred embodiment, the fluorescent group is selected from the following group: FAM, VIC, JOE, TET, CY3, CY5, ROX, TexasRed, LC RED460, or a combination thereof; the quenching group is selected from the following group: BHQ1, BHQ2, BHQ3, Dabcy1, Tamra, or a combination thereof.

[0075] The fourth aspect of the present invention provides a method for nucleic acid amplification or detection, the method comprising the step of using a capture oligonucleotide to bind to a target molecule, the capture oligonucleotide being as described in the first aspect of the present invention.

[0076] In another preferred embodiment, the capture oligonucleotide is the capture oligonucleotide described in the first aspect of the present invention or the capture oligonucleotide in the capture oligonucleotide combination described in the second aspect of the present invention.

[0077] In another preferred embodiment, the capture oligonucleotide is the reverse capture oligonucleotide and / or the forward capture oligonucleotide in the capture oligonucleotide combination described in the second aspect of the present invention.

[0078] In another preferred embodiment, the method comprises the steps of treating the linear extension product of the target molecule and then amplifying it using universal primers and / or capture oligonucleotides to obtain an amplified product.

[0079] In another preferred embodiment, the present invention provides a method for nucleic acid amplification or detection, the method comprising the steps of:

[0080] (a) using a capture oligonucleotide to bind to a target molecule (i.e., using a capture oligonucleotide to bind to a target molecule);

[0081] (b) Linear extension of target molecules;

[0082] (d) Universal primer exponential amplification,

[0083] The capture oligonucleotide is the capture oligonucleotide described in the first aspect of the present invention or the reverse capture oligonucleotide and / or the forward capture oligonucleotide in the capture oligonucleotide combination described in the second aspect of the present invention, and the universal primer is irrelevant to the target molecule sequence.

[0084] Typically, the capture oligonucleotide includes a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is complementary to the 3' terminal sequence of the target molecule or is at least partially identical to the 5' terminal sequence of the target molecule, and the capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, and the universal primer is unrelated to the target molecule sequence.

[0085] In another preferred embodiment, the method (direct method) comprises:

[0086] (1) The reverse capture oligonucleotide binds to the target molecule with a clear 3' end sequence by binding to the capture sequence;

[0087] (2) the target molecule is extended using the reverse capture oligonucleotide as a template, and a sequence (3s) complementary to the first universal sequence (3a) is added to the 3' end of the target molecule to obtain a linear extension product of the target molecule;

[0088] (3) The 3' end of the linear extension product of the target molecule is complementary to the first universal primer (3a);

[0089] (4) the first universal primer performs an extension reaction using the linear extension product of the target molecule as a template, and a sequence complementary to the linear extension product of the target molecule is added to the 3' end of the first universal primer to obtain the linear extension product of the first universal primer (3a) (3'1a-2a-3a 5');

[0090] (5) The forward capture oligonucleotide is complementary to the linear extension product of the first universal primer,

[0091] (6) the linear extension product of the first universal primer is subjected to an extension reaction using the forward capture oligonucleotide as a template, and a sequence (4a) complementary to the second universal sequence (4s) is added to the 3' end of the linear extension product of the first universal primer to obtain a second universal primer linear extension product (3'4a-1a-2a-3a 5'), wherein the second universal primer linear extension product is a single-stranded product having the first universal primer sequence (3a) and the second universal primer complementary sequence (4a) at the 5' and 3' ends, respectively, and containing a target molecule complementary sequence in the middle.

[0092] (7) The first universal primer and the second universal primer perform exponential amplification using the linear extension product of the second universal primer as a template to obtain an amplified product.

[0093] In another preferred embodiment, the method further comprises the step of: (8) using a probe and detecting a probe signal.

[0094] In another preferred embodiment, the capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the universal sequence or at the 5' end of the capture sequence.

[0095] In another preferred embodiment, the method comprises the steps of:

[0096] (a) using a capture oligonucleotide to bind to a target molecule (i.e., using a capture oligonucleotide to bind to a target molecule);

[0097] (b) Linear extension of target molecules;

[0098] (c) Enzyme-specific recognition and cleavage;

[0099] (d) Universal primer exponential amplification;

[0100] The capture oligonucleotide is the capture oligonucleotide described in the first aspect of the present invention or the reverse capture oligonucleotide and / or the forward capture oligonucleotide in the capture oligonucleotide combination described in the second aspect of the present invention, and the universal primer is irrelevant to the target molecule sequence.

[0101] Typically, the capture oligonucleotide includes a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is complementary to the 3' terminal sequence of the target molecule or is at least partially identical to the 5' terminal sequence of the target molecule, the capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, the capture oligonucleotide also includes an enzyme recognition label located at the 3' end of the universal sequence or the 5' end of the binding capture sequence, and the universal primer is unrelated to the target molecule sequence.

[0102] In another preferred embodiment, the method (cutting method) comprises:

[0103] (1) The reverse capture oligonucleotide binds to the target molecule with a clear 3' end sequence by binding to the capture sequence.

[0104] (2) The target molecule is extended using the reverse capture oligonucleotide as a template, and a sequence (3s) complementary to the first universal primer (3a) is added to the 3' end of the target molecule to obtain a linear extension product of the target molecule.

[0105] (3) The enzyme specifically recognizes the linear extension product of the target molecule and the enzyme cleavage site in the reverse capture oligonucleotide binding dimer and cleaves it to obtain a reverse capture oligonucleotide cleavage product containing a free 3' end.

[0106] (4) the reverse capture oligonucleotide cleavage product containing a free 3' end, using the linear extension product of the target molecule as a template for extension reaction, adding the target molecule complementary sequence to the 3' end of the reverse capture oligonucleotide cleavage product containing a free 3' end, to obtain a first universal primer linear extension product,

[0107] (5) The forward capture oligonucleotide is complementary to the linear extension product of the first universal primer,

[0108] (6) the linear extension product of the first universal primer is subjected to an extension reaction using the forward capture oligonucleotide as a template, and a sequence (4a) complementary to the second universal primer is added to the 3' end of the linear extension product of the first universal primer to obtain a second universal primer linear extension product (3'4a-1a-2a-3a 5'), wherein the second universal primer linear extension product is a single-stranded product having the first universal primer sequence (3a) and the second universal primer complementary sequence (4a) at the 5' and 3' ends, respectively, and containing a target molecule complementary sequence in the middle.

[0109] (7) The linear extension product of the second universal primer can be exponentially amplified based on the reverse capture oligonucleotide and the forward capture oligonucleotide under the action of enzyme specific recognition, or directly exponentially amplified based on the first universal primer and the second universal primer to obtain an amplified product.

[0110] In another preferred embodiment, the method further comprises the step of: (8) using a probe and detecting a probe signal.

[0111] In another preferred embodiment, the universal primer comprises a sequence identical or partially identical to the 5' end of the capture oligonucleotide.

[0112] In another preferred embodiment, the target molecule is a target molecule with clear sequences at the 3' end and the 5' end.

[0113] In another preferred embodiment, the target molecule is the cleavage product of a site-specific cleavage nuclease.

[0114] In another preferred embodiment, the target molecule with clear sequences at the 3' and 5' ends is a DNA cleavage product of a site-specific nuclease, preferably a target molecule with clear sequences at both ends due to cleavage by a site-specific nuclease.

[0115] In another preferred example, the DNA includes cfDNA.

[0116] In another preferred embodiment, the 3' end of the combined capture sequence of the reverse capture oligonucleotide and the forward capture oligonucleotide has a nucleic acid analog modification and the 3' end contains a nucleic acid extension blocking modification.

[0117] In another preferred embodiment, the method further comprises using / idsP / and RNA base modification.

[0118] In another preferred embodiment, the restriction enzyme recognition tag at the 3' end of the universal sequence contained in the capture oligonucleotide or at the 5' end of the capture sequence is selected from one or more of the following: / idsP / and RNA base modification.

