Mycobacterium detection kit for four-color fluorescence channel qPCR (quantitative polymerase chain reaction) instrument and marker of mycobacterium detection kit

Abstract

The invention relates to a mycobacterium detection kit for a four-color fluorescent channel qPCR (quantitative polymerase chain reaction) instrument and a marker of the mycobacterium detection kit. The kit comprises a component I, a component II and a component III, wherein the component I is a qPCR reagent for detecting a mycobacterium tuberculosis IS6110 gene; the kit comprises a component 1, a component 2, a qPCR reagent for detecting a mycobacterium tuberculosis IS1081 gene, a component 3, a qPCR reagent for simultaneously detecting mycobacterium avium and mycobacterium abscessus, and a component 4, a qPCR reagent for detecting a reference gene. Each component from the first component to the fourth component is detected by using a fluorescent channel; and the component III is a qPCR (quantitative polymerase chain reaction) reagent for detecting the chromosome sequence of the genome of the intracellular mycobacteria, namely LT703505.1: 3843400-3843599. According to the invention, the mycobacterium tuberculosis, the mycobacterium avium and the mycobacterium abscessus can be simultaneously detected in one-tube four-color fluorescent quantitative PCR (Polymerase Chain Reaction), and the accuracy and the specificity are very high.

Description

Technical Field

[0001] The present invention relates to the field of disease detection, and in particular to a mycobacterium detection kit and a marker thereof for a four-color fluorescent channel qPCR instrument. Background Art

[0002] Mycobacterium tuberculosis (MTB) and nontuberculous mycobacteria (NTM) are both bacteria belonging to the genus Mycobacterium, and both are positive for acid-fast staining. The clinical symptoms, pathological features, imaging and morphology of NTM disease are similar to those of tuberculosis, so it is easy to be misdiagnosed as tuberculosis based on clinical symptoms. NTM disease is usually an opportunistic infection. Compared with MTB, NTM has lower virulence and pathogenicity. In the past, NTM disease has always been considered a rare disease or even a rare disease. However, in recent years, with the aging of the population, the increase in the number of immunosuppressed people, the advancement of bacterial isolation and culture technology, and the development of molecular identification methods, the incidence of NTM disease has shown a significant increasing trend. Among them, the identification of NTM species is an important research direction at present, which is of great significance for understanding the distribution of NTM species in relevant areas and disease prevention and control. In addition, most NTM have natural resistance to anti-tuberculosis drugs, and the drugs available for treatment are limited. Therefore, effective differentiation of NTM and MTB complex groups and reasonable drug sensitivity tests are conducive to the correct diagnosis and effective treatment of NTM disease.

[0003] Through years of clinical epidemiological investigations, it was found that the NTM that cause clinical lung infections are mainly Mycobacterium intracellulare and Mycobacterium abscessus. In tuberculosis testing, it is necessary to distinguish between Mycobacterium tuberculosis, intracellulare and abscessus to facilitate the diagnosis and treatment of the disease. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a mycobacterium detection kit for a four-color fluorescent channel qPCR instrument, the kit comprising: component one, a qPCR reagent for detecting the IS6110 gene of Mycobacterium tuberculosis; component two, a qPCR reagent for detecting the IS1081 gene of Mycobacterium tuberculosis, component three, a qPCR reagent for simultaneously detecting Mycobacterium avium intracellulare and Mycobacterium abscessus, and component four, a qPCR reagent for detecting an internal reference gene; each of components one to four is detected using one fluorescent channel respectively; and component three is a qPCR reagent for detecting the chromosome sequence LT703505.1:3843400-3843599 of the genome of Mycobacterium intracellulare.

[0005] In one embodiment, the component three includes at least two forward primers and at least two reaction primers for simultaneous qPCR amplification.

[0006] In one embodiment, component three includes two forward primers and three reverse primers for qPCR amplification, wherein the two forward primers correspond to the chromosomal sequence positions of the genome of intracellular Mycobacterium as LT703505.1:3843430-3843445 and LT703505.1:3843430-3843445, respectively; the three reverse primers correspond to the chromosomal sequence positions of the genome of intracellular Mycobacterium as LT703505.1:3843582-3843598, LT703505.1:3843553-3843572, and LT703505.1:3843547-3843564.

[0007] In one embodiment, the two forward primers are: SEQ ID. No. 1: GGACGGTCCTCGCGGGC, SEQ ID. No. 2: GCGATGACCACCGCCT; the three reverse primers are: SEQ ID. No. 4: CGCGGATGTACCGCACC, SEQ ID. No. 5: GTGCGGTGGCGTGCCGACGG, SEQ ID. No. 6: GAGACCCGACGGACAGCT.

