Molecular markers associated with resistance to potato virus x and uses thereof

By developing PCR and KASP molecular markers associated with PVX resistance, the problem of insufficient accuracy in potato PVX virus resistance detection in existing technologies has been solved, enabling efficient and accurate PVX virus resistance breeding and improving breeding efficiency and safety.

CN119710070BActive Publication Date: 2025-11-21HUAZHONG AGRI UNIV +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510018057.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-06
Publication Date
2025-11-21
Estimated Expiration
2045-01-06

AI Technical Summary

Technical Problem

In existing technologies, molecular markers for detecting potato PVX virus resistance are not accurate enough, making it difficult to accurately distinguish between Rx1 and Rx2 genes, resulting in inaccurate PVX resistance detection results. Furthermore, traditional methods have limitations in terms of the safety of genetically modified organisms.

Method used

PCR and KASP molecular markers based on PVX resistance-associated mutation sites were developed, including SNP-1 and InDel-1 of the Rx1 gene and SNP-2 and InDel-2 of the Rx2 gene. Corresponding primer sets were designed for PCR and KASP detection, which can accurately identify the presence and type of Rx1 and Rx2 genes in the potato genome.

Benefits of technology

It significantly improved the accuracy of PVX virus resistance detection, with PCR marker detection accuracy reaching 98.3% and 100.0%, and KASP marker detection accuracy reaching 100.0%. It can efficiently distinguish between homozygous and heterozygous resistance genotypes, simplify the operation process, and improve breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119710070B_ABST
    Figure CN119710070B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of potato breeding, and particularly relates to a molecular marker related to potato PVX virus resistance and application thereof. In the embodiments, specific mutation sites closely related to disease resistance and disease susceptibility are screened in PVX resistance genes Rx1 and Rx2, and PCR molecular markers and KASP molecular markers are developed based on the mutation sites. The markers can be used for detecting the genotype of potato at the specific sites, thereby identifying the resistance of the potato to the PVX virus, and providing an effective auxiliary tool for potato PVX disease resistance breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of potato breeding, and particularly relates to a molecular marker associated with potato PVX virus resistance and application thereof. BACKGROUND

[0002] Potato (Solanum tuberosum L.) is the fourth largest food crop in the world, and is of great significance to global food security and economic stability (Islam et al., 2022; Rahman et al., 2022). However, potato production is affected by many diseases including various viral diseases, resulting in significant reduction in yield and quality. Among them, potato virus X (PVX) is a single-stranded positive-sense RNA virus widely distributed globally, belonging to the genus Potexvirus of the family Alphaflexiviridae. Its single infection and complex infection with other viruses have a significant negative impact on potato yield (Liu et al., 2021; He et al., 2022).

[0003] Currently, the main method for preventing and controlling major viruses including PVX in potato production is to use virus-free seed potatoes. However, in temperate and tropical regions where viral diseases are prevalent, the re-infection of field potatoes limits the effectiveness of this method. In addition, although genetic engineering methods such as CRISPR / Cas9-mediated resistance, RNA silencing-related resistance, and virus-induced genome editing can enhance resistance, they are subject to limitations on genetically modified organisms (Jiang et al., 2022; Tiwari et al., 2022; Lee et al., 2024). Therefore, exploring and utilizing the resistance genes of potatoes themselves is a most economical, efficient and environmentally friendly strategy.

[0004] Two cloned PVX virus extreme resistance genes, Rx1 and Rx2, are located on chromosome XII of cultivated potato Solanum tuberosum subsp. andigena and chromosome V of wild potato Solanum acule, respectively. Both genes encode immune proteins with CC-NB-LRR (coiled-coil nucleotide-binding leucine-rich repeat) structure, which can recognize PVX coat protein and thus trigger extreme resistance (Liu et al., 2021; Tameling and Baulcombe, 2007). Although Rx1 and Rx2 genes originate from different sources and are located on different chromosomes, they show high sequence similarity at the nucleotide and amino acid levels. In addition, there are multiple R gene analogs in the potato genome that are highly similar to Rx1 and Rx2. These cases pose challenges to determining the presence of functional resistance genes and distinguishing the sources of the two resistance genes in marker-assisted selection processes (Ahmadvand et al., 2013).

[0005] A large number of molecular markers related to Rx1 and Rx2 genes have been reported, such as markers Rx-1230, 1Rx1, 5Rx1 for detecting Rx1 gene and 10Rx2 and 106Rx2 for detecting Rx2 gene (Ahmadvand et al., 2013; Shaikhaldein et al., 2018). However, these markers show limitations in resistance identification and screening, especially in determining the presence or absence of resistance genes, leading to possible inaccurate PVX resistance detection results (Nie et al., 2018; Caruana et al., 2019). At the same time, mutations in Rx1 and Rx2 genes can increase the risk of loss of their antiviral function (Hinge et al 2021). Therefore, it is of great significance to study the relationship between the resistance function of Rx1 and Rx2 genes and gene variation, and to develop more accurate and efficient molecular markers for accurate detection of PVX resistance in potatoes and to promote the breeding of virus-resistant varieties. SUMMARY

[0006] The embodiments of the present application provide molecular markers associated with potato PVX virus resistance and applications. Based on the mutation sites associated with PVX resistance, the embodiments develop PCR molecular markers and KASP molecular markers, which can more accurately detect Rx1 and Rx2 genes in various potato genotypes and large-scale breeding populations, thereby determining their resistance to PVX. Ultimately, these new tools will significantly improve the efficiency of potato PVX resistance breeding.