[0119] In another preferred embodiment, the enzyme that recognizes the enzyme recognition tag contained in the capture oligonucleotide is selected from one or more of the following: 3'Tth endonuclease, thermostable mismatch repair enzyme and thermostable RNase H.

[0120] In another preferred embodiment, the site-specific cutting nuclease is an exonuclease and / or an endonuclease.

[0121] In another preferred embodiment, the endonuclease is a restriction endonuclease.

[0122] In another preferred embodiment, the endonuclease is selected from the group consisting of a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

[0123] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the group consisting of Gla I, FspEI, MspJI, LpnPI, or a combination thereof.

[0124] The fifth aspect of the present invention also provides a nucleic acid detection system, which includes the capture oligonucleotide described in the first aspect of the present invention or the capture oligonucleotide combination described in the second aspect of the present invention or the composition or kit described in the third aspect of the present invention, Taq polymerase, dNTP, MgCl2 and PCR buffer.

[0125] In another preferred embodiment, the system includes 1-100 nM of the capture oligonucleotide described in the first aspect of the present invention or the capture oligonucleotide combination described in the second aspect of the present invention, 1-5 U (preferably 1-2 U) Taq polymerase, 50-500 μM (preferably 100-300 μM) dNTP, 1-5 mM (preferably 1-3 mM) MgCl2 and PCR buffer.

[0126] In another preferred embodiment, the system further comprises primers (universal primers) and probes (specific probes, universal probes).

[0127] In another preferred embodiment, the system further comprises 100-800 nM (preferably 100-400 nM) universal primers.

[0128] In another preferred embodiment, the system further comprises 100-600 nM (preferably 100-300 nM) probes.

[0129] In another preferred embodiment, the system further comprises at least 20 U (preferably 1-10 U) of 3'Tth endonuclease, a thermostable mismatch repair enzyme and / or a thermostable RNase H enzyme.

[0130] In one or more embodiments, the universal primers and probes are as described in the third aspect of the present invention.

[0131] In one or more embodiments, the system further comprises 1-20 U (preferably 5-15 U) of site-specific cutting nuclease; preferably exonuclease and / or endonuclease.

[0132] In another preferred embodiment, the endonuclease is a restriction endonuclease.

[0133] In another preferred embodiment, the endonuclease is selected from the group consisting of a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

[0134] In another preferred embodiment, the methylation-dependent restriction endonuclease is selected from the group consisting of Gla I, FspEI, MspJI and LpnPI, or a combination thereof.

[0135] In the sixth aspect of the present invention, there is provided an application of the capture oligonucleotide described in the first aspect of the present invention, the capture oligonucleotide combination described in the second aspect of the present invention, the composition or kit described in the third aspect of the present invention, and / or the nucleic acid detection system described in the fifth aspect of the present invention in the preparation of nucleic acid detection products.

[0136] In another preferred example, the nucleic acid detection product is a DNA methylation detection product.

[0137] In another preferred embodiment, the product is selected from a kit, a device, and a computer-readable medium.

[0138] It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the present disclosure. BRIEF DESCRIPTION OF THE DRAWINGS

[0139] The accompanying drawings herein are incorporated into and constitute a part of the specification, illustrate embodiments consistent with the present invention, and together with the specification are used to explain the principles of the present invention. Obviously, the accompanying drawings described below are only some embodiments of the present invention, and for those of ordinary skill in the art, other accompanying drawings can be obtained based on these accompanying drawings without creative work.

[0140] Figure 1Shown are (A) the amplification principle when the capture oligonucleotide does not contain an enzyme recognition tag; (B) the amplification result when the capture oligonucleotide does not contain an enzyme recognition tag.

[0141] Figure 2 Shown are (A) the amplification principle of the capture oligonucleotide containing an enzyme recognition tag; (B) the amplification result of the capture oligonucleotide containing an enzyme recognition tag.

[0142] Figure 3 The amplification principle of the capture oligonucleotide without enzyme recognition tag is shown. The designs of different capture oligonucleotides; 1 / 3 / 5 are the universal primer sequences in the capture oligonucleotides containing hairpin structures; 2 / 4 / 6 are the universal primer sequences in the capture oligonucleotides without hairpin structures. 1 / 2 is 2000 copies / reaction; 3 / 4 is 200 copies / reaction; 5 / 6 is negative control.

[0143] Figure 4 Shows the addition of a universal probe sequence to the capture oligonucleotide; 1 / 3 / 5 are target molecule specific probe detection; 2 / 4 / 6 are universal probe detection. 1 / 2 is 2000 copies / reaction; 3 / 4 is 200 copies / reaction; 5 / 6 are negative controls.

[0144] Figure 5 The sensitivity test results are shown. The target molecule concentrations of 1 / 2 / 3 are 2000 copies / reaction, 200 copies / reaction, and 20 copies / reaction, respectively, and 4 is a negative control.

[0145] Figure 6 The results of methylation detection of locked nucleic acid modified capture oligonucleotides are shown. The target molecule concentrations of 1 / 2 / 3 are 2000 copies / reaction, 200 copies / reaction, and 20 copies / reaction, respectively, and 4 is a negative control.

[0146] Figure 7 The results of LINE-1 gene unmethylation based on methylation-sensitive restriction endonuclease treatment are shown.

[0147] Figure 8 The detection of Mycobacterium tuberculosis based on methylation-sensitive restriction endonuclease treatment is shown. The target molecule concentrations of 1 / 2 / 3 / 4 are 2000 copies / reaction, 1000 copies / reaction, 200 copies / reaction, and 20 copies / reaction, respectively, and 5 is a negative control. DETAILED DESCRIPTION

[0148] Example embodiments will now be described more fully with reference to the accompanying drawings. However, example embodiments can be implemented in many forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that the present invention will be comprehensive and complete and fully convey the concept of the example embodiments to those skilled in the art.

[0149] Unless otherwise defined, all terms and phrases used herein include the meanings that the terms and phrases have in the art, unless explicitly stated to the contrary or clearly apparent from the context in which the terms and phrases are used. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, specific methods and materials are now described.

[0150] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a preferred technical solution.

[0151] After extensive and in-depth research, the inventor unexpectedly discovered for the first time that the target molecule is first captured using a capture oligonucleotide, and then the target molecule is extended using the capture oligonucleotide as a template, and then linearly amplified by combining with a universal primer, to obtain a sequence containing different universal primer sequences at both ends that can be exponentially amplified by the universal primer, and an intermediate sequence of the target molecule sequence in the middle; then, the intermediate sequence obtained by linear amplification is subjected to exponential amplification guided by the universal primer and / or the capture oligonucleotide. Based on this, the present invention was completed.

[0152] Capture oligonucleotides

[0153] The present invention provides a capture oligonucleotide for nucleic acid amplification, wherein the capture oligonucleotide comprises a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is complementary to the 3' terminal sequence of the target molecule or is at least partially identical to the 5' terminal sequence of the target molecule, and the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence.

[0154] Optionally, the capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the universal sequence or at the 5' end of the capture sequence.

[0155] The universal sequence is independent of the target molecule sequence.

[0156] Typically, the capture oligonucleotides described in the present invention also include nucleic acid analog modifications.

[0157] The complementarity described herein includes complete complementarity and partial complementarity. Generally, for the nucleic acid chain that needs to be extended, its 3' end sequence is at least 90% complementary on the corresponding complementary chain, for example, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, or completely complementary, as long as it does not affect the extension of the nucleic acid chain. For example, in the complementarity of the target molecule and the combined capture sequence of the capture oligonucleotide, the target molecule is the nucleic acid chain that needs to be extended, and its 3' end sequence is at least 90% complementary or completely complementary to the combined capture sequence (that is, the 3' end nucleic acid of the target molecule has a paired base on the capture oligonucleotide). For another example, in the complementarity of the universal primer and the linear extension product of the target molecule, the universal primer is the nucleic acid chain that needs to be extended, and its 3' end sequence is at least 90% complementary or completely complementary to the sequence of the linear extension product of the target molecule.