[0008] In one embodiment, the present invention provides a molecular marker for simultaneously detecting Mycobacterium avium-intracellulare and Mycobacterium abscessus, wherein the molecular marker is a chromosome sequence LT703505.1:3843400-3843599 located in the genome of Mycobacterium intracellulare.

[0009] In one embodiment, the molecular markers include the following five chromosomal positions: chromosomal sequence positions LT703505.1:3843430-3843445, LT703505.1:3843430-3843445, LT703505.1:3843582-3843598, LT703505.1:3843553-3843572, and LT703505.1:3843547-3843564 of the genome of Mycobacterium intracellulare.

[0010] In one embodiment, the present invention provides the use of the above molecular markers in the preparation of a product for simultaneously detecting Mycobacterium avium-intracellulare and Mycobacterium abscessus.

[0011] In one embodiment, a kit for simultaneously detecting Mycobacterium avium intracellulare and Mycobacterium abscessus is provided, wherein the kit is used to detect the chromosome sequence LT703505.1:3843400-3843599 of the genome of Mycobacterium intracellulare.

[0012] In one embodiment, the kit is used to detect the chromosomal sequence positions LT703505.1:3843430-3843445, LT703505.1:3843430-3843445, LT703505.1:3843582-3843598, LT703505.1:3843553-3843572, and LT703505.1:3843547-3843564 of the genome of Mycobacterium intracellulare.

[0013] In one embodiment, the kit is a qPCR kit, which includes two forward primers and three reverse primers, the two forward primers are: SEQ ID. No. 1: GGACGGTCCTCGCGGGC, SEQ ID. No. 2: GCGATGACCACCGCCT; the three reverse primers are: SEQ ID. No. 4: CGCGGATGTACCGCACC, SEQID. No. 5: GTGCGGTGGCGTGCCGACGG, SEQ ID. No. 6: GAGACCCGACGGACAGCT.

[0014] The present invention analyzes the whole genome sequence of intracellular mycobacterium and abscess molecular bacillus through biological information, and finds that the LT703505.1:3843400-3843599 fragment exists in both bacteria and contains multiple copies of the gene fragment. The primer probe designed with this gene fragment can simultaneously detect intracellular and abscess molecular bacillus, and does not produce obvious false positive reactions with TB and other non-tuberculosis mycobacteria, has good specificity, and is significantly better than another conservative sequence LT703505.1:3847900-3848099. Compared with another conservative sequence LT703505.1:3847900-3848099, the conservative sequence used in the present invention does not produce obvious false positive reactions with TB and other non-tuberculosis mycobacteria, and has a high detection accuracy.

[0015] In the present invention, when detecting this conserved sequence, since the fragment is relatively long, with a length of 200 bp, in order to increase the accuracy of detection, the present invention designs 3 upstream primers, 3 downstream primers, and 1 probe, which can detect intracellular mycobacterium and abscess mycobacterium, but not detect Mycobacterium tuberculosis. Among these 6 primer combinations, when the F1+F2+R1+R2+R3 combination designed by the LT703505.1:3843400-3843599 fragment is used, the qPCR system of the present invention can simultaneously detect intracellular mycobacterium and abscess mycobacterium with the highest accuracy and sensitivity.

[0016] The present invention uses a qPCR method to detect tuberculosis. Currently, the most commonly used qPCR instrument is a four-color fluorescence channel. In order to identify patients with suspected pulmonary tuberculosis infection symptoms and confirm whether they are TB infection or NTM infection, it is necessary to detect TB's IS6110 and IS1081 target genes, and a person's internal reference gene monitoring sampling, and use the remaining fluorescence channel to simultaneously detect intracellular mycobacterium and abscess mycobacterium, thereby achieving the simultaneous detection of Mycobacterium tuberculosis, avian intracellular mycobacterium, and abscess mycobacterium in one tube of four-color fluorescence quantitative PCR, with high accuracy and specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0018] Figure 1 It is a schematic diagram of three F primers and three R primers on fragment LT703505.1:3843400-3843599. DETAILED DESCRIPTION

[0019] In order to enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below in conjunction with the following embodiments. Obviously, the described embodiments are only part of the embodiments of this application, rather than all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of this application.