[0007] To this end, the embodiments of the present application disclose at least the following technical solutions:

[0008] In a first aspect, the embodiments disclose a molecular marker associated with PVX virus resistance of potato Rx1 gene, including a single nucleotide polymorphism site (SNP-1) formed by a G mutation to C at 14,363 bp of the Rx1 gene (AJ011801.1), and a three-base (TCC) deletion mutation site (InDel-1) occurring at 14,025 bp.

[0009] In a second aspect, the embodiments disclose a molecular marker associated with PVX virus resistance of potato Rx2 gene, including a single nucleotide polymorphism site (SNP-2) formed by a C mutation to G at 2,482 bp of the Rx2 gene (AJ249448.1), and a three-base insertion mutation site (InDel-2) occurring at 2,215 bp.

[0010] In a third aspect, the embodiments disclose a primer set for detecting the PVX resistance gene Rx1, including a PCR marker detection primer set, such as the DNA molecules shown in SEQ ID NO: 1 and 2; and a KASP marker detection primer set, such as the DNA molecules shown in SEQ ID NO: 3, 4 and 5.

[0011] In a fourth aspect, the embodiments disclose a primer set for detecting the PVX resistance gene Rx2, including a PCR marker detection primer set, such as the DNA molecules shown in SEQ ID NO: 6 and 7; and a KASP marker detection primer set, such as the DNA molecules shown in SEQ ID NO: 8, 9 and 10.

[0012] In a fifth aspect, the embodiments disclose a PCR detection method for the PVX virus resistance genes Rx1 and Rx2 of potato. The method comprises: extracting genomic DNA of potato; performing PCR amplification on the genomic DNA by using the PCR marker detection primer set of the third aspect or the fourth aspect; performing electrophoresis detection on the PCR amplification product; and determining, according to the electrophoresis detection result, whether the potato contains the resistance gene and whether the resistance gene contained is Rx1 or Rx2.

[0013] In a sixth aspect, the embodiments disclose a KASP detection method for the PVX virus resistance genes Rx1 and Rx2 of potato. The method comprises: extracting genomic DNA of potato; performing competitive allele-specific PCR amplification on the genomic DNA by using the KASP marker detection primer set of the third aspect or the fourth aspect; performing fluorescence detection on the competitive allele-specific PCR amplification product; and determining, according to the fluorescence signal of the amplification product, whether the potato contains the PVX virus resistance gene.

[0014] In a seventh aspect, the embodiments disclose use of the molecular marker of the first aspect or the second aspect, or the primer set of the third aspect or the fourth aspect, in the preparation of a kit for detecting potato PVX virus resistance genes Rx1 and Rx2 and / or in marker-assisted breeding of potato PVX virus resistance markers.

[0015] Compared with the prior art, the present application has at least the following technical effects:

[0016] (1) The accuracy of molecular marker detection is significantly improved. The present application uses newly developed PVX virus resistance PCR markers and KASP markers to detect 58 potato materials known for PVX resistance. The results show that the newly developed Rx1 gene PCR markers (Rx1-1PCRF / Rx1-PCRR) and KASP markers (Rx1-KASPF1 / Rx1-KASPR1 / Rx1-KASPR2) are completely consistent in the detection results of the above-mentioned materials, and the accuracy of these marker detection results and the resistance phenotype results is 98.3%. However, the accuracy of the detection of the above-mentioned materials by the three reported Rx1 gene molecular markers Rx-1230, 1Rx1 and 5Rx1 is 70.7%, 74.1% and 75.9%, respectively. Meanwhile, the newly developed Rx2 gene PCR markers (Rx2-PCRF / Rx2-PCRR) and KASP markers (Rx2-KASPF2 / Rx2-KASPR3 / Rx2-KASPR4) are also completely consistent in the detection results of the above-mentioned materials, and the accuracy of these marker detection results and the resistance phenotype results is 100.0%. However, the accuracy of the detection of the above-mentioned materials by the two reported Rx2 gene molecular markers 10Rx2 and 106Rx2 is 72.4% and 75.9%, respectively. In addition, in the examination of PVX resistance genes Rx1 and Rx2 in hybrid populations (F1), it is found that the detection results of the newly developed Rx1 and Rx2 gene molecular markers are completely consistent with the resistance identification results of the F1 offspring, and the accuracy is 100%, indicating that the markers can be used for assisted selection in potato PVX resistance breeding.

