Application of SNP molecular marker related to resistance of macrobrachium rosenbergii iridovirus disease

Abstract

The invention discloses application of an SNP molecular marker related to resistance of macrobrachium rosenbergii iridovirus disease, and relates to the technical field of biology. The SNP molecular marker is located at the 69688355th site from the 5'end on a chromosome 2 of a macrobrachium rosenbergii genome and is G or T, and the GT genotype macrobrachium rosenbergii has strong resistance to iridovirus diseases; or the 16939259th site from the 5'end on the 52 # chromosome of the macrobrachium rosenbergii genome is A or C, and the macrobrachium rosenbergii with the genotype A or C has strong resistance to the iridovirus disease. The SNP molecular marker disclosed by the invention is closely related to the resistance of the macrobrachium rosenbergii iridovirus disease, so that related indexes of the macrobrachium rosenbergii can be detected through the SNP molecular marker disclosed by the invention, or genetic improvement of the macrobrachium rosenbergii can be carried out through the SNP molecular marker.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to an application of a SNP molecular marker associated with the resistance of Macrobrachium rosenbergii to iridovirus disease. Background Art

[0002] Macrobrachium rosenbergii Macrobrachium rosenbergii ) belongs to the order Decapoda, family Palaemonidae, genus Macrobrachium Macrobrachium ), is one of the important freshwater aquaculture species in my country. It is widely popular in the aquatic consumer market due to its excellent meat quality and high economic value. However, in recent years, due to the high-density and intensive farming model, the outbreak of iridovirus disease in the farming process of Macrobrachium rosenbergii has posed a serious threat to the industry.

[0003] Iridovirus disease, caused by Decapoda Iridovirus 1 (DIV1), is a highly contagious disease. Sick Macrobrachium rosenbergii exhibits a variety of clinical symptoms, including loss of appetite, slow movement, weak swimming, slow swimming, lying on the side, and the most typical "white head" phenomenon - obvious white spots appear inside the carapace at the base of the frontal sword. As the disease worsens, the body color of the diseased shrimp gradually turns reddish, the gills become congested and red, the hepatopancreas atrophies, the jejunum becomes empty, and eventually leads to large-scale deaths. These symptoms not only seriously affect the growth rate and health of the shrimp, but also lead to large-scale deaths, causing huge economic losses to farmers.

[0004] SNP (single nucleotide polymorphism) is one of the most common forms of genetic variation, which can reveal genetic differences between different individuals and provide an important basis for the study of genetic traits. As an advanced genetic tool, genome-wide association analysis (GWAS) can identify the complex relationship between genes and specific phenotypes (such as disease resistance) by utilizing the linkage disequilibrium phenomenon between SNPs.

[0005] In the field of genetic breeding for disease resistance in plants and livestock, GWAS has achieved remarkable results. By mining molecular markers related to major selected traits (such as disease resistance) and applying them to marker-assisted selection (MAS) and whole genome selection (GS), scientists have successfully bred varieties with multiple excellent traits. Compared with traditional breeding methods, these technologies not only accelerate the process of pure and homozygous alleles related to traits, but also greatly improve breeding efficiency and genetic selection progress, providing strong support for the sustainable development of agricultural production.

[0006] In the field of genetic breeding for disease resistance in plants and livestock, the use of molecular information to assist breeding has been widely used. However, in the field of disease resistance breeding in aquatic animals, especially in the breeding of iridovirus disease resistance in Macrobrachium rosenbergii, the application of GWAS is still in its infancy. Although there have been many reports on genetic variation and disease resistance in Macrobrachium rosenbergii in recent years, there has been no detailed study on SNP loci associated with iridovirus disease resistance. In addition, as a typical quantitative trait, disease resistance is usually affected by multiple genes and environmental factors, and its genetic mechanism is complex, making it difficult to effectively evaluate through simple phenotypic observations. Traditional resistance determination criteria are usually based on survival / death status, and this binary classification may not fully reflect the differences in disease resistance between individuals. Summary of the invention

[0007] Based on the deficiencies in the prior art, the present invention provides an application of SNP molecular markers related to the resistance of Macrobrachium rosenbergii to iridovirus disease. The present invention uses survival time as the resistance judgment standard, and measures the survival time of individuals after infection to evaluate the resistance level of individuals to iridovirus disease, thereby improving the accuracy of disease resistance gene site identification. By identifying and verifying these key SNP sites, new possibilities and directions will be provided for the disease resistance breeding of Macrobrachium rosenbergii and the sustainable development of the industry.