[0158] The target molecule with clear sequence information at the 3' and 5' ends is complementary to the binding capture sequence of the capture oligonucleotide, and then the capture oligonucleotide is used as a template for extension to add the complementary chain of the sequence of the first universal primer to the 3' end of the target molecule (such as Figure 1 A, Figure 1 B). In order to prevent the capture oligonucleotide itself from being extended, the capture oligonucleotide may also optionally include a nucleic acid extension blocking modification. The nucleic acid extension blocking modification is usually located at the 3' end of the binding capture sequence. The nucleic acid extension blocking modification has a substance that can block the extension of DNA polymerase, so that the capture oligonucleotide will not extend to the 3' end, thereby forming a complementary chain of the target molecule and affecting the subsequent binding and extension of the capture oligonucleotide. The modification that can block the extension of DNA polymerase includes: Spacer, thio group, sulfhydryl group, amino group or uracil base.

[0159] In an embodiment of the present invention, the capture oligonucleotide with the nucleic acid extension modification is modified at the Spacer of the binding capture sequence. In order to further enhance the effect of nucleic acid extension blocking, the 3' end of the capture oligonucleotide binding capture sequence may also include a nucleic acid analog modification. The nucleic acid analog includes one or more selected from the following: peptide nucleic acid, locked nucleic acid, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine or 2'-fluoro RNA.

[0160] In the present invention, in the embodiment where the recognition and cleavage of the enzyme is required for amplification, an enzyme recognition tag modification can also be added to the 3' end of the universal sequence of the capture oligonucleotide or the 5' end of the capture sequence, and free ends are generated by the recognition and cleavage of the enzyme to extend and amplify. The enzyme recognition tag modification includes / idsP / and RNA base modification. The recognition enzyme includes 3'Tth endonuclease, thermostable mismatch repair enzyme and thermostable RNase H.

[0161] Typically, during use, the capture oligonucleotides may appear in pairs to form a capture oligonucleotide combination (a pair of capture oligonucleotides), including a reverse capture oligonucleotide and a forward capture oligonucleotide, wherein the reverse capture oligonucleotide includes a first universal sequence (3a) and a first binding capture sequence (2a) from the 5' end to the 3' end, and the forward capture oligonucleotide includes a second universal sequence (4s) and a second binding capture sequence (1s) from the 5' end to the 3' end.

[0162] In the present invention, the universal sequence can be an artificially synthesized sequence. Therefore, when detecting different target molecules, it is only necessary to design the combined capture sequence of the capture oligonucleotide according to the target molecule, and the universal sequence can remain unchanged. In some embodiments, in order to reduce nonspecific amplification, the combined capture sequence of the capture oligonucleotide is designed according to different target molecules, while the universal sequence remains unchanged, thereby realizing multiple amplification detection. The length or base ratio of the universal sequence (universal primer) can be conventionally adjusted according to the composition, length, required specificity, etc. of the sequence to be amplified.

[0163] Typically, in the present invention, when a capture oligonucleotide combination is used, the first universal sequence and the second universal sequence can be artificially synthesized sequences. Therefore, when detecting different target molecules, it is only necessary to design the combined capture sequence of the capture oligonucleotide according to the target molecule, while the first universal sequence and the second universal sequence can remain unchanged. In some embodiments, in order to reduce nonspecific amplification, the combined capture sequence of the capture oligonucleotide is designed according to different target molecules, while the first universal sequence and the second universal sequence remain unchanged, thereby realizing multiple amplification detection. The length or base ratio of the universal sequence (universal primer) can be conventionally adjusted according to the composition, length, required specificity, etc. of the sequence to be amplified.

[0164] Capture oligonucleotide combination

[0165] The present invention provides a capture oligonucleotide combination for nucleic acid amplification, the combination comprising a reverse capture oligonucleotide and a forward capture oligonucleotide:

[0166] (1) The reverse capture oligonucleotide comprises a first universal sequence (3a) and a first binding capture sequence (2a) from the 5' end to the 3' end; wherein,

[0167] The first binding capture sequence (2a) is complementary to the 3' end sequence of the target molecule;

[0168] The reverse capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the first binding capture sequence;

[0169] (2) the forward capture oligonucleotide includes a second universal sequence (4s) and a second binding capture sequence (1s) from the 5' end to the 3' end;

[0170] wherein the second binding capture sequence (1s) is at least partially identical to the 5' end sequence of the target molecule;

[0171] The forward capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the second binding capture sequence (1s);

[0172] Optionally,

[0173] The reverse capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the first universal sequence or the 5' end of the first binding capture sequence;

[0174] The forward capture oligonucleotide further includes an enzyme recognition tag located at the 3' end of the second universal sequence or the 5' end of the second binding capture sequence.

[0175] In a preferred embodiment of the present invention, the capture oligonucleotide combination includes a reverse capture oligonucleotide and a forward capture oligonucleotide, both of which include a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence of the forward capture oligonucleotide is at least partially identical to the 5' end of the target molecule; the binding capture sequence of the reverse capture oligonucleotide is complementary to the 3' end sequence of the target molecule; the reverse capture oligonucleotide and the forward capture oligonucleotide also include a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, and the universal primer is unrelated to the target molecule sequence.

[0176] In another preferred embodiment of the present invention, the capture oligonucleotide combination includes a reverse capture oligonucleotide and a forward capture oligonucleotide, both of which include a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence of the forward capture oligonucleotide is at least partially identical to the 5' end of the target molecule; the binding capture sequence of the reverse capture oligonucleotide is complementary to the 3' end sequence of the target molecule; the reverse capture oligonucleotide and the forward capture oligonucleotide also include a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence and an enzyme recognition label located at the 3' end of the universal sequence or the 5' end of the binding capture sequence, and the universal primer is unrelated to the target molecule sequence.

[0177] Target molecule

[0178] In the present invention, the target molecule can be a target molecule with clear sequence information at its 3' end and 5' end (i.e., clear sequence), or a target molecule with clear sequence information at its 3' end and 5' end generated after being treated by a biological method. The types of nucleic acid sequences with clear sequence information at the 3' end and 5' end include normal nucleic acid sequences, nucleic acid sequences with modifications, single nucleotide mutations, sequence transpositions, sequence deletions, sequence recombination, and other different types.

[0179] Target molecules with clear sequence information at their 3' and 5' ends, such as mature microRNA, microRNA precursor, cfDNA, etc.

[0180] The target molecule intermediate with clear sequence information at the 3' end and 5' end can be obtained by cutting or blocking by biological methods, including products cut by site-specific cutting nucleases, such as AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), nucleic acid restriction endonuclease, methylation-dependent nucleic acid restriction endonuclease, methylation-sensitive nucleic acid restriction endonuclease, nickase, giant nuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas system, mismatch repair enzyme, etc. Methylation-dependent restriction endonucleases such as GlaI, FspEI, MspJI and LpnPI; methylation-sensitive restriction endonucleases such as HpaⅡ, SmaⅠ, etc.; restriction endonucleases such as MspⅠ, Xmal, etc.; CRISPR-Cas system includes a guide short RNA matching the target DNA fragment and an endonuclease that can recognize and cut a specific sequence, such as a CRISPR-Cas system based on Cas9, Cas12 or Cas13.

[0181] Composition, kit

[0182] The present invention provides a composition or a kit for nucleic acid amplification, wherein the composition or the kit comprises the capture oligonucleotide or the capture oligonucleotide combination described above in the present invention.

