Kit for detecting fgfr2 gene fusion mutation in cholangiocarcinoma
By designing a digital PCR-based kit, which utilizes fusion-specific primers to complement the FGFR2 WT exon18 sequence near the breakpoint, WT cDNA amplification is inhibited, achieving high sensitivity and accuracy in detecting FGFR2 gene fusion mutations. This solves the problem of limited detection targets in existing technologies and is suitable for the clinical diagnosis of cholangiocarcinoma.
Patent Information
- Application Number
- CN202411747094.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-29
- Publication Date
- 2025-12-19
- Estimated Expiration
- 2044-11-29
AI Technical Summary
Existing digital PCR detection methods can only detect known FGFR2 gene fusions, and the detection targets are limited, making it impossible to effectively detect unknown fusions.
A digital PCR-based kit was designed, comprising reverse transcription reagents and PCR expression reagents. By introducing a fixed sequence at the 5' end of the cDNA as the upstream primer binding site and selecting downstream primer binding sites on exons 1-17 of FGFR2, the kit utilizes fusion-specific primers that are complementary to the sequence near the breakpoint of FGFR2 WT exon18 to inhibit FGFR2 WT cDNA amplification, thereby increasing the amplification efficiency of FGFR2 fusion. Combined with single-end anchoring and ddPCR amplification techniques, a highly sensitive detection of FGFR2 gene fusion mutations can be achieved.
It achieves high sensitivity and high accuracy in detecting FGFR2 gene fusion mutations, and can detect approximately 150 FGFR2 gene fusions at once. It is easy to operate and low in cost, and is suitable for clinical drug reference.
Smart Images

Figure BDA0005164018550000051 
Figure BDA0005164018550000061 
Figure BDA0005164018550000081
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biomedical technology, and particularly relates to a kit for detecting FGFR2 gene fusion mutation in cholangiocarcinoma. BACKGROUND
[0002] Intrahepatic cholangiocarcinoma (ICC) is an important subtype of cholangiocarcinoma (CCA), accounting for about 10-20% of all primary liver cancer. ICC is a deadly primary liver cancer, but the early symptoms of ICC are not obvious, and patients are usually diagnosed in the advanced and unresectable stage, with limited treatment options and poor prognosis, so there is an urgent need for timely diagnosis and treatment means.
[0003] With the development of sequencing technology, it is found that the generation of fusion genes is one of the important driving factors of cancer occurrence and progression.
[0004] In ICC, the main fusion mutation gene is Fibroblast Growth Factor Receptor 2 (FGFR2) driven fusion gene, and FGFR2 gene fusion mutation exists in more than 15% of ICC patients.
[0005] The fusion partner genes of FGFR2 in ICC are numerous, and more than 150 kinds have been found in current research; most of the FGFR2 driven fusion genes have a fixed mode in composition structure: at the N terminal, the fusion protein shares an almost identical FGFR2 part, including the complete kinase domain (FGFR2 exon1-17), at the C terminal, there is a dimerization / oligomerization domain provided by different fusion partner genes, including Bicaudal family RNA binding protein 1 (BICC1), adenosine homocysteinase 1 (AHCYL1) and Periphilin 1 (PPHLN1) and the like, and this mode shows that the breakpoints of FGFR2 driven fusion genes in cholangiocarcinoma are mostly located at the end of FGFR2 exon 17.
[0006] FGFR2 gene fusion with BICC1, AHCYL1 and other genes will continuously activate FGFR2 tyrosine kinase region and downstream signaling pathway, causing tumor occurrence. Clinical studies have found that small molecule targeted drugs such as Pemigatinib / Peimgatinib, Derazantinib / Derazantinib, Erdafitinib / Erdafitinib, Infigratinib / Infigratinib, Futibatinib / TAS-120, etc. can specifically act on FGFR2 gene fusion mutations, inhibit the activity of FGFR2 tyrosine kinase region, block its downstream signal transduction pathway, and inhibit tumor cell proliferation to achieve therapeutic effect. Therefore, detecting the FGFR2 fusion mutation state is the premise of guiding the use of targeted drugs, and it is of great significance to improve the survival rate of patients with cholangiocarcinoma, prolong the survival period and improve the quality of life.
[0007] Currently, the methods for detecting fusion genes mainly include chromosome karyotype analysis, fluorescence in situ hybridization (FISH), real-time fluorescent PCR (RT-PCR), and next-generation sequencing (NGS) methods. The first two techniques are commonly used clinical auxiliary diagnostic methods, but the sensitivity is very limited. RT-PCR and NGS have higher sensitivity, both of which can reach 1%, but RT-PCR has limited fusion gene targets and cannot detect unknown fusions, and NGS can detect unknown fusion genes, but the detection cost is high and the detection period is long.
[0008] For example, Chinese patent document CN 112143815 B (application number 202011332715.9) discloses a nucleic acid composition and detection method for detecting human FGFR2 gene fusion mutations, which is a real-time fluorescent PCR (RT-PCR) detection method: first extract the RNA of the detection sample and reverse transcribe it into cDNA, then use the above-mentioned kit to perform real-time fluorescent PCR reaction with cDNA as template, finally determine the positive and negative of the detection sample according to the Ct value, which can simultaneously detect 18 kinds of fusion genes driven by FGFR2.