[0008] In one aspect, the present invention provides a SNP molecular marker associated with the resistance of Macrobrachium rosenbergii to iridovirus disease, wherein the SNP molecular marker comprises at least one of the following SNP molecular markers: The first type, the nucleotide sequence containing the SNP molecular marker is shown in SEQ ID No. 1, the SNP molecular marker is located at the 300th position from the 5' end of SEQ ID No. 1, corresponds to the 69688355th position from the 5' end on chromosome 2 of the Macrobrachium rosenbergii genome, and is G or T; The second type, the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No.2, and the SNP molecular marker is located at the 300th position from the 5' end of SEQ ID No.2, corresponding to the 16939259th position from the 5' end on chromosome 52 of the Macrobrachium rosenbergii genome, and is A or C.

[0009] Wherein, the sequence shown in SEQ ID No.1 is: CTGGAAATAGATGGATCGGTAAGCTGTCTTAGGAGATGGAAATCTACCTGATAAAGAGCTTACAAACGTAAAAACAACAGGTAAAGATCTAAGAAGAGGAAAGTGAGTCTAAGTAACAAAAGAATAAAGAAAAAAAATTTCATAGACCAGTCATGAAAATAAAAATAGCTGTATTGAATAATAAAAAGCTATGAAAAACAGGCGTTAATGAAGCCCTTTTTGTTGATTAATGTCAATATTCTTCTCTTTCACGCGCTAAATATTGCGAATAAATTCTTTACAGATTAACTGTAGATTTTKATATTTATCTAAGTTTTGCTGAAAGGATGGACTTGTATGCTAAATAATGAAGCAGTGCAATATTCAGCGAAGGTATAACGTTATATCTAAGACTAAGCATTGTTCGTAGTATGTTGCATTTTTTCAGTCTGTACTCACCACCGTCAGGCTCAATGAAGAAAGGCGAGGTATCTTTTTAACTAGACATATGTTATCACCTTAAAGGCAACACAAACAACTTAACACTTGGATGGGATTTCAACTGTATCATCAGTAGAAAAGATTGTTCAAAAATAATTCTTACCTAATATTTTTCAGAC, where K is G or T.

[0010] The sequence shown in SEQ ID No.2 is: , where M is A or C.

[0011] For the first type, when the SNP molecular markers in the sequence shown in SEQ ID No.1 on the two chromosomes are G and T respectively, it is called the GT genotype, and the GT genotype Macrobrachium rosenbergii has strong resistance to iridovirus disease (taking the survival time of Macrobrachium rosenbergii after being infected with Decapoda iridovirus 1 as an indicator, individuals with long survival time are judged as individuals with strong resistance to iridovirus disease, and individuals with short survival time are judged as individuals with weak resistance to iridovirus disease); when the SNP molecular markers in the sequence shown in SEQ ID No.1 on the two chromosomes are G, G or T, T respectively, it is called the GG or TT genotype, and the GG or TT genotype Macrobrachium rosenbergii has weak resistance to iridovirus disease; for the second type, when the SNP molecular markers in the sequence shown in SEQ ID No.2 on the two chromosomes are A and C respectively, it is called the AC genotype, and the AC genotype Macrobrachium rosenbergii has strong resistance to iridovirus disease; when the SNP molecular markers in the sequence shown in SEQ ID No.2 on the two chromosomes are A and A respectively, it is called the AA genotype, and the AA genotype Macrobrachium rosenbergii has weak resistance to iridovirus disease.

[0012] On the other hand, the present invention provides the use of the SNP molecular marker in determining the resistance of Macrobrachium rosenbergii to iridovirus disease.

[0013] In another aspect, the present invention provides a method for determining the resistance of Macrobrachium rosenbergii to iridovirus disease, the method comprising: determining the SNP molecular marker of Macrobrachium rosenbergii, and determining the iridovirus disease resistance trait of Macrobrachium rosenbergii according to the SNP molecular marker: If the SNP molecular marker is the first type, the trait of resistance to iridovirus disease of Macrobrachium rosenbergii is ranked from strong to weak based on the genotype of the 300th site from the 5' end of the SEQ ID No. 1: GT genotype, GG genotype or TT genotype; If the SNP molecular marker is the second type, the trait of resistance to iridovirus disease of Macrobrachium rosenbergii is ranked from strong to weak based on the genotype of the 300th position from the 5' end on the SEQ ID No. 2: AC genotype, AA genotype.