[0017] (2) The newly developed high-throughput molecular markers provide breeders with a set of efficient and reliable tools, which can accelerate the selection of potato PVX resistance genotypes. Their high consistency, consistency of different genotyping platforms, and high correlation with phenotypic resistance identification make them valuable assets for potato PVX virus resistance variety breeding programs.

[0018] (3) The KASP molecular markers provided by the present application can effectively distinguish homozygous resistance genotypes and heterozygous resistance genotypes, as well as homozygous susceptible genotypes. Compared with traditional molecular markers, the detection results can be obtained without electrophoresis, and the operation convenience is significantly improved in the process of high-throughput molecular marker-assisted selection of potato PVX virus resistance. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Structure diagram of Rx1 and Rx2 genes and the proteins they encode. DNA coding sequences are represented by straight lines (black), while intron sequences are represented by dotted lines; protein sequences and functional domains are represented by rectangles of different colors; the numerical values marked on the sequences represent the position information of the DNA sequences or protein sequences; the PVX-Rx1230 marker region is the target region for molecular marker screening in this application.

[0020] Figure 2 Electrophoresis diagram of part of the potato materials detected using Rx1 and Rx2 gene PCR molecular markers for the examples. "M" represents Marker; A, the detection result of the Rx1 gene molecular marker; B, the detection result of the Rx2 gene molecular marker; S and R represent the susceptibility and resistance to PVX virus, respectively; 1-20 are potato commercial varieties Huashu No. 1, Huashu No. 2, Huashu No. 3, Huashu No. 4, Huayu No. 5, Huayu No. 6, Huashu No. 7, Huashu No. 8, Huashu No. 9, Huashu No. 10, Huashu No. 11, Huashu No. 12, Huashu No. 13, Huashu No. 41, Huashu No. 15, Huashu No. 16, Huacai No. 1, Huacai No. 3, Huanen No. 1, Huanen No. 2; 21, positive control resistant variety Atlantic containing Rx1 gene; 22, positive control resistant material MPI.163.613.63 containing Rx2 gene; 23-24, negative control susceptible varieties Kexin No. 1 and Zhongshu No. 3 not containing Rx1 and Rx2 genes. Material 22 (MPI.163.613.63) needs to be obtained from the National Potato Germplasm Bank, and the rest are commercial varieties.

[0021] Figure 3 KASP marker primer set diagram for Rx1 and Rx2 genes, respectively (including one common forward primer and two allele-specific reverse primers) provided for the examples. The target SNP is highlighted in red, and the position of the SNP in the coding sequence (CDS) is indicated by a number. FAM and HEX represent the fluorescent groups carried by the two allele primers, corresponding to the favorable allele and the unfavorable allele, respectively.

[0022] Figure 4 Fluorescence detection results of KASP markers provided for the examples. Figure 4 A is the Rx1 gene KASP marker detection result of 58 potato materials. Figure 4 B is the Rx1 gene KASP marker detection result of the hybrid F1 population of the resistant male parent Huashu No. 1 (Rrrr) containing the Rx1 gene and the susceptible female parent Huacai No. 1 (rrrr) not containing the resistance gene. Figure 4C is the detection result of KASP marker of Rx2 gene of 7 potato materials. Figure 4 D is the detection result of KASP marker of Rx2 gene of hybrid F1 population of resistant female parent Huashu 16 (Rrrr) containing Rx2 gene and susceptible male parent Huacai 3 (rrrr) not containing resistance gene. NTC represents negative control, green small triangle represents homozygous susceptible genotype (unfavorable allele) not containing resistance gene, and red small triangle represents heterozygous resistant genotype (two fluorescence are detected at the same time, containing favorable allele and unfavorable allele) containing resistance gene.

[0023] Figure 5 The screenshots of the effects of PVX resistance molecular marker detection of 58 potato materials provided for the examples.

[0024] In the figure, each potato variety is inoculated with PVX-HB isolate by grafting, and ELISA detection is carried out after 3 weeks to identify PVX resistance, R is resistant (ELISA reading is less than 0.1), and S is susceptible (ELISA reading is greater than 0.5); each variety is detected by the published Rx1 and Rx2 gene related molecular marker after extracting genomic DNA, "+" indicates that there is a band; "-" indicates that there is no band, the highlighted green indicates that the detection result is accurate, that is, the molecular marker is consistent with the resistance identification result; red indicates that the detection result is false positive, that is, the molecular marker detection result is positive, and the resistance identification result is susceptible; blue indicates that the detection result is false negative, that is, the molecular marker detection result is negative, and the resistance identification result is resistant. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical scheme and advantages of the present application more clear, the present application will be further described in detail below in combination with specific examples. It should be emphasized that the examples described here are only used to explain the technical content of the present application, and do not limit the scope of the present application. The reagents not specifically described in the present application are conventional reagents, which can be obtained through commercial channels; the methods not specifically described are conventional experimental methods, which can be known from prior art.