[0009] For example, Chinese patent document CN 112301115 B (application number 202011001862.8) discloses a detection method for FGFRs gene mutations based on high-throughput sequencing, including the following steps: extracting sample genomic DNA and total RNA; fragmenting genomic DNA and recovering fragmented DNA; total RNA is broken and / or primer hybridization according to total RNA quality control; synthesizing cDNA first strand; synthesizing cDNA second strand; mixing fragmented DNA and cDNA to construct a mixed library; hybridization and capture using capture probes; library amplification and purification after capture; high-throughput sequencing and mutation analysis.
[0010] Digital PCR (dPCR) is a new absolute quantitative technique, which can determine the absolute number of target molecules as low as a single copy by micro-uniting the sample, greatly improving the accuracy and sensitivity of detection, and is an effective detection method for fusion gene detection. However, the conventional dPCR detection has the same limitations as RT-PCR, that is, the detection target is limited, and unknown fusion cannot be detected. SUMMARY
[0011] The technical problem to be solved by the present application is that the conventional method for detecting fusion genes by digital PCR can only detect known fusions, and the detection target is limited. The present application provides a method for detecting FGFR2 gene fusion mutations in cholangiocarcinoma by digital PCR, which effectively breaks through the limitation of the detection target, and provides a nucleic acid combination for detecting FGFR2 gene fusion mutations in cholangiocarcinoma.
[0012] The technical solution for achieving the object of the present application is a kit for detecting FGFR2 gene fusion mutations in cholangiocarcinoma, comprising reverse transcription reagents and PCR expression reagents.
[0013] The reverse transcription reagents comprise reverse transcription primers Uni-N6, reverse transcriptase and reverse transcription buffer; wherein the Uni sequence in Uni-N6 is a fixed sequence artificially synthesized, and N represents a random primer.
[0014] The PCR expression reagents comprise primers, probes, DNA polymerase and PCR buffer, and the primers and probes comprise Universal primer F primers, GSPprimer-R-Tail primers, Fusionprobe probes and WTprobe probes.
[0015] The Universal primer F primers are a sequence identical or partially identical to the Uni sequence of the reverse transcription primer Uni-N6.
[0016] In the GSPprimer-R-Tail primers, GSPprimer-R is a sequence on the 1-17th exon of the FGFR2 transcript, and Tail is a sequence complementary to a sequence close to the 3' end (breakpoint) of the 17th exon on the 18th exon of the FGFR2 transcript.
[0017] The Fusionprobe probe is a sequence on the 1-17th exon of the FGFR2 transcript.
[0018] The WTprobe probe is an arbitrary sequence on the 18th exon of the FGFR2 transcript.
[0019] The 5' end of the Fusion probe sequence is modified with a fluorescent group, the 5' end of the WT probe sequence is modified with a fluorescent group, and the 5' end fluorescent groups of the Fusion probe and the WT probe sequences are different.
[0020] The 3' end of the Fusion probe sequence is modified with a quenching group, and the 3' end of the WT probe sequence is modified with a quenching group.
[0021] Optionally, the last base of the Uni sequence in the reverse transcription primer Uni-N6 of the reverse transcription reagent is A.
[0022] In the above PCR expression reagent, the GSPprimer-R and the Fusion probe are two different sequences on the 1-17 exons of the FGFR2 transcript, the Fusion probe is in the downstream region of the GSPprimer-R primer position, and in the cDNA template, the Fusion probe is in the upstream region of the GSPprimer-R primer position.
[0023] In the above PCR expression reagent, the fluorescent group at the 5' end of the Fusion probe sequence is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5 fluorescent groups; the fluorescent group at the 5' end of the WT probe sequence is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5 fluorescent groups.
[0024] In the above PCR expression reagent, the 3' end group of the Fusion probe sequence is one of BHQ1, BHQ2, BHQ3, Dabcyl, Eclipse quenching group, and MGB; the 3' end group of the WT probe sequence is one of BHQ1, BHQ2, BHQ3, Dabcyl, Eclipse quenching group, and MGB; wherein MGB is a small groove binder plus NFQ quenching group modification.
[0025] Further, the length of the reverse transcription primer Uni-N6 sequence in the reverse transcription reagent is greater than or equal to 8 bases; the length of each primer or probe sequence in the PCR expression reagent is greater than or equal to 8 bases.
[0026] Optionally, in the reverse transcription reagent, the gene sequence of the reverse transcription primer Uni-N6 is SEQ ID NO. 1, SEQ ID NO. 8, or SEQ ID NO. 15, preferably SEQ ID NO. 1 or SEQ ID NO. 15, wherein N represents a random primer.
[0027] The gene sequence of the Universal primer F primer is SEQ ID NO. 2, SEQ ID NO. 9 or SEQ ID NO. 16.
[0028] The gene sequence of the GSP primer-R in the GSP primer-R-Tail primer is SEQ ID NO. 3, SEQ ID NO. 10 or SEQ ID NO. 17, and the gene sequence of the Tail is CGAGAGGTTGGCTGAGGTCCAAGTA or ACTGTTCGAGAGGTTGGCTGAGGTCCAAGTA.
[0029] The gene sequence of the Fusion probe probe is SEQ ID NO. 6, SEQ ID NO. 11 or SEQ ID NO. 18.
[0030] The gene sequence of the WTprobe probe is SEQ ID NO. 7, SEQ ID NO. 12 or SEQ ID NO. 19.