[0183] Typically, the present invention provides a composition or kit comprising a capture oligonucleotide according to any embodiment for amplifying or detecting nucleic acid. Exemplary capture oligonucleotides are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, or SEQ ID NO: 20. Exemplary modified capture oligonucleotides are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, or SEQ ID NO: 20. Exemplary sequences of capture oligonucleotides with self-folding regions are shown in SEQ ID NO: 9 and SEQ ID NO: 10. The kit also includes a reagent for generating a target molecule with clear 3' and 5' end sequence information (e.g., a target molecule pre-sequence pretreatment reagent), such as the above-mentioned site-specific cutting nuclease. The kit also includes a DNA polymerase, dNTP, Mg 2+ , enzyme digestion buffer, PCR buffer, any one or more thereof.

[0184] In addition, the kit also includes a universal primer. Specifically, the kit also includes the universal primer as described above in the present invention. An exemplary universal primer is shown in SEQ ID NO: 3 or 4.

[0185] When detecting different target molecules, it is only necessary to design the binding capture sequence portion of the specific capture oligonucleotide according to the target molecule, while the universal primer can remain unchanged.

[0186] In order to detect nucleic acid, the kit may further include a probe (i.e., a detection probe). In some embodiments, the probe is labeled with a fluorescent group and / or a quencher group. Typically, the fluorescent group is labeled at the 5' end of the detection probe, and the quencher group is labeled at the 3' end of the detection probe. The fluorescent group includes any one or more of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LCRED460; the quencher group includes any one or more of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra. Exemplary probes are shown in SEQ ID NO: 5, 12, 17, or 21.

[0187] The kit may also include reagents required for sequencing, which are well known to those skilled in the art, such as polymerase, sequencing primers, etc.

[0188] Nucleic acid amplification or detection methods

[0189] The present invention provides a method for amplifying or detecting nucleic acid, which comprises the step of using a capture oligonucleotide to bind to a target molecule, wherein the capture oligonucleotide is as described in the first aspect of the present invention.

[0190] Typically, the nucleic acid amplification or detection method is a nucleic acid amplification or detection method for non-diagnostic purposes.

[0191] Generally speaking, the method comprises the following steps: (A) providing a capture oligonucleotide and a target molecule (or a target molecule presequence); (B) performing an extension reaction and an amplification reaction on the capture oligonucleotide and the target molecule in a reaction system; (C) detecting a signal; the capture oligonucleotide comprises a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is complementary to the 3' terminal sequence of the target molecule or is at least partially identical to the 5' terminal sequence of the target molecule, and the capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence,

[0192] Optionally, the capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the universal sequence or at the 5' end of the capture sequence.

[0193] The universal primer has nothing to do with the target molecule sequence.

[0194] Typically, the present invention provides a method for nucleic acid amplification or detection, the method comprising the steps of:

[0195] (a) using a capture oligonucleotide to bind to a target molecule (i.e., using a capture oligonucleotide to bind to a target molecule);

[0196] (b) Linear extension of target molecules;

[0197] (d) Universal primer exponential amplification,

[0198] The capture oligonucleotide includes a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is complementary to the 3' terminal sequence of the target molecule or is at least partially identical to the 5' terminal sequence of the target molecule, and the capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence,

[0199] Optionally, the capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the universal sequence or at the 5' end of the capture sequence.

[0200] The universal primer has nothing to do with the target molecule sequence.

[0201] In a preferred embodiment of the present invention, the nucleic acid amplification or detection method is a nucleic acid amplification or detection method for non-diagnostic purposes.

[0202] The nucleic acid amplification or detection method can be further divided into a cleavage method including step (c) enzyme-specific recognition and cleavage and a direct method not including step (c).

[0203] In a preferred embodiment of the present invention, the direct method comprises the steps of using a capture oligonucleotide to bind to a target molecule (i.e., using a capture oligonucleotide to bind to a target molecule), linear extension of the target molecule, and exponential amplification using a universal primer. Specifically, the method comprises:

[0204] (1) The reverse capture oligonucleotide binds to the target molecule with a clear 3' end sequence by binding to the capture sequence.

[0205] (2) The target molecule is extended using the reverse capture oligonucleotide as a template, and a sequence (3s) complementary to the first universal primer (3a) is added to the 3' end of the target molecule to obtain a linear extension product of the target molecule.

[0206] (3) The 3' end of the linear extension product of the target molecule is complementary to the first universal primer (3a),

[0207] (4) the first universal primer performs an extension reaction using the linear extension product of the target molecule as a template, and a sequence complementary to the linear extension product of the target molecule is added to the 3' end of the first universal primer to obtain the linear extension product of the first universal primer (3'1a-2a-3a 5').

[0208] (5) The forward capture oligonucleotide is complementary to the linear extension product of the first universal primer,

[0209] (6) the linear extension product of the first universal primer is subjected to an extension reaction using the forward capture oligonucleotide as a template, and a sequence (4a) complementary to the second universal primer (4s) is added to the 3' end of the linear extension product of the first universal primer to obtain a second universal primer linear extension product (3'4a-1a-2a-3a 5'), wherein the second universal primer linear extension product is a single-stranded product having the first universal primer sequence (3a) and the second universal primer complementary sequence (4a) at the 5' and 3' ends, respectively, and containing a target molecule complementary sequence in the middle.

[0210] (7) The first universal primer and the second universal primer perform exponential amplification using the linear extension product of the second universal primer as a template to obtain an amplified product.

[0211] The amplification optionally further comprises the use of a probe.

[0212] In another preferred embodiment of the present invention, the cleavage method includes the steps of using a capture oligonucleotide to bind to a target molecule (i.e., using a capture oligonucleotide to bind to a target molecule), linear extension of the target molecule, enzyme-specific recognition and cleavage, and / or universal primer exponential amplification. Specifically, the method includes:

[0213] (1) The reverse capture oligonucleotide binds to the target molecule with a clear 3' end sequence by binding to the capture sequence.

[0214] (2) The target molecule is extended using the reverse capture oligonucleotide as a template, and a sequence (3s) complementary to the first universal primer (3a) is added to the 3' end of the target molecule to obtain a linear extension product of the target molecule.

[0215] (3) The enzyme specifically recognizes the linear extension product of the target molecule and the enzyme cleavage site in the reverse capture oligonucleotide binding dimer and cleaves it to obtain a reverse capture oligonucleotide cleavage product containing a free 3' end.

[0216] (4) the reverse capture oligonucleotide cleavage product containing a free 3' end, using the linear extension product of the target molecule as a template for extension reaction, adding the target molecule complementary sequence to the 3' end of the reverse capture oligonucleotide cleavage product containing a free 3' end, to obtain a first universal primer linear extension product,

[0217] (5) The forward capture oligonucleotide is complementary to the linear extension product of the first universal primer,

[0218] (6) the linear extension product of the first universal primer is subjected to an extension reaction using the forward capture oligonucleotide as a template, and a sequence (4a) complementary to the second universal primer is added to the 3' end of the linear extension product of the first universal primer to obtain a second universal primer linear extension product (3'4a-1a-2a-3a 5'), wherein the second universal primer linear extension product is a single-stranded product having the first universal primer sequence (3a) and the second universal primer complementary sequence (4a) at the 5' and 3' ends, respectively, and containing a target molecule complementary sequence in the middle.

[0219] (7) The linear extension product of the second universal primer can be exponentially amplified based on the reverse capture oligonucleotide and the forward capture oligonucleotide under the action of enzyme specific recognition, or directly exponentially amplified based on the first universal primer and the second universal primer to obtain an amplified product.

[0220] The amplification optionally further comprises the use of a probe.