[0026] Screening of molecular markers

[0027] 1. PVX resistance identification of potato materials

[0028] Twenty potato materials from HZAU were rubbed and grafted inoculated with PVX, and then tested for virus by ELISA three weeks after inoculation. Only the materials that were not detected for virus by both rubbing and graft inoculation were determined as PVX extreme resistant materials. In addition, the potato variety Atlantic containing Rx1 gene was used as positive control for Rx1, and MPI.163.613.63 containing Rx2 gene was used as positive control for Rx2, while Kenox 1 and Zhuxi 3 were used as negative controls for not containing Rx1 and Rx2 resistance genes. Thus, 9 PVX virus extreme resistant materials were obtained, which were Huashu 1, Huashu 2, Huashu 4, Huashu 12, Huashu 13, Huashu 14, Huashu 15, Huashu 16, and Huan 2, respectively. 11 susceptible materials were Huashu 3, Huayu 5, Huayu 6, Huashu 7, Huashu 8, Huashu 9, Huashu 10, Huashu 11, Huacai 1, Huacai 3, and Huan 1, respectively.

[0029] 2. Sequencing of CDS region of resistance genes

[0030] According to the above resistance identification results, 7 extreme resistant varieties (Huashu 1, Huashu 2, Huashu 4, Huashu 13, Huashu 15, Huashu 16, and Huan 2) and 5 susceptible varieties (Huashu 3, Huayu 6, Huashu 9, Huacai 1, and Huan 1) were randomly selected, and the genomic DNA was extracted by CTAB method. The partial CDS region of PVX resistance genes Rx1 and Rx2 was amplified by primer PVX-Rx1230 (Mori et al., 2011), and TA cloning and sequencing were performed. Figure 1 In addition, the positive control variety Atlantic containing Rx1 gene, the positive control MPI163.613.63 containing Rx2, and the negative control Kenox 1 not containing Rx1 and Rx2 resistance genes were also subjected to CDS region amplification and TA cloning and sequencing using the same primer.

[0031] 3. Analysis of sequencing data to identify SNP or Indel variations between resistant and susceptible materials

[0032] The data obtained by the above sequencing were aligned with the Rx1 reference gene (AJ011801.1) and the Rx2 reference gene (AJ249448.1) using MEGAXI software (version 0.13), and combined with the results of PVX resistance identification of the sequencing materials, the SNP variation sites related to the disease resistance and susceptibility phenotype were explored using SNiplay (https: / / sniplay.southgreen.fr / cgi-bin / home.cgi).

[0033] Through sequence analysis, two variation sites highly related to PVX resistance mediated by Rx1 gene, SNP-1 and InDel-1, and two variation sites highly related to PVX resistance mediated by Rx2 gene, SNP-2 and InDel-2, were discovered, which can be used to detect and distinguish the two PVX virus resistance genes.

[0034] SNP-1 is a single nucleotide polymorphism site (SNP) formed by mutation of G to C at 14,363 bp of the Rx1 reference gene (AJ011801.1).

[0035] InDel-1 is a three-base (TCC) deletion mutation site (InDel) occurring at 14,025 bp of the Rx1 reference gene (AJ011801.1).

[0036] SNP-2 is a single nucleotide polymorphism site (SNP) formed by mutation of C to G at 2,482 bp of the Rx2 reference gene (AJ249448.1).

[0037] InDel-2 is a three-base (TCC) insertion mutation site (InDel) occurring at 2,215 bp of the Rx2 reference gene (AJ249448.1). Application of Rx1 and Rx2 gene PCR molecular markers

[0038] Based on the resistance-related variation sites discovered in the examples, the application designs PCR primer sets, detection methods and applications for detecting resistance genes Rx1 and Rx2, respectively.

[0039] The example discloses an Rx1 gene PCR detection primer set, which comprises DNA molecules as shown in SEQ ID NO: 1 and 2. The primer set can specifically detect whether the Rx1 gene exists by using the two resistance-related variation sites SNP-1 and InDel-1.

[0040] The example discloses an Rx2 gene PCR detection primer set, which comprises DNA molecules as shown in SEQ ID NO: 6 and 7. The primer set can specifically detect whether the Rx2 gene exists by using the two resistance-related variation sites SNP-2 and InDel-2.

[0041] In addition, the example also discloses a method for PCR detection of potato PVX resistance genes. The method comprises: extracting the genomic DNA of potato; performing PCR amplification on the genomic DNA by using the primer set; performing electrophoresis detection on the PCR amplification product; and judging whether the potato contains resistance genes and the type of resistance genes according to the electrophoresis detection result.

[0042] In some embodiments, the DNA molecules as set forth in SEQ ID NOs: 1 and 2 are used as primer sets for PCR amplification of genomic DNA of potato to determine whether the Rx1 gene is present.

[0043] Upstream primer (Rx1-PCRF): CACCTTCAGGTTCTACGC (SEQ ID NO: 1)

[0044] Downstream primer (Rx1-PCRR): ACGGCAATCTCTAAGAATAACT (SEQ ID NO: 2)

[0045] In some embodiments, the DNA molecules as set forth in SEQ ID NOs: 6 and 7 are used as primer sets for PCR amplification of genomic DNA of potato to determine whether the Rx2 gene is present.