[0031] In the Fusion probe probe and the WTprobe probe, "+" represents a locked nucleic acid (LNA) modification, 5'VIC and 5'FAM are fluorescent group modifications, 3'BHQ1 is a quencher group modification, and 3'MGB is a 3' terminal connection small groove binder plus NFQ quencher group modification.
[0032] Optionally, in the PCR expression reagent, the amount-of-substance ratio of the Universal primer F primer, the GSP primer-R-Tail primer, the Fusion probe probe and the WTprobe probe is 1:1:0.5:0.5.
[0033] Optionally, the PCR expression reagent comprises 5X DNA Master mix, and the 5X DNA Master mix comprises a DNA polymerase and a PCR buffer.
[0034] The present application has the following positive effects: the kit of the present application utilizes the feature that the breakpoints of FGFR2-driven fusion genes are mostly located at the end of FGFR2 exon 17, and develops a design method of a universal joint based on digital PCR, which can detect all (about 150) fusions with breakpoints at the 3' end of FGFR2 exon 17 at one time.
[0035] On the basis of the above-mentioned universal joint, the kit of the present application further solves the problem of competitive inhibition with the pipe. The amplification of WTRNA can greatly inhibit the detection sensitivity of fusion RNA, therefore we specially design a tail sequence Tail for the fusion-specific primer, which is complementary to the sequence near the breakpoint of FGFR2 WT exon18, so as to inhibit the amplification of FGFR2 WT cDNA, thereby greatly increasing the amplification efficiency of FGFR2 fusion.
[0036] The detection technology of the combination of single-end anchoring and ddPCR amplification can effectively break through the problem of limited detection targets. The technical principle of the kit of the present application is that a fixed sequence (Uni) is introduced at the 5' end of cDNA in the reverse transcription (RT) stage as the binding site of the upstream primer (Universal primer-F), and after reverse transcription into cDNA, a sequence is selected on FGFR2 1-17 exons (exon 1-17) as the binding site of the downstream primer (GSP primer-R), and the entire region after FGFR2 17 exons can be completely amplified in ddPCR. A sequence tail is added to the 5' end of the GSP primer-R in the present application, which is complementary to a sequence near the breakpoint of FGFR2 WT exon18. Meanwhile, a sequence is selected between the binding site of the downstream primer and the 3' end of exon 17 as the binding site of the mutation probe (Fusion probe, 5' end fluorescent group labeled), and a sequence is selected on exon 18 as the binding site of the wild type probe (WT probe, 5' end fluorescent group labeled). The 5' end fluorescent groups of the Fusion probe and the WT probe are different, and the amplification of the FGFR2 wild type transcript produces double fluorescence labeled by the Fusion probe and the WT probe, and the amplification of the FGFR2 fusion transcript produces single fluorescence labeled by the Fusion probe, so as to distinguish the FGFR2 fusion gene and the FGFR2 wild type gene. Because the tail sequence at the 5' end of the fusion-specific primer (GSP primer-R) is complementary to the sequence near the breakpoint of FGFR2 WT exon18, the amplification of FGFR2 WT cDNA can be inhibited, and the amplification efficiency of FGFR2 fusion can be increased.
[0037] The kit of the present application is convenient to operate, and has the characteristics of high sensitivity, high accuracy, low cost and the like, and can be used as a clinical drug reference. BRIEF DESCRIPTION OF DRAWINGS
[0038] Figure 1 The principle diagram of the present application.
[0039] Figure 2FGFR2 GSP primer R Set 1D scatter plot: FAM channel (FGFR2 WT Type) and VIC channel (FAM cutoff: 17000; VIC cutoff: 13000).
[0040] Figure 3 FGFR2 GSP primer R-Tail 1 Set 1D scatter plot: FAM channel (FGFR2 WT Type) and VIC channel (FAM cutoff: 17000; VIC cutoff: 13000).
[0041] Figure 4 FGFR2 GSP primer R-Tail 2 Set 1D scatter plot: FAM channel (FGFR2 WT Type) and VIC channel (FAM cutoff: 17000; VIC cutoff: 13000).
[0042] Figure 5 FGFR2 GSP primer R / GSP primer R-Tail 1 / GSP primer R-Tail 2 Set 2D scatter plot (FAM cutoff: 17000; VIC cutoff: 13000).
[0043] Figure 6 FGFR2 GSP primer-R_NO.8 / GSP primer-R_NO.8-Tail 1 / GSP primer-R_NO.8-Tail 2 Set 2D scatter plot (FAM cutoff: 20000; VIC cutoff: 11000).
[0044] Figure 7 FGFR2 GSP primer-R_NO.11 / GSP primer-R_NO.11-Tail 1 / GSP primer-R_NO.11-Tail 2 Set 2D scatter plot (FAM cutoff: 25000, VIC cutoff: 8800).
[0045] Figure 8 FGFR2 GSP primer R-Tail 1 Replicate Verification 2D scatter plot (FAM cutoff: 20000; VIC cutoff: 13000).
[0046] Figure 9Linear relationship of copy number of FGFR2 GSP primer R-Tail 1 for different RNA input (FAM cutoff: 20000; VIC cutoff: 13000).