[0221] Detection system

[0222] The present invention provides a nucleic acid detection system, which comprises the capture oligonucleotide described in the first aspect of the present invention or the capture oligonucleotide combination described in the second aspect of the present invention or the composition or kit described in the third aspect of the present invention, Taq polymerase, dNTP, MgCl2 and PCR buffer.

[0223] Typically, the detection system further includes primers (universal primers) and probes (specific probes, universal probes).

[0224] Methylation detection system

[0225] In a specific embodiment, the present invention relates to a methylation detection system, which mainly comprises two parts: methylation-dependent restriction endonuclease treatment and / or methylation-sensitive restriction endonuclease treatment, and fluorescent PCR technology based on capture oligonucleotides and / or universal primer amplification. The methylation detection system involves treating the target gene sequence with methylation-dependent restriction endonucleases and / or methylation-sensitive restriction endonucleases for enzymatic treatment; and involves performing fluorescent PCR amplification on the enzymatic products of methylation-dependent restriction endonucleases and / or methylation-sensitive restriction endonucleases. Preferably, the methylation detection system includes capture oligonucleotides, probes and universal primers, and the above components are as described elsewhere herein.

[0226] There are two options for the capture oligonucleotide involved in the methylation detection system.

[0227] The first option: the capture oligonucleotide combination includes a reverse capture oligonucleotide and a forward capture oligonucleotide, both of which include a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence of the forward capture oligonucleotide is at least partially identical to the 5' end of the target molecule; the binding capture sequence of the reverse capture oligonucleotide is complementary to the 3' end sequence of the target molecule; the reverse capture oligonucleotide and the forward capture oligonucleotide also include a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, and the universal primer is unrelated to the target molecule sequence.

[0228] The second option: the capture oligonucleotide combination includes a reverse capture oligonucleotide and a forward capture oligonucleotide, both of which include a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence of the forward capture oligonucleotide is at least partially identical to the 5' end of the target molecule; the binding capture sequence of the reverse capture oligonucleotide is complementary to the 3' end sequence of the target molecule; the reverse capture oligonucleotide and the forward capture oligonucleotide also include a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence and an enzyme recognition label located at the 3' end of the universal sequence or the 5' end of the binding capture sequence, and the universal primer is unrelated to the target molecule sequence.

[0229] In a preferred embodiment of the present invention, the 3' end of the binding capture sequence is modified with a nucleic acid analog.

[0230] Typically, the capture oligonucleotide involved in the methylation detection system is modified with a nucleic acid analog; preferably, the nucleic acid analog includes any one or a combination of at least two of peptide nucleic acid, locked nucleic acid, transposed base, spacer, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine (2'-deoxyuridine), 2-fluoro RNA or 2'-fluoro RNA. The above preferred nucleic acid analogs are modified on the 3' end sequence of the capture oligonucleotide binding capture sequence.

[0231] In an embodiment of the present invention, the probes (including specific probes and universal probes) involved in the methylation detection system are respectively labeled with a fluorescent detection group and a quenching group at both ends.

[0232] Preferred fluorescent detection groups are selected from the group consisting of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, LCRED460, or combinations thereof.

[0233] Preferred quenching groups are selected from the group consisting of BHQ1, BHQ2, BHQ3, Dabcy1, Tamra, or a combination thereof.

[0234] The present invention provides two methods for the above-mentioned fluorescence PCR amplification detection:

[0235] The first method includes the steps of using a capture oligonucleotide to bind to a target molecule (ie, using a capture oligonucleotide to bind to a target molecule), linear extension of the target molecule, and exponential amplification of the target molecule using a universal primer.

[0236] Specifically, the method comprises: (1) a reverse capture oligonucleotide binds to a target molecule with a clear 3' terminal sequence by binding to a capture sequence; (2) the target molecule is extended using the reverse capture oligonucleotide as a template, and a sequence complementary to a first universal primer is added to the 3' terminal of the target molecule to obtain a linear extension product of the target molecule; (3) the 3' terminal of the linear extension product of the target molecule is complementary to the first universal primer; (4) the first universal primer is extended using the linear extension product of the target molecule as a template, and a sequence complementary to the linear extension product of the target molecule is added to the 3' terminal of the first universal primer to obtain a linear extension product of the first universal primer; (5) a forward capture oligonucleotide is complementary to the linear extension product of the first universal primer; (6) the linear extension product of the first universal primer is extended using the forward capture oligonucleotide as a template, and a sequence (4a) complementary to a second universal primer (4s) is added to the 3' terminal of the linear extension product of the first universal primer to obtain a linear extension product of the second universal primer (3'4a-1a-2a-3a 5'), the second universal primer linear extension product is a single-stranded product having the first universal primer sequence and the second universal primer complementary sequence at the 5' and 3' ends respectively, and containing the target molecule complementary sequence in the middle, (7) the first universal primer and the second universal primer perform exponential amplification using the second universal primer linear extension product as a template to obtain an amplified product. The amplification optionally further comprises the use of a probe.

[0237] The second method includes the steps of using capture oligonucleotides to bind to target molecules (ie, using capture oligonucleotides to bind to target molecules), linear extension of target molecules, enzyme-specific recognition and cleavage, and / or universal primer exponential amplification.

[0238] Specifically, the method comprises: (1) a reverse capture oligonucleotide binds to a target molecule with a clear 3' terminal sequence by binding to a capture sequence; (2) the target molecule is extended using the reverse capture oligonucleotide as a template, and a sequence complementary to a first universal primer is added to the 3' terminal of the target molecule to obtain a linear extension product of the target molecule; (3) an enzyme specifically recognizes the restriction site in the dimer of the linear extension product of the target molecule and the reverse capture oligonucleotide and cuts it to obtain a reverse capture oligonucleotide cutting product containing a free 3' terminal; (4) the reverse capture oligonucleotide cutting product containing a free 3' terminal product, performing an extension reaction with the linear extension product of the target molecule as a template, adding a complementary sequence of the target molecule to the 3' end of the reverse capture oligonucleotide cleavage product containing a free 3' end, to obtain a first universal primer linear extension product, (5) the forward capture oligonucleotide is complementary to the first universal primer linear extension product, (6) the first universal primer linear extension product is subjected to an extension reaction with the forward capture oligonucleotide as a template, adding a second universal primer complementary sequence (4a) to the 3' end of the first universal primer linear extension product, to obtain a second universal primer linear extension product (3'4a-1a-2a-3a 5'), the second universal primer linear extension product is a single-stranded product containing the first universal primer sequence (3a) and the second universal primer complementary sequence (4a) at the 5' and 3' ends respectively, and containing a complementary sequence of the target molecule in the middle,

[0239] (7) The linear extension product of the second universal primer can be exponentially amplified based on the reverse capture oligonucleotide and the forward capture oligonucleotide under the action of enzyme specific recognition, or directly exponentially amplified based on the first universal primer and the second universal primer to obtain an amplified product.

[0240] The amplification optionally further comprises the use of a probe.

[0241] In a specific embodiment of the present invention, the methylation sites in the sequence of Septine 9 gene as described in SEQ ID NO: 6 are detected by the following method:

[0242] The capture oligonucleotides shown in SEQ ID NOs: 1 and 2 are contacted with the cfDNA digested with GlaI, and SEQ ID NO: 2 is complementary to the target molecule 1 shown in SEQ ID NO: 23; the target molecule 1 is extended using SEQ ID NO: 2 as a template, and a sequence complementary to SEQ ID NO: 2 is added to the 3' end of the target molecule to obtain an extended target molecule (i.e., a linear extension product of the target molecule); the extended target molecule is complementary to the universal primer SEQ ID NO: 3; the universal primer SEQ ID NO: 3 performs an extension reaction using the extended target molecule as a template to obtain a sequence complementary to the extended target molecule; the sequence can be complementary to the capture oligonucleotide SEQ ID NO: 1 and extended to form a single-stranded product having the first universal primer sequence and the second universal primer complementary sequence at the 5' and 3' ends, respectively, and containing the target molecule complementary sequence in the middle; finally, amplification is performed using the universal primers shown in SEQ ID NOs: 3 and SEQ ID NO: 4 and a probe shown in SEQ ID NO: 5, and the probe signal is detected.