[0046] Upstream primer (Rx2-PCRF): ACCTTCAGGTTCTACTCCGC (SEQ ID NO: 6)

[0047] Downstream primer (Rx2-PCRR): CATCATCCAGAAACAAGAAGT (SEQ ID NO: 7)

[0048] Specifically, some embodiments provide a method for PCR detection of PVX resistance genes in potato, which comprises:

[0049] 1) Varieties and populations to be detected

[0050] The newly developed PCR markers were used to screen PVX resistance in 58 commercial varieties and two hybrid populations collected in the laboratory. In the two populations, one was a hybrid F1 population of the resistant male parent Huashu No. 1 (Rrrr) containing the Rx1 gene and the susceptible female parent Huacai No. 1 (rrrr) not containing the resistance gene; the other was a hybrid F1 population of the resistant female parent Huashu No. 16 (Rrrr) containing the Rx2 gene and the susceptible male parent Huacai No. 3 (rrrr) not containing the resistance gene.

[0051] 2) Extraction of genomic DNA

[0052] The CTAB method was used to extract genomic DNA from the progeny materials of potato varieties and populations.

[0053] 3) PCR and product electrophoresis detection

[0054] PCR amplification of genomic DNA was performed using primer set Rx1-PCRF (SEQ ID NO: 1) and Rx1-PCRR (SEQ ID NO: 2). Alternatively, PCR amplification of genomic DNA was performed using primer set Rx2-PCRF (SEQ ID NO: 6) and Rx2-PCRR (SEQ ID NO: 7). The PCR amplification products of these genomic DNAs were detected by 1% agarose gel electrophoresis, respectively.

[0055] PCR amplification reaction system (10 μΐ): 50 ng / μΐ of DNA template 1.0 μΐ, 10 μΜ of upper and lower primers 0.5 μΐ each, 2x Ftaq PCR mix (Zomanbio, Beijing, China) 5.0 μΐ, ddH2O 3.0 μΐ. PCR reaction program: 94°C for 5 minutes; 35 cycles of 94°C for 30 seconds, annealing temperature 63°C (Rx1) or 61°C (Rx2) for 30 seconds, 72°C for 30 seconds; finally extend at 72°C for 10 minutes.

[0056] 4) Detection results

[0057] In the Rx1 gene PCR molecular marker detection, if 374 bp band is detected by electrophoresis, the Rx1 resistance gene molecular marker detection of the material to be tested is judged to be positive, otherwise it is negative. In the Rx2 gene PCR molecular marker detection, if 302 bp band is detected by electrophoresis, the Rx2 resistance gene molecular marker detection of the material to be tested is judged to be positive, otherwise it is negative.

[0058] The material Rx1 and Rx2 gene molecular marker detection results are compared with the PVX resistance identification results. If one of the molecular markers is positive and the material resistance identification is also resistant to PVX virus, the detection result is consistent with the actual resistance, and the marker detection result is accurate; if one of the molecular markers is positive and the material resistance identification is susceptible to PVX virus, the detection result is not consistent with the actual resistance, and the marker detection result is false positive; if both of the molecular markers are negative and the material resistance identification is resistant to PVX virus, the detection result is not consistent with the actual resistance, and the marker detection result is false negative. Figure 2

[0059] ​In the embodiment of detecting 58 known resistant varieties Rx1 and Rx2 by PCR molecular markers, the accuracy of primers Rx1-PCRF and Rx1-PCRR for detecting Rx1 gene is 98.3%, and only 1.7% of the samples appear false positive, while the accuracy of primers Rx2-PCRF and Rx2-PCRR for detecting Rx2 gene is 100.0%, both of which are significantly higher than the detection accuracy of other molecular markers in the prior art. The reported molecular markers PVX-Rx1230, 1Rx1 and 5Rx1 of Rx1 gene, the accuracy of the detection results of 58 potato varieties is 70.7%, 74.1% and 75.9% respectively, the false positive rate is 25.9%, 22.4% and 19.0% respectively, and the false negative rate is 3.4%, 3.4% and 5.2% respectively; the reported molecular markers 10Rx2 and 106Rx2 of Rx2 gene, the accuracy of the detection results of 58 potato varieties is 72.4% and 75.9% respectively, the false positive rate is 19.0% and 6.9% respectively, and the false negative rate is 8.6% and 17.2% respectively. Figure 5 ) In addition, two F1 populations were detected by using Rx1 and Rx2 gene PCR detection primers, and the marker detection results were completely consistent with the resistance identification results, indicating that the newly developed PCR molecular marker can accurately identify PVX resistance.

[0060] Application of Rx1 and Rx2 gene KASP molecular markers

[0061] Based on the resistance-related variation sites found in the embodiment, KASP primer sets for detecting resistance genes Rx1 and Rx2 are also designed respectively. Figure 3 ), detection methods and applications.