[0020] Several recently published complete genomes of Mycobacterium abscessus and Mycobacterium intracellulare were downloaded from the Ganbank database. The chromosome sequence of a strain genome of Mycobacterium intracellulare (LT703505.1, Mycobacterium intracellulare subsp. Chimaera, Chimaera is a subspecies of Mycobacterium intracellulare) was taken and shortened to 200 bp long shingled fragments in the form of a sliding window (100 bp each slide). These fragments were aligned with their own genome sequences and a genome of Mycobacterium abscessus (NZ_CP142117.1 Mycobacteroides abscessus strain MD4). Sequences with a match of at least 150 bp were taken, and the LT703505.1:3843400-3843599 fragment was found, of which there were 16 copies in the LT703505.1 sequence of the Mycobacterium intracellulare genome and 4 copies in the NZ_CP142117.1 sequence of the Mycobacterium abscessus genome. This fragment and its 100bp sequences on both sides were used to compare the additional genomes of other Mycobacterium abscessus and Mycobacterium intracellulare in the Genbank data, and homologous sequences were extracted for multiple comparisons to design primers and probes. The design goal is to detect Mycobacterium intracellulare and Mycobacterium abscessus at the same time with the highest accuracy. For this purpose, 3 upstream primers, 3 downstream primers, and 1 probe were designed, which can detect Mycobacterium intracellulare and Mycobacterium abscessus, but not Mycobacterium tuberculosis.

[0021] The LT703505.1:3843400-3843599 fragment was found. Although this fragment is a conserved sequence of abscesses and intracellular bacteria, there is still a lot of genetic polymorphism between strains. In order to improve the detection sensitivity, multiple pairs of primers were designed for PCR amplification, as shown in Table 1 below.

[0022] Table 1

[0023] The distribution of the three F primers and the three R primers on the fragment is as follows: Figure 1 As shown, any one of the F primers can form PCR amplification with any one of the R primers.

[0024] In addition, another conserved sequence of abscesses and intracellular bacteria, LT703505.1:3847900-3848099, was selected as a control fragment, and control primer probes were designed as shown in Table 2 below.

[0025] Table 2

[0026] By culture, 12 strains of Mycobacterium tuberculosis, 19 strains of Mycobacterium intracellulare, 28 strains of Mycobacterium abscessus, 24 strains of Mycobacterium kansasii, 15 strains of Mycobacterium gordonii, 5 strains of Mycobacterium chelonae, and 8 strains of Mycobacterium fortuitum were cultured from the sputum of patients suspected of tuberculosis infection; the colonies were identified by mass spectrometry. The nucleic acid of the colonies was extracted and diluted to a concentration of 10 ng / μl for the following qPCR reaction.

[0027] The qPCR reaction system of the above primer probes uses the qPCR premix reaction system produced by Novozymes, and the specific reaction system is as shown in Table 3 below:

[0028] Add water to 20 μl, and the reaction conditions are as shown in Table 4 below: Table 4

[0029] Fluorescence was collected at 65°C. When the Ct value was <38, the qPCR test was considered positive.

[0030] Tables 5 to 14 below show the results of various primer combinations for detecting intracellular mycobacterium, abscess mycobacterium, and other mycobacteria.

[0031] Table 5

[0032] .

[0033] Table 6 .

[0034] Table 7

[0035] Table 8

[0036] Table 9

[0037] Table 10

[0038] Table 11

[0039] Table 12

[0040] Table 13

[0041] Table 14

[0042] The following results were obtained based on the summary of the results in Tables 5-14. The results of detecting intracellular and abscess mycobacterium from cultured strains by using the designed F1+F2+R1+R2+R3 fragment of LT703505.1:3843400-3843599 are shown in Table 15.

[0043] Table 15

[0044] The results of detecting intracellular and abscess Mycobacterium abscessus from cultured strains using F1+F2+F3+R1+R2 designed using the LT703505.1:3843400-3843599 fragment are shown in Table 16.

[0045] Table 16

[0046] The results of detecting intracellular and abscess Mycobacterium abscessus from cultured strains using F1+F2+F3+R1+R2+R3 designed using the LT703505.1:3843400-3843599 fragment are shown in Table 17.

[0047] Table 17

[0048] The results of detecting intracellular and abscess Mycobacterium abscessus from cultured strains using F2+F3+R2+R3 designed using the LT703505.1:3843400-3843599 fragment are shown in Table 18.

[0049] Table 18

[0050] The results of detecting intracellular and abscess Mycobacterium abscessus from cultured strains using cF1+cF2+cF3+cR1+cR2+cR3 designed using LT703505.1:3847900-3848099 as a control fragment are shown in Table 19.

[0051] Table 19

[0052] The results of detecting intracellular and abscess Mycobacterium abscessus from cultured strains using cF1+cF2+cR1+cR2+cR3 designed using LT703505.1:3847900-3848099 as a control fragment are shown in Table 20.