[0243] The main advantages of the present invention include:

[0244] Compared with the existing methylation detection technology based on bisulfite conversion, the present invention has the following beneficial effects:

[0245] (1) The cfDNA methylation detection technology involved in the present invention does not require complicated chemical treatment, purification and other processes. The scheme of the present invention can only trigger amplification when both the 3' end and the 5' end are mediated by methylation sites, which can effectively inhibit the amplification false positive caused by random breakage of cfDNA, improve the specificity of amplification, and is more suitable for methylation detection of cfDNA with a high degree of fragmentation.

[0246] (2) The capture oligonucleotides and universal primers in the present invention are specially designed. When the target molecules are present in the environment, the extension reaction mediated by the capture oligonucleotide can be triggered, and the signal can be amplified through subsequent exponential amplification to meet the sensitivity requirements for cfDNA methylation detection.

[0247] Compared with the existing methylation-dependent restriction endonuclease technology (ZL 202111389443.0 and Nucleic Acids Res. 2013; 41(1): e15.), the present invention has the following beneficial effects:

[0248] (1) The amplification method of the present invention only needs a pair of capture oligonucleotides with a simple design of 3' end containing nucleic acid extension blocking modification and a pair of universal primers to detect methylation. Compared with the reference document (ZL 202111389443.0), this unique design structure not only does not require the two-step amplification required by the reference document, but also forms a hairpin structure and performs USER enzyme treatment during the amplification process. In principle, it is simpler and easier to operate. Compared with the reference document (Nucleic Acids Res. 2013; 41(1): e15.), the present invention not only avoids the effect that the reference document requires multiple cycles to perform a round of amplification, but also can directly use 3'Tth endonuclease, high temperature mismatch repair enzyme and high temperature stable RNase H to mediate exponential amplification based on capture oligonucleotides with enzyme recognition site modification and universal primers, thereby improving the efficiency of amplification and the sensitivity of detection.

[0249] (2) When the present invention performs methylation detection on different target molecules, it is only necessary to design the binding capture sequence portion of the capture oligonucleotide according to the target molecule, while keeping the universal primer portion unchanged, thereby reducing the interference between multiple primers that is prone to occur during the amplification of multiple target molecules and improving the sensitivity of the reaction, thereby realizing methylation detection of multiple target molecules.

[0250] Compared with the existing multiple nucleic acid amplification detection technology (WO 2018 / 165593 A1 and US2012 / 0171725A1), the present invention has the following beneficial effects:

[0251] (1) The capture oligonucleotide described in the present invention not only has a nucleic acid extension blocking modification at the 3' end, but also has a nucleic acid analog modification at its binding capture sequence. Compared with the comparative documents (WO 2018 / 165593A1 and US2012 / 0171725 A1), this unique design structure can not only effectively reduce the non-specific amplification caused by partial mismatch between primers, but also avoid the nested opening scheme required by other documents, thereby improving the detection sensitivity.

[0252] (2) The amplification reaction described in the present invention depends on the presence of target molecules with clear sequences at the 5' and 3' ends to initiate the corresponding amplification reaction. This unique amplification design concept based on the simultaneous presence of capture oligonucleotides and target molecules with clear sequences at the 5' and 3' ends, compared with the comparative documents (WO 2018 / 165593 A1 and US2012 / 0171725 A1), can not only further improve the specificity of detection, but also realize some detections that cannot be realized in the comparative documents (WO 2018 / 165593 A1 and US2012 / 0171725A1), such as DNA methylation detection.

[0253] The detection method, detection system and kit provided by the invention are further described below in conjunction with specific embodiments.

[0254] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention. The experimental methods in the following examples that do not specify detailed conditions are usually based on conventional conditions such as the conditions described in "Molecular Cloning Laboratory Guide" by Sambrook.J, USA (Huang Peitang, etc., Beijing: Science Press, 2002), or according to the conditions recommended by the manufacturer (e.g., product instructions). Unless otherwise specified, percentages and parts are calculated by weight. The experimental materials and reagents used in the following examples can be obtained from commercial channels or can be prepared according to literature methods unless otherwise specified.

[0255] Example 1: Detection of DNA methylation of human Septine 9 gene by ultrasonic fragmentation based on the amplification principle of capture oligonucleotides without enzyme recognition tags

[0256] (1) Obtain methylated Jurka genomic DNA and sequence to identify the methylation status of the Septine 9 gene.

[0257] (2) By ultrasonic treatment of methylated Jurka genomic DNA, fragmented DNA with a fragment size of about 150 bp was obtained.

[0258] (3) The DNA fragmented by ultrasonic treatment was digested with the methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10 U GlaI, ultrasonic fragmented DNA, and a total volume of 10 μL. The reaction conditions were incubation at 37°C for 1 hour. After the digestion reaction was completed, the system was heated to 85°C and incubated for 10 minutes to heat inactivate GlaI.

[0259] (4) Septine 9 gene capture oligonucleotide and universal primers were added to the above enzyme digestion system for amplification. The reaction system was: ultrasonic fragmented DNA after digestion, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl; the PCR reaction program was pre-denaturation at 95°C for 3 min; 94°C for 10 s, 66°C for 90 s, 5 cycles; 95°C for 10 s, 65°C for 20 s, 40 cycles; real-time fluorescence PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0260] The combinations of capture oligonucleotides, universal primers, and specific probes used include:

[0261] Forward capture oligonucleotide (2' methoxy modified bases in italics)

[0262]

[0263] Reverse capture oligonucleotide (2' methoxy modified bases in italics)

[0264]

[0265] First universal primer

[0266] GGATCGGAGTGTTCAAGTC(SEQ ID NO:3)

[0267] Second universal primer

[0268] ACGCTCACGCTCGCTGCTAC(SEQ ID NO:4)

[0269] Target molecule specific probe

[0270] 5'FAM-ACCAGCCATCATGTCGGAC-MGB(SEQ ID NO:5)

[0271] The partial sequence of human Septine 9 gene is as follows: / / indicates the restriction site, and the CG before and after it indicates the methylation site.

[0272] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGGGTCGC / / GCGGAGGGC (SEQ ID NO: 6, wherein positions 18 to 62 are the target molecule 1 sequence, and the target molecule 1 sequence number is SEQ ID NO: 23)

[0273] The 3' end of the capture oligonucleotide has Spacer C3 to block extension. Figure 1 This indicates that the present invention has good sensitivity and specificity for detecting the methylation of Septine 9 gene in ultrasonically fragmented DNA.

[0274] Example 2: Detection of DNA methylation of human Septine 9 gene by ultrasonic fragmentation based on the amplification principle of capture oligonucleotides containing enzyme recognition tags

[0275] (1) Obtain methylated Jurka genomic DNA and sequence to identify the methylation status of the Septine 9 gene.

[0276] (2) By ultrasonic treatment of methylated Jurka genomic DNA, fragmented DNA with a fragment size of about 150 bp was obtained.

[0277] (3) The DNA fragmented by ultrasonic treatment was digested with the methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10 U GlaI, ultrasonic fragmented DNA, and a total volume of 10 μL. The reaction conditions were incubation at 37°C for 1 hour. After the digestion reaction was completed, the system was heated to 85°C and incubated for 10 minutes to heat inactivate GlaI.