[0062] The embodiment discloses an Rx1 gene KASP detection primer set, which comprises DNA molecules as shown in SEQ ID NO: 3, 4 and 5. The primer set can detect the genotype of the resistance-related variation site SNP-1 of the Rx1 gene.

[0063] The embodiment discloses an Rx2 gene KASP detection primer set, which comprises DNA molecules as shown in SEQ ID NO: 8, 9 and 10. The primer set can detect the genotype of the resistance-related variation site SNP-2 of the Rx2 gene.

[0064] In addition, the embodiment also discloses a KASP method for detecting potato PVX resistance genes. The method comprises: extracting the genomic DNA of potato; performing PCR amplification on the genomic DNA by using the primer set; performing fluorescence detection on the competitive allele-specific PCR amplification product; and determining whether the potato contains PVX virus resistance gene according to the fluorescence signal of the competitive allele-specific PCR amplification product.

[0065] In some embodiments, KASP detection is performed on potato genomic DNA using DNA molecules as set forth in SEQ ID NOs: 3, 4, and 5 as primer sets to determine the genotype of the Rx1 gene resistance associated locus.

[0066] Universal forward primer (Rx1 -KASPF1 ): AGTAGTGATCACTTTCCGTACCTTGAACGA (SEQ ID NO: 3)

[0067] Allele-specific reverse primer 1 (Rx1 -KASPR1 ): FAM-CAAATTACGGCAATCTCTAAGAATAAC (SEQ ID NO: 4)

[0068] Allele-specific reverse primer 2 (Rx1 -KASPR2): HEX-CCAAATTACGGCAATCTCTAAGAATAAG (SEQ ID NO: 5)

[0069] In some embodiments, KASP detection is performed on potato genomic DNA using DNA molecules as set forth in SEQ ID NOs: 8, 9, and 10 as primer sets to determine the genotype of the Rx2 gene resistance associated locus.

[0070] Universal forward primer (Rx2-KASPF2): GTTGAGGAAGGGTTTCCTCACTTGAA (SEQ ID NO: 8)

[0071] Allele-specific reverse primer 1 (Rx2-KASPR3): FAM-GAATGTATACATCATCCAGAAACAAGAAG (SEQ ID NO: 9)

[0072] Allele-specific reverse primer 2 (Rx2-KASPR4): HEX-GAATGTATACATCATCCAGAAACAAGAAC (SEQ ID NO: 10)

[0073] In particular, some embodiments provide a method of KASP detection of potato PVX resistance genes comprising:

[0074] 1) Varieties and populations to be tested

[0075] Two hybrid populations of 58 commercial varieties and groups collected in the laboratory were screened for PVX resistance using newly developed PCR markers. In both populations, one was the hybrid F1 population of the resistant male parent Shu-shu No. 1 (Rrrr) containing Rx1 gene and the susceptible female parent Shu-cai No. 1 (rrrr) not containing resistance genes. The other was the hybrid F1 population of the resistant female parent Shu-shu No. 16 (Rrrr) containing Rx2 gene and the susceptible male parent Shu-cai No. 3 (rrrr) not containing resistance genes.

[0076] 2) Extraction of genomic DNA

[0077] Genomic DNA was extracted from the potato varieties and population progeny materials by CTAB method.

[0078] 3) Competitive allele-specific PCR and fluorescence detection of products

[0079] Genomic DNA was subjected to competitive allele-specific PCR amplification using primer set Rx1-KASPF1, Rx1-KASPR1, and Rx1-KASPR2. Alternatively, genomic DNA was subjected to competitive allele-specific PCR amplification using primer set Rx2-KASPF2, Rx2-KASPR3, and Rx2-KASPR4. The competitive allele-specific PCR amplification products of these genomic DNAs were subjected to fluorescence detection, respectively.

[0080] The KASP reaction system (10 μL) was composed of 2.5 μL of 20 ng / μL genomic DNA template, 0.15 μL of KASP primer mixture (containing 30 μM of KASP universal forward primer and 12 μM of two allele-specific reverse primers), 5 μL of 2×KASP Master mix (LGC Biosearch Technologies), and 2.35 μL of ddH2O.

[0081] The KASP reaction program included I: KASP thermal cycling: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s; 61-55℃ annealing and extension for 60 s, 10 cycles (each cycle decreased by 0.6℃); 94℃ denaturation for 20 s; 55℃ annealing and extension for 60 s, 26 cycles; 37℃ reading for 1 min. II: KASP recovery: 94℃ denaturation for 20 s; 57℃ extension for 60 s; 37℃ reading for 1 min. If the detection results of different alleles were not ideal in the two-dimensional graph, step II could be repeated twice (3 times in total) and then read at 37℃ for 1 min; after the reaction was completed, the sample allele typing was determined according to the two fluorescence signals.