[0014] Finally, the present invention provides a method for genetic improvement of Macrobrachium rosenbergii, wherein the genetic improvement is the genetic improvement of the resistance trait of shrimp iridovirus disease, and the method comprises: determining the above-mentioned SNP molecular markers of seed shrimps in the core group of Macrobrachium rosenbergii, and making corresponding selections according to the SNP molecular markers: If the SNP molecular marker is the first type, then in the core group of Macrobrachium rosenbergii, the seed shrimp individuals with the GT genotype at the 300th position from the 5' end on the SEQ ID No. 1 are selected, and the seed shrimp individuals with the GG or TT genotype at the position are eliminated; If the SNP molecular marker is the second type, then in the core group of Macrobrachium rosenbergii, the seed shrimp individuals with the AC genotype at the 300th position from the 5' end on SEQ ID No. 2 are selected, and the seed shrimp individuals with the AA genotype at the position are eliminated.

[0015] Due to the adoption of the above technical scheme, the embodiments of the present invention have at least the following beneficial effects: the SNP molecular marker of the present invention is closely related to the resistance of Macrobrachium rosenbergii to iridovirus disease, and therefore the SNP molecular marker of the present invention can be used to detect relevant indicators of Macrobrachium rosenbergii, or the genetic improvement of Macrobrachium rosenbergii can be carried out through this SNP molecular marker. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a statistical analysis chart based on the survival time characteristics of Macrobrachium rosenbergii infected with iridovirus in an embodiment of the present invention.

[0017] Figure 2 This is the Manhattan plot of the genome-wide association analysis in the embodiment of the present invention.

[0018] Figure 3 This is a box plot of the survival time of different mutant groups at the 69688355th site of chromosome 2 after infection with iridovirus in the example of the present invention; wherein **** indicates p<0.0001.

[0019] Figure 4 This is a box plot of the survival time of different mutant groups at the 16939259th site of chromosome 52 after infection with iridovirus in the example of the present invention; wherein **** indicates p<0.0001. DETAILED DESCRIPTION

[0020] The following is a clear and complete description of the concept of the present invention and the technical effects produced, so as to fully explain the purpose, scheme and effect of the present invention.

[0021] Example 1: Identification of SNP molecular markers associated with iridovirus disease resistance in Macrobrachium rosenbergii 1) A large-scale Macrobrachium rosenbergii challenge experiment with decapod iridovirus 1 was conducted. The experimental shrimp weighed 1.5±0.2 g and the survival time of each shrimp from virus injection to onset and death was recorded. At the end of the experiment, a total of 435 dead Macrobrachium rosenbergii samples were collected, with survival times ranging from 42 hours to 134 hours. Statistical analysis of survival time traits was performed, such as Figure 1 As shown, the results are approximately normally distributed, which is a typical quantitative trait and meets the basic requirements of association analysis.

[0022] 2) The sample DNA was extracted by magnetic bead method, and the concentration of DNA samples was detected by Qubit fluorescence quantification instrument; the integrity of DNA was detected by 1% agarose gel electrophoresis, and the samples that passed the quality control were used for library construction and quality control. The samples that passed the quality control were sent to Huazhi Biotechnology Co., Ltd. for sequencing using Macrobrachium rosenbergii liquid phase chip. The software GATK was used for genotyping, and beagle was used to fill in the missing genotypes. Plink was used to filter the typing files for quality control to obtain the final typing results.

[0023] 3) After quality control of the sequencing data and alignment to the reference genome, GATK was used to detect variants. The SNP data was filtered by VCFtools for site deletion rate and minimum allele frequency to obtain the final typing results. The disease resistance phenotype was in the survival time (quantitative trait) format. The rMVP software was used to combine the phenotype and genotype for genome-wide association analysis, and the threshold was set to -log 10 (0.05 / N)=6.265 (N is the number of SNP sites used for analysis), pThe loci with values ​​reaching the threshold are significantly associated. The SnpEff software is used to annotate genes for all loci exceeding the threshold. The ggplot2 package is used to create a Manhattan plot. Figure 2 shown.