[0047] Figure 10 2D scatter plot of FGFR2 GSP primer R-Tail 1 in clinical samples (FAM cutoff: 20000; VIC cutoff: 13000). DETAILED DESCRIPTION
[0048] The following describes some of the multiple possible embodiments of the present application, which are intended to provide a basic understanding of the present application and are not intended to identify key or decisive elements or limit the scope of protection. It is easily understood that, according to the technical solutions of the present application, other implementation manners can be proposed by those skilled in the art without changing the essential spirit of the present application. Therefore, the following detailed description is only an exemplary description of the technical solutions of the present application, and should not be regarded as the whole or as a limitation or restriction of the technical solutions of the present application.
[0049] The partial primer probe sequence information involved in the following examples (1 and 2) and test examples is as follows:
[0050]
[0051]
[0052] In the table, Uni sequence is a fixed sequence artificially synthesized, N represents a random primer, + indicates a locked nucleic acid (LNA) modification, 5'VIC and 5'FAM are fluorescent group modifications, and 3'BHQ1 is a quencher group modification.
[0053] The fluorescent group at the 5' end of the Fusion probe and the WT probe is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5 fluorescent groups, and the fluorescent groups at the 5' ends of the Fusion probe and the WT probe are different.
[0054] In addition to the above-mentioned BHQ1, the 3' end quencher group of the Fusion probe and the WT probe can also be one of BHQ2, BHQ3, Dabcyl, and Eclipse quencher groups; the group at the 3' end of the Fusion probe and the WT probe can also be modified with MGB, and the MGB is a small groove binder plus NFQ quencher group modification.
[0055] The Universal primer-F sequence is a sequence identical or partially identical to the Uni sequence of the RT primer (Uni-N6). The sequence in the table is identical. The GSP primer-R sequence is the base sequence at positions 2886-2905 of the E1-17 region of the FGFR2 transcript (NM_022970.3). The Tail1 part of the GSP primer R-Tail 1 sequence is the reverse complement of the sequence at positions 2955-2980 of E18 of the FGFR2 transcript (NM_022970.3). The Tail2 part of the GSP primer R-Tail 2 sequence is the reverse complement of the sequence at positions 2955-2986 of E18 of the FGFR2 transcript (NM_022970.3). The Fusion probe sequence is the base sequence at positions 2923-2944 of the E1-17 region of the transcript (NM_022970.3). The WT probe is the base sequence at positions 37-63 of E18 of the transcript (NM_022970.3). The GSP primer-R primer and the Fusion probe are two different sequences on the exon 1-17 of the FGFR2 transcript, and the Fusion probe is downstream of the GSP primer-R primer. The WT probe is any sequence on the exon 18 of the FGFR2 transcript.
[0056] (Example 1)
[0057] The kit of the present embodiment includes a reverse transcription reagent (RNA reverse transcription to cDNA reagent) and a PCR expression reagent.
[0058] The reverse transcription reagent includes a reverse transcription buffer, a reverse transcription enzyme, a Uni-N6 primer, and enzyme-free water. Specifically, the reverse transcription reagent of the present embodiment includes 5X PrimeScript Buffer 2 μL, PrimeScript RT Enzyme Mix I 0.5 μL, Uni-N6 primer (10 μM) 2 μL, and enzyme-free water 5.5 μL.
[0059] The PCR expression reagent includes primers, probes, a DNA polymerase, a buffer, and enzyme-free water; the primers and probes include a Universal primer F primer, a GSP primer-R-Tail primer, a Fusion probe, and a WT probe.
[0060] Specifically, the PCR expression reagent of the embodiment includes 5X DNA Master mix 7 μL, Universal primer-F (10 μM) 1.4 μL, GSP primer-R-Tail (10 μM) 1.4 μL, Fusion probe (10 μM) 0.7 μL, WT probe 0.7 μL, and enzyme-free water 18.8 μL; the 5X DNA Master mix contains DNA polymerase and buffer.
[0061] See Figure 1 The method for detecting FGFR2 gene fusion mutation in cholangiocarcinoma by using the kit and digital PCR includes the following steps:
[0062] S1, preparation of the genomic RNA of the sample to be tested.
[0063] The wax block of the sample to be tested is made into a tissue section of 10 μm, and after being dewaxed, the genomic RNA is extracted from the sample to be tested by using the Qiagen DSP FFPE Kit RNA extraction kit (item number: 73604) to obtain 20 μL of total RNA with a concentration of 100-300 ng / μL.
[0064] Any extraction method of the extracted RNA including mRNA can be selected.
[0065] Specifically, the RNA extraction method can be any one of the extraction methods such as phenol-chloroform method, silica gel column method, magnetic bead method, Trizol method, and RNeasy method, or a commercial RNA extraction kit can be directly used.
[0066] S2, reverse transcription of the RNA into cDNA, and a fixed sequence Uni-N6 is introduced at the 5' end of the cDNA in the reverse transcription (RT) stage as a binding site of the upstream primer (Universal primer-F).
[0067] S2-1, heating the RNA at 65±5℃ (65℃ in the embodiment) for 1.5-2.5 min (2 min in the embodiment) to denature the secondary structure, and then rapidly cooling on ice.