[0278] (4) Septine 9 gene capture oligonucleotide and universal primers were added to the above enzyme digestion system for amplification. The reaction system was: ultrasonic fragmented DNA after digestion, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl; the PCR reaction program was pre-denaturation at 95°C for 3 min; 94°C for 10 s, 66°C for 90 s, 5 cycles; 95°C for 10 s, 65°C for 20 s, 40 cycles; real-time fluorescence PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0279] The combination of universal primers and specific probes used in the same manner as in Example 1 includes:

[0280] Forward capture oligonucleotide (2' methoxy modified bases in italics)

[0281]

[0282] Reverse capture oligonucleotide (2' methoxy modified bases in italics)

[0283]

[0284] The partial sequence of human Septine 9 gene is as follows: / / indicates the restriction site, and the CG before and after it indicates the methylation site.

[0285] ATCCCATCCAGCTGCGC / / GTTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGGGTCGC / / GCGGAGGGC (SEQ ID NO: 6, wherein positions 18 to 62 are the target molecule 1 sequence, and the target molecule 1 sequence number is SEQ ID NO: 23)

[0286] The 3' end of the capture oligonucleotide has Spacer C3 to block extension. Figure 2 This indicates that the present invention has good sensitivity and specificity for detecting the methylation of Septine 9 gene in ultrasonically fragmented DNA.

[0287] Example 3: Experiments with capture oligonucleotides of different structures

[0288] In order to improve the ability of the capture oligonucleotide to bind to the target molecule, this example selected capture oligonucleotides with different structures for detection. The universal primers and specific probes used were the same as those in Example 1, and the enzyme digestion conditions and amplification conditions were the same as those in Example 1.

[0289] The capture oligonucleotides used included:

[0290] Linear forward capture oligonucleotide (2' methoxy modified bases in italics)

[0291]

[0292] Linear reverse capture oligonucleotide (2' methoxy modified bases in italics)

[0293]

[0294] Self-folding forward capture oligonucleotide (the underlined area is the self-folding region, and the italics are the 2' methoxy modified bases)

[0295]

[0296] Self-folding reverse capture oligonucleotide (the underlined area is the self-folding region, and the italics are the 2' methoxy modified bases)

[0297]

[0298] The partial sequence of the human Septine 9 gene is shown in Example 1.

[0299] like Figure 3 As shown, using different designs of capture oligonucleotides, amplification curves appeared in the detection of 2000 copies and 200 copies of methylation-positive genomic DNA, showing positive results, indicating that both straight-chain capture oligonucleotides and self-folding capture oligonucleotides can achieve highly sensitive methylation detection. However, there is no obvious difference between the two in this example.

[0300] Example 4: Experiments with different probe selections

[0301] In order to improve the flexibility of capture oligonucleotide detection, this embodiment selected a universal probe sequence added between the universal primer sequence of a capture oligonucleotide and the binding capture sequence. The other capture oligonucleotides and universal primers used were the same as those in Example 1, and the enzyme digestion conditions and amplification conditions were the same as those in Example 1.

[0302] The capture oligonucleotides used included:

[0303] Capture oligonucleotides without universal probe sequences (2' methoxy-modified bases in italics)

[0304]

[0305] Capture oligonucleotide containing universal probe sequence (underlined is the self-folding region, italics are 2' methoxy modified bases)

[0306]

[0307] Universal probe sequence capture oligonucleotides

[0308] FAM-CGATGGCTGAGGATTCTG-MGB(SEQ ID NO:12)

[0309] The partial sequence of the human Septine 9 gene is shown in Example 1.

[0310] like Figure 4 As shown, using capture oligonucleotides without universal probe sequences and containing universal probe sequences, amplification curves appeared in the detection of 2000 copies and 200 copies of methylation-positive genomic DNA, showing positive results, indicating that using universal probe sequences or target molecule-specific probe sequences can achieve highly sensitive methylation detection. However, there is no obvious difference between the two in this example.

[0311] Example 5: Sensitivity test

[0312] In order to test the sensitivity of the present invention in detecting ctDNA methylation, this example selected different target concentrations after treatment for detection. The capture oligonucleotides, universal primers and specific probes used were the same as those in Example 1, and the enzyme digestion conditions and amplification conditions were the same as those in Example 1. Figure 5 As shown, when there are 2000 copies / reaction, 200 copies / reaction, and 20 copies / reaction of methylation-positive genomic DNA in the reaction, positive results can be shown, and the negative control NC has no amplification.

[0313] Example 6: Methylation detection of locked nucleic acid modified capture oligonucleotides

[0314] (1) Genomic DNA was extracted from Jurkat cell lines and Hela cell lines, and the methylation status of the Septine 9 gene was identified by sequencing.

[0315] (2) The two genomic DNAs were treated by ultrasound to obtain fragmented DNA with a fragment size of about 150 bp.

[0316] (3) The DNA fragmented by ultrasonic treatment was digested with the methylation-dependent restriction endonuclease GlaI. The reaction system was: 1× digestion buffer, 10 U GlaI, ultrasonic fragmented DNA, and a total volume of 10 μL. The reaction conditions were incubation at 37°C for 1 hour. After the digestion reaction was completed, the system was heated to 85°C and incubated for 10 minutes to heat inactivate GlaI.

[0317] (4) Septine 9 gene capture oligonucleotide and universal primers were added to the above enzyme digestion system for amplification. The reaction system was: ultrasonic fragmented DNA after digestion, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl; the PCR reaction program was pre-denaturation at 95°C for 3 min; 94°C for 10 s, 66°C for 90 s, 5 cycles; 95°C for 10 s, 65°C for 20 s, 40 cycles; real-time fluorescence PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0318] The combination of universal primers, target molecule-specific probes and target molecule sequences used is the same as that in Example 1, and the capture oligonucleotides include:

[0319] Forward capture oligonucleotide (the base preceding the + is modified with a locked nucleic acid)

[0320] ACGCTCACGCTCGCTGCTAC GTTGACC GC+GG+G+G-Spacer C3(SEQ IDNO:13)

[0321] Reverse capture oligonucleotide (+ the base in front is modified with locked nucleic acid)

[0322] GGATCGGAGTGTTCAAGTC GCGACCC GCT+GC+C+C-Spacer C3(SEQ ID NO:14)

[0323] The capture oligonucleotide has a Spacer C3 at the 3' end of the folded sequence to block extension. Figure 6 As shown, the positive templates of 200 copies and 100 copies showed amplification curves, indicating positive results, while the negative control NC had no amplification curve, indicating negative results. This indicates that the capture oligonucleotide modified with locked nucleic acid can be used in the present invention and perform DNA methylation detection.

[0324] Example 7: Detection of DNA methylation of human LINE-1 gene by ultrasonic fragmentation based on the amplification principle of capture oligonucleotides without enzyme recognition tags

[0325] (1) Obtain HELA genomic DNA and sequence to identify the methylation status.

[0326] (2) DNA was digested with methylation-sensitive restriction endonuclease HinP1I. The reaction system was: 1× digestion buffer, 10 U HinP1I, genomic DNA, and a total volume of 10 μL. The reaction conditions were incubation at 37°C for 1 hour.

[0327] (3) The capture oligonucleotide and universal primer of the treated gene were added to the above enzyme digestion system for amplification. The reaction system was: genomic DNA after digestion, 5nM capture oligonucleotide, 0.5U Taq DNA polymerase, 200μM dNTPs, 2.5mM MgCl2 and 1X PCR buffer, with a final volume of 20μl; the PCR reaction program was pre-denaturation at 95℃ for 3min; 94℃ for 10s, 66℃ for 90s, 5 cycles; 95℃ for 10s, 65℃ for 20s, 40 cycles; real-time fluorescence PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0328] The combinations of capture oligonucleotides, universal primers, and specific probes used include:

[0329] Forward capture oligonucleotide (2' methoxy modified bases in italics)

[0330]

[0331] Reverse capture oligonucleotide (2' methoxy modified bases in italics)

[0332]

[0333] Second universal primer

[0334] ACGCTCACGCTCGCTGCTAC(SEQ ID NO:4)

[0335] First universal primer

[0336] GGATCGGAGTGTTCAAGTC(SEQ ID NO:3)

[0337] Specific probe

[0338] FAM-CCAGCGATGGCTGAGGATT-MGB(SEQ ID NO:17)

[0339] The partial sequence of the human LINE-1 gene is as follows: / / indicates the restriction site, and the CG before and after it indicates the methylation site.