[0082] 4) Detection results

[0083] In the KASP molecular marker detection of Rx1 gene, if only FAM fluorescence signal is detected, the SNP-1 site of the tested material is judged to be homozygous favorable allele (GG), which is theoretically resistant to disease; if only HEX fluorescence signal is detected, the SNP-1 site of the tested material is judged to be homozygous unfavorable allele (CC), which is theoretically susceptible to disease; if FAM and HEX fluorescence signals are detected simultaneously, the SNP-1 site of the tested material is judged to be heterozygous allele (GC), which is theoretically resistant to disease. Similarly, in the KASP molecular marker detection of Rx2 gene, if only FAM fluorescence signal is detected, the SNP-2 site of the tested material is judged to be homozygous favorable allele (CC), which is theoretically resistant to disease; if only HEX fluorescence signal is detected, the SNP-2 site of the tested material is judged to be homozygous unfavorable allele (GG), which is theoretically susceptible to disease; if FAM and HEX fluorescence signals are detected simultaneously, the SNP-2 site of the tested material is judged to be heterozygous allele (CG), which is theoretically resistant to disease. Figure 4

[0084] In the KASP molecular marker detection of 58 known resistant varieties of Rx1 and Rx2 in the examples, the detection results are completely consistent with the PCR marker results Figure 5 ), that is, the accuracy of primers Rx1-KASPF1, Rx1-KASPR1 and Rx1-KASPR2 in detecting Rx1 gene is 98.3%, with a false positive rate of 1.7%, while the accuracy of primers Rx2-KASPF2, Rx2-KASPR3 and Rx2-KASPR4 in detecting Rx2 gene is also 100.0%, both of which are significantly higher than the detection accuracy of other molecular markers in the prior art. The reported molecular markers PVX-Rx1230, 1Rx1 and 5Rx1 of Rx1 gene, the detection accuracy of 58 potato varieties is 70.7%, 74.1% and 75.9% respectively; the reported molecular markers 10Rx2 and 106Rx2 of Rx2 gene, the detection accuracy of 58 potato varieties is 72.4% and 75.9% respectively Figure 4 and Figure 5 ). In addition, two F1 populations are detected by using KASP detection primers of Rx1 and Rx2 genes, and the marker detection results are completely consistent with the resistance identification results Figure 5 . Moreover, KSAP marker detection does not need to be electrophoresed, and is more efficient. These results show that the newly developed KASP molecular marker can accurately and efficiently identify PVX resistance.

[0085] The above description is only a preferred specific embodiment of the present application, but the protection scope of the present application is not limited thereto, and any changes or replacements easily thought of by those skilled in the art within the technical scope disclosed in the present application should be covered within the protection scope of the present application.​

Claims

1. A PCR detection method of potato PVX resistance genes, comprising: extracting genomic DNA of potato; performing PCR amplification on the genomic DNA of potato by using DNA molecules as described in SEQ ID NO: 1 and 2 as a primer set, which specifically detects whether the Rx1 gene exists by using an InDel-1 resistance-related mutation site; wherein the InDel-1 is a three-base TCC deletion mutation site at position 14,025 of the Rx1 reference gene AJ011801.1; performing PCR amplification on the genomic DNA of potato by using DNA molecules as described in SEQ ID NO: 6 and 7 as a primer set, which specifically detects whether the Rx2 gene exists by using an InDel-2 resistance-related mutation site; wherein the InDel-2 is a three-base TCC insertion mutation site InDel at position 2,215 of the Rx2 reference gene AJ249448.1; performing electrophoresis detection on the PCR amplification product; and judging, according to the electrophoresis detection result, that: in the Rx1 gene PCR molecular marker detection, if a 374 bp band is detected by electrophoresis, it is judged that the Rx1 resistance gene molecular marker detection of the material to be tested is positive, otherwise it is negative; and in the Rx2 gene PCR molecular marker detection, if a 302 bp band is detected by electrophoresis, it is judged that the Rx2 resistance gene molecular marker detection of the material to be tested is positive, otherwise it is negative. 2.A competitive allele-specific PCR detection method of potato PVX resistance genes, comprising: extracting genomic DNA of potato; performing competitive allele-specific PCR amplification on the Rx1 gene of potato by using DNA molecules as described in SEQ ID NO: 3, 4 and 5 as a primer set to determine the genotype of a resistance-related mutation site SNP-1; wherein the sequence of the universal forward primer is AGTAGTGATCACTTTCCGTACCTTGAACGA; the sequence of the allele-specific reverse primer 1 is FAM-CAAATTACGGCAATCTCTAAGAATAAC; the sequence of the allele-specific reverse primer 2 is HEX-CCAAATTACGGCAATCTCTAAGAATAAG; and the SNP-1 is a single nucleotide polymorphism site formed by mutation of G to C at position 14,363 of the Rx1 reference gene AJ011801.