[0068] S2-2, adding 20 ng of the RNA template into the reverse transcription reagent to prepare the following reverse transcription reaction system on ice:
[0069] Component Volume (μL) 5X PrimeScript Buffer 2 PrimeScript RT Enzyme Mix I 0.5 Uni-N6 primer (10 μM) 2 RNA template 20 ng H2O up to 10
[0070] The PrimeScript Buffer and PrimeScript RT Enzyme were ordered from Baori Biotechnology (Beijing) Co., Ltd. (Catalog No.: RR037A). The amount of RNA used can be adjusted according to sample type and experimental purpose. Then
[0071] S2-3. Perform the reverse transcription reaction under the following conditions:
[0072] Temperature Time 37℃ 15 min 85℃ 5 sec 4℃ Incubate until reverse transcription is complete .
[0073] S3, digital PCR reaction.
[0074] S3-1. Take 5 μL of RT reaction product as an amplification template, add it to the PCR expression reagent, and prepare the following dPCR system at room temperature. After mixing evenly, take 30 μL of the system to enter the droplet generation step.
[0075]
[0076] The 5X DNAMaster mix is sourced from Roche (catalog number: 09393544001). The 5X DNAMaster mix includes reaction buffer (PCR buffer), DNA polymerase, cDNA template, and the amount of primers and probes can be adjusted according to experimental requirements.
[0077] S3-2. The obtained PCR reaction system was prepared into uniform droplets using a Roche Digital LC sample dispenser, with the droplet size being approximately 1 nL.
[0078] For droplets, the following conditions are applied in Roche Digital Amplification reaction and fluorescence signal detection were performed on a digital PCR instrument.
[0079]
[0080] After the reaction is complete, use Digital The insertion / deletion analysis method using Development Software (Roche) was used to calculate the copy number of FGFR2 wild-type and fusion transcripts. The result was then combined with droplet fluorescence distribution for differentiation: FGFR2 wild-type transcripts produced both VIC and FAM fluorescence during amplification, while FGFR2 fusion transcripts produced only VIC fluorescence, thus distinguishing between the two. A total mutant gene copy number ≥1 calculated from the insertion / deletion analysis was considered a positive result based on fluorescence intensity; a total mutant gene copy number <1 was considered a negative result.
[0081] (Example 2)
[0082] In the kit of this example, the reverse transcription reagent is the same as in Example 1, and the GSP primer-R-Tail primer in the PCR expression reagent is GSP primer-R-Tail 2.
[0083] (Examples 3-4)
[0084] In the kit of Example 3-4, the primer probe sequences are different from those in Example 1, wherein the GSP primer-R-Tail primer in the kit of Example 3 is GSP primer-R_NO.8-Tail 1, and the nucleic acid combination in the kit of Example 3 is SEQ ID NO.8, 9, 11, 12, 13.
[0085] In the kit of Example 4, the GSP primer-R-Tail primer is GSP primer-R_NO.8-Tail 2, and the nucleic acid combination in the kit of Example 4 is SEQ ID NO.8, 9, 11, 12, 14.
[0086] The specific information is as follows:
[0087]
[0088]
[0089] (Examples 5-6)
[0090] The kits of Examples 5-6 are the same as those of Example 1, except that the primer probe sequence information used is as follows:
[0091] In the kit of Example 5, the GSP primer-R-Tail primer is GSP primer-R_NO.11-Tail 1, and the nucleic acid combination in the kit of Example 5 is SEQ ID NO.15, 16, 18, 19, 20.
[0092] In the kit of Example 6, the GSP primer-R-Tail primer is GSP primer-R_NO.11-Tail 2, and the nucleic acid combination in the kit of Example 6 is SEQ ID NO.15, 16, 18, 19, 21.
[0093] The specific information is as follows:
[0094]
[0095]
[0096] Test Example 1, Example 1, 2, detection of validity of the scheme.
[0097] 1) FGFR2-Casp7 fusion cell line full-length RNA (8 Kb); 2) FGFR2-BICC1 fusion cell line full-length RNA (5 Kb); 3) 1:1 mixture of FGFR2-Casp7 and FGFR2-BICC1 fusion cell line full-length RNA as positive template, normal liver cell line L02 RNA as negative control, reverse transcription according to the RT system of Example 1, then take 5 μL RT product for PCR amplification.
[0098] The three groups of nucleic acid combinations of the test are respectively:
[0099] GSP-R group: SEQ ID NO. 1, 2, 3, 6, 7.
[0100] Tail 1 group: SEQ ID NO. 1, 2, 4, 6, 7.
[0101] Tail 2 group: SEQ ID NO. 1, 2, 5, 6, 7.
[0102] After the program ends, according to the droplet fluorescence distribution combined with insertion and deletion analysis method, it is judged whether there is positive detection, and the experimental results are shown in Table 1 and Table 2, and see Figure 2 to Figure 5 .
[0103] Table 1 Copy number display of FGFR2 GSP primer R / GSP primer R-Tail 1 / GSP primer R-Tail 2 group (FAM cutoff: 17000; VIC cutoff: 13000)
[0104]
[0105] Table 2 Difference between theoretical copy number and actual copy number of FGFR2-BICC1+Casp7 mixed at 1:1
[0106]
[0107]
[0108] The result interpretation is mainly based on the fluorescence intensity reading result, using 1D scatter plot for cluster analysis. First, take the fluorescence intensity of the negative experimental group as a reference, and divide the two fluorescence channels (FAM+VIC) into threshold values. After dividing the threshold value, the result graph can be divided into four quadrants. The first quadrant is the double positive droplet area of FAM and VIC fluorescence, the second quadrant is the single positive droplet area of FAM fluorescence, the third quadrant is the droplet area without any excited fluorescence, i.e. the negative droplet area, and the fourth quadrant is the single positive droplet area of VIC fluorescence.