[0053] Table 20

[0054] The results of detecting intracellular and abscess Mycobacterium abscessus from cultured strains using cF1+cF2+cF3+cR1+cR2 designed using LT703505.1:3847900-3848099 as a control fragment are shown in Table 21.

[0055] Table 21

[0056] Therefore, it can be found that when the F1+F2+R1+R2+R3 combination is designed by the LT703505.1:3843400-3843599 fragment, the qPCR system can simultaneously detect intracellular mycobacterium and abscessus mycobacterium with the highest accuracy.

[0057] It should be understood that the disclosed invention is not limited only to the specific method, scheme and material of description, because these all can change.It should also be understood that the terminology used herein is only for the purpose of describing specific embodiment scheme, rather than being intended to limit the scope of the present invention, and the scope of the present invention is only limited to the appended claims.

[0058] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are also intended to be encompassed by the appended claims.

Claims

1. A mycobacterium detection kit for a four-color fluorescence channel qPCR instrument, characterized in that: The kit comprises: component one, a qPCR reagent for detecting the IS6110 gene of Mycobacterium tuberculosis; component two, a qPCR reagent for detecting the IS1081 gene of Mycobacterium tuberculosis; component three, a qPCR reagent for simultaneously detecting Mycobacterium avium intracellulare and Mycobacterium abscessus; component four, a qPCR reagent for detecting an internal reference gene; each of components one to four is detected using a fluorescent channel respectively; component three is a qPCR reagent for detecting the chromosome sequence LT703505.1:3843400-3843599 of the genome of Mycobacterium intracellulare.

2. The kit according to claim 1, characterized in that The third component includes at least two forward primers and at least two reaction primers used for qPCR amplification simultaneously.

3. The kit according to claim 1, characterized in that The component three includes two forward primers and three reverse primers for qPCR amplification, wherein the two forward primers correspond to the chromosome sequence positions of the genome of intracellular mycobacterium LT703505.1:3843430-3843445 and LT703505.1:3843430-3843445 respectively; the three reverse primers correspond to the chromosome sequence positions of the genome of intracellular mycobacterium LT703505.1:3843582-3843598, LT703505.1:3843553-3843572, and LT703505.1:3843547-3843564.

4. The kit according to claim 3, characterized in that The two forward primers are: SEQ ID. No. 1: GGACGGTCCTCGCGGGC, SEQ ID. No. 2: GCGATGACCACCGCCT; the three reverse primers are: SEQ ID. No. 4: CGCGGATGTACCGCACC, SEQ ID. No. 5: GTGCGGTGGCGTGCCGACGG, SEQ ID. No. 6: GAGACCCGACGGACAGCT.

5. A molecular marker for simultaneous detection of Mycobacterium avium-intracellulare and Mycobacterium abscessus, characterized in that: The molecular marker is the chromosome sequence LT703505.1:3843400-3843599 located in the genome of Mycobacterium intracellulare.

6. The molecular marker according to claim 5, characterized in that The molecular markers include the following five chromosomal positions: chromosomal sequence positions LT703505.1:3843430-3843445, LT703505.1:3843430-3843445, LT703505.1:3843582-3843598, LT703505.1:3843553-3843572, and LT703505.1:3843547-3843564 of the genome of Mycobacterium intracellulare.

7. Use of the molecular marker according to claim 6 in the preparation of a product for simultaneously detecting Mycobacterium avium-intracellulare and Mycobacterium abscessus.

8. A kit for simultaneously detecting Mycobacterium avium-intracellulare and Mycobacterium abscessus, characterized in that: The kit is used to detect the chromosome sequence LT703505.1:3843400-3843599 of the genome of intracellular mycobacterium.

9. The kit according to claim 8, characterized in that The kit is used to detect the chromosome sequence positions LT703505.1:3843430-3843445, LT703505.1:3843430-3843445, LT703505.1:3843582-3843598, LT703505.1:3843553-3843572, and LT703505.1:3843547-3843564 of the genome of intracellular mycobacterium.

10. The kit according to claim 9, characterized in that The kit is a qPCR kit, which includes two forward primers and three reverse primers, the two forward primers are: SEQ ID. No. 1: GGACGGTCCTCGCGGGC, SEQ ID. No. 2: GCGATGACCACCGCCT; the three reverse primers are: SEQ ID. No. 4: CGCGGATGTACCGCACC, SEQ ID. No. 5: GTGCGGTGGCGTGCCGACGG, SEQ ID. No. 6: GAGACCCGACGGACAGCT.

Images