[0024] The results showed that 15 SNP sites among all SNPs met the requirements. Through Blast analysis and comparison, according to physical information and linkage region gene annotation, two SNPs that may be associated with the resistance to iridovirus disease of Macrobrachium rosenbergii were preliminarily identified. They were located at the 300th site from the 5' end on SEQ ID No.1 and SEQ ID No.2, respectively. The 300th site from the 5' end on SEQ ID No.1 corresponds to the 69688355th site from the 5' end on chromosome 2 of the Macrobrachium rosenbergii genome, which is G (guanine) or T (thymine); the 300th site from the 5' end on SEQ ID No.2 corresponds to the 16939259th site from the 5' end on chromosome 52 of the Macrobrachium rosenbergii genome, which is A (adenine) or C (cytosine). Example 2: Verification of the effects of SNP chr2: 69688355 and SNP chr52: 16939259 on the resistance of Macrobrachium rosenbergii to iridovirus disease The two SNP molecular markers associated with the iridovirus disease resistance of Macrobrachium rosenbergii identified in this example are located at the 300th position from the 5' end on SEQ ID No. 1 and SEQ ID No. 2. SEQ ID NO. 1 corresponds to the 69688355th position on chromosome 2 of the Macrobrachium rosenbergii genome, and the reference genome of the position is the G genotype, and the mutant type is T. SEQ ID NO. 2 corresponds to the 16939259th position on chromosome 52 of the Macrobrachium rosenbergii genome, and the reference genome of the position is the A genotype, and the mutant type is C.

[0025] The genotype of the SNP molecular marker site located at SEQ ID NO.1 was correlated with the survival time of Macrobrachium rosenbergii after infection with iridovirus. The statistical results are as follows: Figure 3 The results showed that the survival time of Macrobrachium rosenbergii genotype GT was the longest, and there was a very significant difference between the survival time of Macrobrachium rosenbergii genotype GT and that of Macrobrachium rosenbergii genotype GG or TT; there was no difference in the survival time of Macrobrachium rosenbergii genotype GG or TT.

[0026] The genotype of the SNP molecular marker site located at SEQ ID NO.2 was correlated with the survival time of Macrobrachium rosenbergii after infection with iridovirus. The statistical results are as follows: Figure 4 The results showed that the AC genotype of Macrobrachium rosenbergii had the longest survival time, and there was a very significant difference in survival time between the AC genotype and the AA genotype.

[0027] In summary, the molecular markers provided by the present invention can efficiently and accurately identify the survival time of the identified Macrobrachium rosenbergii after being infected with iridovirus, and then judge the resistance of Macrobrachium rosenbergii to iridovirus disease. It has significant application value in the breeding of Macrobrachium rosenbergii and provides a reliable reference for the breeding of Macrobrachium rosenbergii.

[0028] The above is only a preferred embodiment of the present invention. The present invention is not limited to the above implementation. As long as the technical effect of the present invention is achieved by the same or equivalent means, it should belong to the protection scope of the present invention. Within the protection scope of the present invention, its technical scheme and / or implementation method can have various modifications and changes.

Claims

1. Use of a SNP molecular marker associated with iridovirus disease resistance of Macrobrachium rosenbergii in determining iridovirus disease resistance of Macrobrachium rosenbergii, characterized in that: The SNP molecular markers include at least one of the following SNP molecular markers: The first type, the nucleotide sequence containing the SNP molecular marker is shown in SEQ ID No. 1, the SNP molecular marker is located at the 300th position from the 5' end of SEQ ID No. 1, corresponds to the 69688355th position from the 5' end on chromosome 2 of the Macrobrachium rosenbergii genome, and is G or T; The second type, the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No.2, and the SNP molecular marker is located at the 300th position from the 5' end of SEQ ID No.2, corresponding to the 16939259th position from the 5' end on chromosome 52 of the Macrobrachium rosenbergii genome, and is A or C.

2. The use according to claim 1, characterized in that: When applied, if the SNP molecular marker is the first type, the iridovirus disease resistance trait of the Macrobrachium rosenbergii is ranked from strong to weak based on the genotype of the 300th site from the 5' end on the SEQ ID No.1: GT genotype, GG genotype or TT genotype.

3. The use according to claim 1, characterized in that: When applied, if the SNP molecular marker is the second type, the iridovirus disease resistance trait of the Macrobrachium rosenbergii is ranked from strong to weak based on the genotype of the 300th site from the 5' end on the SEQ ID No.2: AC genotype, AA genotype.