[0109] According to the principles of the present technology, FGFR2 wild type template amplification will excite FAM and VIC fluorescence at the same time, and the droplets will be gathered in the first quadrant. FGFR2 fusion template amplification will only excite VIC, and the droplets will be gathered in the fourth quadrant. Negative droplets without any excited fluorescence should be gathered in the third quadrant.
[0110] From Figure 5 It can be seen that there is no positive droplet in the negative experimental group, indicating that there is no non-specific amplification in the system. In the GSP-R group, the first quadrant and the fourth quadrant of the fusion positive template experimental group (FGFR2-BICC1 / Casp7 / BICC1+Casp7) appear obvious droplet gathering, i.e. double positive droplets (green) and VIC single positive droplets (blue), corresponding to FGFR2 wild type detection and FGFR2 fusion detection respectively. The results are as expected and effective.
[0111] From Figure 5 It can also be seen that in the Tail1 and Tail2 groups, in the fusion positive template experimental group (FGFR2-BICC1 / Casp7 / BICC1+Casp7), the original double positive droplets have no green droplets in the first quadrant due to the inhibition of WT amplification. From Figure 3-4 It can also be seen that compared with Figure 2 In the GSP-R group, the FAM channel WT amplification signal of the fusion positive template experimental group (FGFR2-BICC1 / Casp7 / BICC1+Casp7) is significantly reduced, while the VIC channel fusion signal is significantly increased. In addition, more points of signal are close to the high signal value of 18400 due to good amplification effect, and the overall positive signal is more concentrated. The difference of copy number amplification can be further seen from Table 1. In addition, we also noticed that the last group of BICC1+Casp7 fusion cell line full-length RNA 1:1 mixed, the copy number amplified by the result is about the same as the average number of 20 ng detected by FGFR2-BICC1 and FGFR2-Casp7 respectively (Table 2). It shows that the bias for FGFR2 unknown fusion detection is very small.
[0112] The above experimental results show that the present scheme can detect FGFR2 wild type target and FGFR2 fusion target at the same time, and through the special design of the fusion specific R primer 5'tail, the sequence complementary to the sequence near the breakpoint of FGFR2 WT exon18 is achieved, so as to inhibit the amplification of FGFR2 WT cDNA, thereby greatly increasing the amplification efficiency of FGFR2 fusion. In addition to the two groups of FGFR2 driven fusion genes verified by the above experiments, the present scheme is also suitable for the detection of other FGFR2 driven fusion targets.
[0113] (Experimental Example 2), effectiveness detection of Examples 3-6.
[0114] I. Effectiveness detection of Examples 3 and 4.
[0115] 1) FGFR2-Casp7 fusion cell line full-length RNA (8Kb); 2) FGFR2-BICC1 fusion cell line full-length RNA (5Kb); 3) 1:1 mixture of FGFR2-Casp7 and FGFR2-BICC1 fusion cell line full-length RNA as positive template, normal liver cell line L02 RNA as negative control, according to the conditions of Example 1, nucleic acid combinations of Example 3 and Example 4 were reverse transcribed, and then 5 μL of RT product was taken for PCR amplification.
[0116] The three groups of nucleic acid combinations of the experiment are:
[0117] GSPprimer-R_NO.8 group: SEQ ID NO. 8, 9, 10, 11, 12.
[0118] GSPprimer-R_NO.8_Tail 1 group: SEQ ID NO. 8, 9, 11, 12, 13.
[0119] GSPprimer-R_NO.8_Tail 2 group: SEQ ID NO. 8, 9, 11, 12, 14.
[0120] After the program ends, according to the droplet fluorescence distribution combined with the insertion and deletion analysis method, it is judged whether there is positive detection, and the experimental results are shown in Tables 3, 4 and see Figure 6 .
[0121] Table 3 Copy number display of FGFR2 GSP-R_NO.8 / GSP primer-R_NO.8_Tail 1 / GSP primer-R_NO.8_Tail 2 three groups (FAM cutoff: 20000; VIC cutoff: 11000)
[0122]
[0123] Table 4 Difference between theoretical copy number and actual copy number of FGFR2-BICC1+Casp7 mixed at 1:1
[0124]
[0125]
[0126] II. Validity detection of the protocol of Example 5, 6.
[0127] 1) FGFR2-Casp7 fusion cell line full-length RNA (8 Kb); 2) FGFR2-BICC1 fusion cell line full-length RNA (5 Kb); 3) mixture of FGFR2-Casp7 and FGFR2-BICC1 fusion cell line full-length RNA 1:1 as positive template, normal liver cell line L02 RNA as negative control, according to the conditions of Example 1, the reaction primers of Example 5 and Example 6 were reverse transcribed, and then 5 μL of RT product was taken for PCR amplification.
[0128] The three groups of nucleic acid combinations tested are respectively:
[0129] GSPprimer-R_NO.11 group: SEQ ID NO. 15, 16, 17, 18, 19.
[0130] GSPprimer-R_NO.11_Tail 1 group: SEQ ID NO. 15, 16, 18, 19, 20.
[0131] GSPprimer-R_NO.11_Tail 2 group: SEQ ID NO. 15, 16, 18, 19, 21.