1. ​ ​ ​ ​ ​ ​ ​ ​ The DNA molecules as shown in SEQ ID NO: 8, 9 and 10 are used as a primer group for competitive allele-specific PCR amplification of the Rx2 gene of potato to determine the genotype of the resistance-related variation site SNP-2; wherein the sequence of the universal forward primer is GTTGAGGAAGGGTTTCCTCACTTGAA, the sequence of the allele-specific reverse primer 1 is FAM-GAATGTATACATCATCCAGAAACAAGAAG, and the sequence of the allele-specific reverse primer 2 is HEX-GAATGTATACATCATCCAGAAACAAGAAC; and the SNP-2 is a single nucleotide polymorphism site formed by mutation of C to G at 2,482bp of the Rx2 reference gene AJ249448.

1. The product of the competitive allele-specific PCR amplification is subjected to fluorescence detection to obtain the fluorescence signal of the amplification product; and the genotype of the SNP-2 site of the test material is determined according to the fluorescence signal of the amplification product, and the determination criteria are as follows: In the fluorescence detection of the competitive allele-specific PCR product of the Rx1 gene, if only FAM fluorescence signal is detected, it is determined that the SNP-1 site of the test material is homozygous for the beneficial allele GG, which shows resistance; if only HEX fluorescence signal is detected, it is determined that the SNP-1 site of the test material is homozygous for the non-beneficial allele CC, which shows susceptibility; and if FAM and HEX fluorescence signals are detected simultaneously, it is determined that the SNP-1 site of the test material is heterozygous for the allele GC, which shows resistance. In the fluorescence detection of the competitive allele-specific PCR product of the Rx2 gene, if only FAM fluorescence signal is detected, it is determined that the SNP-2 site of the test material is homozygous for the beneficial allele CC, which shows resistance; if only HEX fluorescence signal is detected, it is determined that the SNP-2 site of the test material is homozygous for the non-beneficial allele GG, which shows susceptibility; and if FAM and HEX fluorescence signals are detected simultaneously, it is determined that the SNP-2 site of the test material is heterozygous for the allele CG, which shows resistance.

3. Use of the primer group for detecting the PVX resistance gene Rx1 of potato in the preparation of a kit for detecting a molecular marker associated with the PVX resistance gene Rx1 of potato and / or in marker-assisted breeding associated with the PVX resistance gene Rx1 of potato; wherein the primer group for detecting the PVX resistance gene Rx1 of potato comprises a PCR detection primer group with the nucleotide sequences as shown in SEQ ID NO: 1 and 2, and a competitive allele-specific PCR detection primer group with the nucleotide sequences as shown in SEQ ID NO: 3, 4 and 5; the molecular marker associated with the PVX resistance gene Rx1 of potato comprises a single nucleotide polymorphism site SNP-1 formed by mutation of G to C at 14,363bp of the Rx1 reference gene AJ011801.1, and a three-base TCC deletion mutation site InDel-1 at 14,025bp. ​ 4. Use of a primer set for detecting potato PVX resistance gene Rx2 in preparing a kit for detecting a molecular marker associated with potato PVX resistance gene Rx2 and / or in marker-assisted breeding of a molecular marker associated with potato PVX resistance gene Rx2; wherein, the primer set for detecting potato PVX resistance gene Rx2 comprises a PCR detection primer set with nucleotide sequences as shown in SEQ ID NO: 6 and 7; and a competitive allele-specific PCR detection primer set with nucleotide sequences as shown in SEQ ID NO: 8, 9 and 10; and the molecular marker associated with potato PVX resistance gene Rx2 comprises a single nucleotide polymorphism site SNP-2 of C to G mutation at 2,482bp of Rx2 reference gene AJ249448.1, and a three-base insertion mutation site InDel-2 at 2,215bp.

4. Use of a primer set for detecting potato PVX resistance gene Rx2 in preparing a kit for detecting a molecular marker associated with potato PVX resistance gene Rx2 and / or in marker-assisted breeding of a molecular marker associated with potato PVX resistance gene Rx2; wherein, the primer set for detecting potato PVX resistance gene Rx2 comprises a PCR detection primer set with nucleotide sequences as shown in SEQ ID NO: 6 and 7; and a competitive allele-specific PCR detection primer set with nucleotide sequences as shown in SEQ ID NO: 8, 9 and 10; and the molecular marker associated with potato PVX resistance gene Rx2 comprises a single nucleotide polymorphism site SNP-2 of C to G mutation at 2,482bp of Rx2 reference gene AJ249448.1, and a three-base insertion mutation site InDel-2 at 2,215bp.

4. Use of a primer set for detecting potato PVX resistance gene Rx2 in preparing a kit for detecting a molecular marker associated with potato PVX resistance gene Rx2 and / or in marker-assisted breeding of a molecular marker associated with potato PVX resistance gene Rx2; wherein, the primer set for detecting potato PVX resistance gene Rx2 comprises a PCR detection primer set with nucleotide sequences as shown in SEQ ID NO: 6 and 7; and a competitive allele-specific PCR detection primer set with nucleotide sequences as shown in SEQ ID NO: 8, 9 and 10; and the molecular marker associated with potato PVX resistance gene Rx2 comprises a single nucleotide polymorphism site