[0340] CGAATATTGC / / GCTTTTCAGACCGGCTTAAGAAACGGC / / GCACCACGAGA (SEQ ID NO: 18, wherein positions 11 to 37 are the target molecule 2 sequence, and the target molecule 2 sequence number is SEQ ID NO: 24)

[0341] The 3' end of the capture oligonucleotide has Spacer C3 to block extension. Figure 7 This indicates that the results of the detection can be based on the non-methylated state based on the methylation-sensitive restriction endonuclease treatment.

[0342] Example 8: Detection of the IS6110 fragment of Mycobacterium tuberculosis based on the present invention

[0343] (1) Obtaining Mycobacterium tuberculosis genomic DNA.

[0344] (2) DNA was digested with restriction endonuclease FokI. The reaction system was: 1× digestion buffer, 10 U Fok I, Mycobacterium tuberculosis genomic DNA, and the total volume was 10 μL. The reaction conditions were incubation at 37° C. for 1 hour.

[0345] (3) The capture oligonucleotide and universal primer of the treated gene were added to the above-mentioned enzyme digestion system for amplification. The reaction system was: the Mycobacterium tuberculosis genome after digestion, 5 nM capture oligonucleotide, 0.5 U Taq DNA polymerase, 200 μM dNTPs, 2.5 mM MgCl2 and 1X PCR buffer, with a final volume of 20 μl; the PCR reaction program was pre-denaturation at 95°C for 3 min; 94°C for 10 s, 66°C for 90 s, 5 cycles; 95°C for 10 s, 65°C for 20 s, 40 cycles; real-time fluorescence PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0346] The combinations of capture oligonucleotides, universal primers, and specific probes used include:

[0347] Forward capture oligonucleotide (2' methoxy modified bases in italics)

[0348]

[0349] Reverse capture oligonucleotide (2' methoxy modified bases in italics)

[0350]

[0351] Second universal primer

[0352] ACGCTCACGCTCGCTGCTAC(SEQ ID NO:4)

[0353] First universal primer

[0354] GGATCGGAGTGTTCAAGTC(SEQ ID NO:3)

[0355] Specific probe

[0356] FAM-cgccggagctgcgtga-MGB(SEQ ID NO:21)

[0357] The partial sequence of the IS6110 gene of Mycobacterium tuberculosis is as follows: / / indicates the restriction site, and the CG before and after it indicates the methylation site.

[0358] (SEQ ID NO: 22, wherein positions 33 to 97 are the target molecule 3 sequence, and the target molecule 3 sequence number is SEQ ID NO: 25)

[0359] The 3' end of the capture oligonucleotide has Spacer C3 to block extension. Figure 8 This indicates that the results of the detection can be based on the non-methylated state based on the methylation-sensitive restriction endonuclease treatment.

[0360] Those skilled in the art will readily appreciate other embodiments of the present invention after considering the specification and practicing the invention disclosed herein. This application is intended to cover any variations, uses or adaptations of the present invention, which follow the general principles of the present invention and include common knowledge or customary techniques in the art that are not disclosed by the present invention. The specification and examples are intended to be exemplary only, and the true scope and spirit of the present invention are indicated by the appended claims.

Claims

1. A capture oligonucleotide for nucleic acid amplification, characterized in that: The capture oligonucleotide includes a universal sequence and a binding capture sequence from 5' to 3', wherein the binding capture sequence is complementary to the 3' terminal sequence of the target molecule or is at least partially identical to the 5' terminal sequence of the target molecule, and the capture oligonucleotide also includes a nucleic acid extension blocking modification located at the 3' end of the binding capture sequence, Optionally, the capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the universal sequence or at the 5' end of the combined capture sequence.

2. The capture oligonucleotide according to claim 1, characterized in that The 3' end of the binding capture sequence is modified with a nucleic acid analog.

3. The capture oligonucleotide according to claim 1, characterized in that The nucleic acid extension blocking modification is selected from the following group: Spacer, amino, C6, methyl, azide, phosphoramidite, alkyne, DBCO, biotin, digoxigenin, puromycin, methylene blue, azobenzene, locked nucleic acid, 5-nitroindole, inverted base, or a combination thereof.

4. The capture oligonucleotide according to claim 2, wherein The nucleic acid analog modification is selected from the following group: peptide nucleic acid, locked nucleic acid, transposed base, Spacer, 2'-O, 4'-C-methylated bridging RNA, 2'-methoxy modified base, 2'-O-methyl RNA, deoxyuridine, 2-fluoro RNA, 2'-fluoro RNA, or a combination thereof.

5. A capture oligonucleotide combination for nucleic acid amplification, characterized in that: The combination includes a reverse capture oligonucleotide and a forward capture oligonucleotide: (1) The reverse capture oligonucleotide includes a first universal sequence and a first binding capture sequence from the 5' end to the 3' end; wherein The first binding capture sequence is complementary to the 3' end sequence of the target molecule; The reverse capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the first binding capture sequence; (2) the forward capture oligonucleotide comprises a second universal sequence and a second binding capture sequence in sequence from the 5' end to the 3' end; wherein the second binding capture sequence is at least partially identical to the 5' end sequence of the target molecule; The forward capture oligonucleotide further comprises a nucleic acid extension blocking modification located at the 3' end of the second binding capture sequence (1s); Optionally, The reverse capture oligonucleotide further comprises an enzyme recognition tag located at the 3' end of the first universal sequence or the 5' end of the first binding capture sequence; The forward capture oligonucleotide further includes an enzyme recognition tag located at the 3' end of the second universal sequence or the 5' end of the second binding capture sequence.

6. A composition or kit for nucleic acid amplification, characterized in that: The composition or kit comprises the capture oligonucleotide of any one of claims 1 to 4 or the capture oligonucleotide combination of claim 5.

7. The composition or kit according to claim 6, characterized in that The composition or kit also includes a target molecule pre-sequence pretreatment reagent to obtain a target molecule with clear 3' and 5' end sequences; Preferably, the pretreatment reagent comprises a methylation-dependent restriction endonuclease, a methylation-sensitive restriction endonuclease, a nickase, a CRISPR-Cas system, a mismatch repair enzyme, or a combination thereof.

8. A method for amplifying or detecting nucleic acid for non-diagnostic purposes, characterized in that: The method comprises the step of using a capture oligonucleotide to bind to a target molecule, wherein the capture oligonucleotide is as described in claim 1.

9. The nucleic acid amplification or detection method according to claim 8, characterized in that: The method comprises the steps of: (a) using capture oligonucleotides to bind target molecules; (b) Linear extension of target molecules; (d) Universal primer exponential amplification, The capture oligonucleotide is the capture oligonucleotide according to claim 1 or the reverse capture oligonucleotide and / or the forward capture oligonucleotide in the capture oligonucleotide combination according to claim 2, and the universal primer is independent of the target molecule sequence.

10. The nucleic acid amplification or detection method according to claim 8, characterized in that: The method comprises the steps of: (a) using capture oligonucleotides to bind target molecules; (b) Linear extension of target molecules; (c) Enzyme-specific recognition and cleavage; (d) Universal primer exponential amplification; The capture oligonucleotide is the capture oligonucleotide according to claim 1 or the reverse capture oligonucleotide and / or the forward capture oligonucleotide in the capture oligonucleotide combination according to claim 2, and the universal primer is independent of the target molecule sequence.

Images