[0132] After the program ends, according to the droplet fluorescence distribution combined with the insertion and deletion analysis method, it is judged whether there is positive detection, and the experimental results are shown in Table 5, Table 6 and see Figure 7 .
[0133] Table 5 Copy number display of FGFR2 GSP-R_NO.11 / GSP primer-R_NO.11_Tail 1 / GSP primer-R_NO.11_Tail 2 three groups
[0134]
[0135]
[0136] Table 6 Difference between theoretical copy number and actual copy number of FGFR2-BICC1+Casp7 mixed at 1:1
[0137]
[0138] in conclusion:
[0139] 1. Primers NO.8 and NO.11 in Examples 3-6 showed some FAM single positive spots in the second quadrant. It is speculated that there are two reasons: 1) the VIC probe concentration is low, and FGFR2 WT binding is insufficient; 2) the WT FAM probe has insufficient specificity, which may bind to other primers to form primer dimers or extended product-primer polymers, resulting in false positives.
[0140] 2. From Figure 6 and Figure 7 It can be seen that primers NO.8 and NO.11 do not have the same specificity. Figure 5 The first set of primers was excellent, but the phenomenon of inhibiting WT amplification through Tail complementarity with WT was reproducible. In the GSPprimer R-Tail 1 and GSPprimer R-Tail 2 groups, the FAM value of double-positive droplets in the first quadrant of the fusion positive template experimental group (FGFR2-BICC1 / Casp7 / BICC1+Casp7) decreased due to the inhibition of WT amplification.
[0141] 3. As can be seen from Tables 3 and 5, compared with the GSP primer R group, the WT copy number of the fusion positive template experimental group (FGFR2-BICC1 / Casp7 / BICC1+Casp7) of these two groups was reduced to a certain extent, and the copy number of VIC channel fusion was also reduced. This may be related to the non-specific amplification of the primers themselves. Primer dimers and dimers generated during amplification can affect the detection of fusion signals.
[0142] 4. The primer systems in Examples 1 and 2, and the two primer systems in Examples 3 and 4 (NO. 8) and Examples 5 and 6 (NO. 11), all detected the same target, but the detected copy numbers differed significantly. Example 1 > Examples 5 and 6 (NO. 11) > Examples 3 and 4 (NO. 8), indicating that primer optimization is crucial in this method.
[0143] The above experimental results show that this method can not only detect both wild-type FGFR2 targets and FGFR2 fusion targets simultaneously, but also, through the special design of the fusion-specific primer 5'tail, achieve the purpose of inhibiting FGFR2 WT cDNA amplification by being complementary to the sequence near the breakpoint of FGFR2 WT exon18, thereby increasing the amplification efficiency of FGFR2 fusion.
[0144] (Experimental Example 3) Repeatability Test
[0145] The complete FGFR2-Casp7 and FGFR2-BICC1 fusion cell line RNA1:1 mixture was used as a positive template to set up four gradient RNA input experiments of 20 ng, 10 ng, 5 ng, and 2.5 ng, with 20 ng of normal liver cell line LO2 RNA as a negative control. The downstream primer Tail1 replaced GSP-R for 5 replicates in each group. The RT system was prepared according to Example 1 and reverse transcription was performed. Subsequently, 5 μL of RT product was subjected to PCR amplification. After the program ended, the FGFR2 wild-type and fusion copy numbers of each experimental group were counted according to the insertion-deletion analysis method. The results are shown in Table 7, see Figure 8 and Figure 9 .
[0146] Table 7 FGFR2 GSP primer R-Tail 1 repeated detection copy numbers at different RNA inputs (FAM cutoff: 20000; VIC cutoff: 13000)
[0147]
[0148]
[0149] The above table from top to bottom is the 2.5 ng, 5 ng, 10 ng, and 20 ng experimental groups, respectively.
[0150] From Figure 8 It can be seen that this scheme can achieve specific detection of FGFR2 fusion targets for positive samples of 2.5-20 ng, and effectively suppresses the wild-type copy number.
[0151] Table 7 shows that the difference in fusion detection of the repeated groups at 2.5 ng input is 12%, which may be due to the low RNA input. However, at 5 ng, 10 ng, and 20 ng input, the fusion and copy number detection differences of the 5 repeated experimental groups are basically less than 10%, indicating that the detection repeatability of this scheme is good within the detection limit.
[0152] From Figure 9 It can be seen that the copy number of this system has a good linear relationship at different RNA inputs, with a linear R 2 = 0.9883.
[0153] (Experimental Example 4), detection of clinical positive samples
[0154] Take 3 cases of verified FGFR2-BICC1 and FGFR2-Casp7 fusion positive clinical RNA samples (clinical samples 1-3) 20 ng, 20 ng normal hepatocyte line L02 RNA as negative control, according to the preparation of RT system and reverse transcription of example 1, then take 5 μL RT product for PCR amplification. After the program, use the insertion and deletion analysis method in Roche digital PCR analysis software (Digital Development Software) for data analysis, the results are shown in Table 8, see Figure 10 .
[0155] Table 8 FGFR2 fusion and wild type transcript copy number of clinical positive sample
[0156]
[0157] From Figure 10 it can be seen that the fourth quadrant of the result graph of the three clinical samples has obvious VIC single positive droplet aggregation, indicating that FGFR2 fusion target exists in the three samples, which is consistent with the clinical detection results. And there is no droplet in the first quadrant, indicating that the wild type amplification is strongly inhibited when using this method.