4. A method for determining the resistance of Macrobrachium rosenbergii to iridovirus disease, characterized in that: include: Determine the SNP molecular marker of the Macrobrachium rosenbergii, and determine the iridovirus disease resistance trait of the Macrobrachium rosenbergii based on the SNP molecular marker: If the SNP molecular marker is the first type, that is, the nucleotide sequence containing the SNP molecular marker is as shown in SEQ ID No.1, the SNP molecular marker is located at the 300th position from the 5' end on SEQ ID No.1, corresponding to the 69688355th position from the 5' end on chromosome 2 of the Macrobrachium rosenbergii genome, which is G or T; then the iridovirus disease resistance trait of the Macrobrachium rosenbergii is ranked from strong to weak based on the genotype of the 300th position from the 5' end on the SEQ ID No.1: GT genotype, GG genotype or TT genotype; If the SNP molecular marker is the second type, that is, the nucleotide sequence containing the SNP molecular marker is as shown in SEQ ID No.2, the SNP molecular marker is located at the 300th position from the 5' end on SEQ ID No.2, corresponding to the 16939259th position from the 5' end on chromosome 52 of the genome of Macrobrachium rosenbergii, which is A or C; then the iridovirus disease resistance trait of the Macrobrachium rosenbergii is ranked from strong to weak based on the genotype of the 300th position from the 5' end on the SEQ ID No.2: AC genotype, AA genotype.

5. Use of a SNP molecular marker associated with iridovirus disease resistance of Macrobrachium rosenbergii in breeding of iridovirus disease resistance of Macrobrachium rosenbergii, characterized in that: The SNP molecular markers include at least one of the following SNP molecular markers: The first type, the nucleotide sequence containing the SNP molecular marker is shown in SEQ ID No. 1, the SNP molecular marker is located at the 300th position from the 5' end of SEQ ID No. 1, corresponds to the 69688355th position from the 5' end on chromosome 2 of the Macrobrachium rosenbergii genome, and is G or T; The second type, the nucleotide sequence containing the SNP molecular marker is shown as SEQ ID No.2, and the SNP molecular marker is located at the 300th position from the 5' end of SEQ ID No.2, corresponding to the 16939259th position from the 5' end on chromosome 52 of the Macrobrachium rosenbergii genome, and is A or C.

6. The use according to claim 5, characterized in that: When used, if the SNP molecular marker is the first type, the shrimp individuals with the GT genotype at the 300th position from the 5' end on the SEQ ID No. 1 are selected, and the shrimp individuals with the GG or TT genotype at the position are eliminated.

7. The use according to claim 5, characterized in that: When used, if the SNP molecular marker is the second type, the shrimp individuals with AC genotype at the 300th position from the 5' end on SEQ ID No. 2 are selected, and the shrimp individuals with AA genotype at the position are eliminated.

8. A method for genetic improvement of Macrobrachium rosenbergii, characterized in that: include: Determine the SNP molecular markers of the seed shrimp in the core group of Macrobrachium rosenbergii, and make corresponding selections based on the SNP molecular markers: If the SNP molecular marker is the first type, that is, the nucleotide sequence containing the SNP molecular marker is as shown in SEQ ID No.1, the SNP molecular marker is located at the 300th position from the 5' end on SEQ ID No.1, corresponding to the 69688355th position from the 5' end on chromosome 2 of the Macrobrachium rosenbergii genome, which is G or T; then, in the Macrobrachium rosenbergii core group, the seed shrimp individuals with the GT genotype at the 300th position from the 5' end on SEQ ID No.1 are selected, and the seed shrimp individuals with the GG or TT genotype at this position are eliminated; If the SNP molecular marker is the second type, that is, the nucleotide sequence containing the SNP molecular marker is as shown in SEQ ID No.2, and the SNP molecular marker is located at the 300th position from the 5' end on SEQ ID No.2, corresponding to the 16939259th position from the 5' end on chromosome 52 of the Macrobrachium rosenbergii genome, which is A or C; then, in the Macrobrachium rosenbergii core group, the seed shrimp individuals with the AC genotype at the 300th position from the 5' end on SEQ ID No.2 are selected, and the seed shrimp individuals with the AA genotype at this position are eliminated.

Images