[0158] The FGFR2 wild type copy number and fusion copy number in each sample obtained after data analysis and conversion are shown in Table 8, wherein fusion / wild type (copy / μL) is the output result of the analysis software, fusion / wild type (copies) is the target copy number in the sample after conversion, and the results show that in the system of 30 μL, the total copy number of mutant genes calculated from the three clinical samples is greater than 1 (total copy number = concentration (copy / μL) × volume (30 μL)), indicating that the fusion is positive. The above experimental results prove that the detection results of this scheme are consistent with the clinical detection results.
Claims
1. A kit for detecting FGFR2 gene fusion mutation in cholangiocarcinoma, characterized by: The reverse transcription reagent and the PCR expression reagent are included; The reverse transcription reagent includes a reverse transcription primer Uni-N6, a reverse transcriptase and a reverse transcription buffer; wherein the Uni sequence in Uni-N6 is a fixed sequence artificially synthesized, and N represents a random primer; The PCR expression reagent includes primers, probes, a DNA polymerase and a PCR buffer, and the primers and the probes include a Universal primer F primer, a GSP primer-R-Tail primer, a Fusion probe and a WT probe; The Universal primer F primer is a sequence identical or partially identical to the Uni sequence of the reverse transcription primer Uni-N6; The GSP primer-R-Tail primer includes a GSP primer-R and a Tail, the GSP primer-R is a sequence on the 1-17th exon of the FGFR2 transcript, and the Tail is a sequence complementary to a sequence close to the 3' end of the 17th exon on the 18th exon of the FGFR2 transcript; The Fusion probe is a sequence on the 1-17th exon of the FGFR2 transcript; The WT probe is an arbitrary sequence on the 18th exon of the FGFR2 transcript; When the gene sequence of the reverse transcription primer Uni-N6 is SEQ ID NO. 1, the gene sequence of the Universal primer F primer is SEQ ID NO. 2, the gene sequence of the GSP primer-R-Tail primer is SEQ ID NO. 4 or SEQ ID NO. 5, the gene sequence of the Fusion probe is SEQ ID NO. 6, and the gene sequence of the WT probe is SEQ ID NO. 7; When the gene sequence of the reverse transcription primer Uni-N6 is SEQ ID NO. 8, the gene sequence of the Universal primer F primer is SEQ ID NO. 9, the gene sequence of the GSP primer-R-Tail primer is SEQ ID NO. 13 or SEQ ID NO. 14, the gene sequence of the Fusion probe is SEQ ID NO. 11, and the gene sequence of the WT probe is SEQ ID NO. 12; When the gene sequence of the reverse transcription primer Uni-N6 is SEQ ID NO. 15, the gene sequence of the Universal primer F primer is SEQ ID NO. 16, the gene sequence of the GSP primer-R-Tail primer is SEQ ID NO. 20 or SEQ ID NO. 21, the gene sequence of the Fusion probe is SEQ ID NO. 18, and the gene sequence of the WT probe is SEQ ID NO. 19; The 5' end of the Fusion probe sequence is modified with a fluorescent group, the 5' end of the WT probe sequence is modified with a fluorescent group, and the 5' end fluorescent groups of the Fusion probe and the WT probe sequence are different; The 3' end of the Fusion probe sequence is modified with a quenching group, and the 3' end of the WT probe sequence is modified with a quenching group. In the Fusion probe and the WT probe, "+" indicates a locked nucleic acid (LNA) modification. 2.The kit for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: In the reverse transcription primer Uni-N6 of the reverse transcription reagent, the last base of the Uni sequence is A. 3.The kit for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: In the PCR expression reagent, the GSP primer-R and the Fusion probe are two different sequences on the 1-17 exons of the FGFR2 transcript. 4.The kit for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: In the PCR expression reagent, the fluorescent group at the 5' end of the Fusion probe sequence is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5; and the fluorescent group at the 5' end of the WT probe sequence is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.
5. 5.The kit for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: In the PCR expression reagent, the 3' end group of the Fusion probe sequence is one of BHQ1, BHQ2, BHQ3, Dabcyl, Eclipse quenching group, and MGB; the 3' end group of the WT probe sequence is one of BHQ1, BHQ2, BHQ3, Dabcyl, Eclipse quenching group, and MGB; and MGB is a small groove binder plus NFQ quenching group modification.
6. The kit for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to any one of claims 1 to 5, characterized in that: The length of the Uni-N6 sequence of the reverse transcription primer in the reverse transcription reagent is greater than or equal to 8 bases; and the length of each primer or probe sequence in the PCR expression reagent is greater than or equal to 8 bases. 7.The kit for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: In the PCR expression reagent, the Universal primer F primer, the GSP primer-R-Tail primer, the Fusion probe, and the WT probe have a molar ratio of 1:1:0.5:0.
5. 8.The kit for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: The PCR expression reagent includes 5X DNA Master mix, and the 5X DNA Master mix includes a DNA polymerase and a PCR buffer.
Citation Information
Patent Citations
A nucleic acid composition, kit, and detection method for detecting human FGFR2 gene fusion mutations.
CN112143815B
A method and probe sequence for detecting FGFR gene mutations based on high-throughput sequencing
CN112301115B
Nucleic acid composition, kit and detection method for detecting fusion mutation of human FGFR2 (fibroblast growth factor receptor 2) gene
CN112143815A
KR20240009343A