Co-segregation molecular marker of hybrid male sterility locus hms10 in rice and application thereof
By precisely mapping the rice chromosome 10 and developing the co-segregating molecular marker IDHMS10, the problem of high risk in two-line hybrid rice seed production has been solved, enabling the breeding and safe seed production of fertile-stable heterozygous male-sterile lines, thus improving the accuracy and safety of rice breeding.
Patent Information
- Application Number
- CN202510154805.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-12
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2045-02-12
AI Technical Summary
The existing two-line hybrid rice has high seed production risks, a narrow breeding area for sterile lines, a relatively limited range of practical sterile resources, and serious seed production safety issues, which affect its healthy and sustainable development.
By precisely locating the HMS10 locus within the ~60 kb physical region of rice chromosome 10, a co-segregating molecular marker IDHMS10 was developed. Using molecular breeding strategies, a thermosensitive male sterile line was converted into a heterozygous male sterile line whose fertility is not affected by the environment. The purity of the heterozygous male sterile line was then identified using the molecular marker IDHMS10.
This method achieves fertility stability and safe seed production of heterozygous male-sterile lines, provides a fast and accurate breeding method, reduces seed production risks, and ensures the safety and sustainable development of hybrid rice.
Smart Images

Figure CN119710074B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of crop genetic breeding, and particularly relates to a co-segregation molecular marker of a hybrid male sterility locus HMS10 of rice and application thereof. BACKGROUND
[0002] The invention of two-line hybrid rice technology based on rice photoperiod and temperature-sensitive male nuclear sterility (i.e. two-line sterile resource) gene resources and its popularization and application have made significant contributions to ensuring rice yield increase and food security in China. However, the popularization of two-line hybrid rice is also faced with many difficulties such as high seed production risk, narrow propagation area of sterile lines, and single type of practical sterile resources. In recent years, the global climate is complex and changeable, and the seed production risk of two-line hybrid rice is high, and seed production failure events occur frequently. The safety of seed production has become a major obstacle to the healthy and sustainable development of two-line hybrid rice. Therefore, there is an urgent need for a new male sterile resource with a wide recovery spectrum and sterile characteristics unaffected by the environment, which can overcome the technical difficulties of potential seed production risks of two-line hybrid rice.
[0003] Heterozygous male sterility (HMS) has the advantages of stable fertility and relatively free assortment, and its breeding utilization is expected to solve the above technical difficulties. Therefore, the heterozygous male sterile line has broad breeding application prospects. Ni Jinlong et al. of the Rice Institute of Anhui Academy of Agricultural Sciences developed a series of design breeding techniques for reproducible heterozygous male sterile lines (ZL201911258959.4, ZL202211640849.6 and ZL202310044830.3) for different types of materials, and created heterozygous male sterile lines 1829HS and YanongHS with stable fertility and relatively free assortment. Ni Jinlong et al. crossed the temperature-sensitive male nuclear sterile line carrying RTMS10 RS (derived from YanongS) with the fertile material carrying allele in 1892F, and the F1 showed HMS. Since RTMS10 HB RTMS10 RS the allele in 1892F, whether HMS is caused by direct genetic interaction or not also needs to be further verified. Therefore, it is necessary to conduct in-depth genetic analysis of HMS, fine map the genetic locus controlling HMS, and develop related molecular markers to provide reliable technical support for molecular breeding of heterozygous male sterile lines. RTMS10 RTMS10 RS RTMS10 HB SUMMARY
[0004] In view of the problems in the prior art, the application provides a hybrid male sterile locus of rice HMS10 Fine mapping and a co-segregation molecular marker thereof aim to solve or at least alleviate some of the problems in the prior art.
[0005] In one aspect of the application, the application provides fine mapping of a hybrid male sterile locus HMS10 of rice, wherein the locus is fine-mapped to a 60 kb physical interval of chromosome 10 of rice. HMS10 The locus is fine-mapped to a 60 kb physical interval of chromosome 10 of rice.
[0006] In one aspect of the application, the application provides a molecular marker, which is a co-segregation molecular marker IDHMS10 of a hybrid male sterile locus of rice HMS10 , wherein forward and reverse primer sequences of the molecular marker are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.
[0007] The molecular marker IDHMS10 has an amplified fragment size of 364 bp in a reverse temperature-sensitive male nuclear sterile line RS resource (Yannong S or a homotype line thereof and a derived reverse temperature-sensitive male nuclear sterile line) carrying the genotype, and a sequence shown in SEQ ID NO: 3. HMS10 RS The molecular marker IDHMS10 has an amplified fragment size of 364 bp in a reverse temperature-sensitive male nuclear sterile line RS resource (Yannong S or a homotype line thereof and a derived reverse temperature-sensitive male nuclear sterile line) carrying the genotype, and a sequence shown in SEQ ID NO: 3.
[0008] The molecular marker IDHMS10 has an amplified fragment size of 283 bp in a hybrid male sterile maintainer line HB resource (including but not limited to 1892S, Y58S, P88S and Qian211S and the like temperature-sensitive male nuclear sterile line and 1892F and Nipponbare and the like fertile resource and a derived similar material) carrying the genotype, and a sequence shown in SEQ ID NO: 4. HMS10 HB The molecular marker IDHMS10 has an amplified fragment size of 283 bp in a hybrid male sterile maintainer line HB resource (including but not limited to 1892S, Y58S, P88S and Qian211S and the like temperature-sensitive male nuclear sterile line and 1892F and Nipponbare and the like fertile resource and a derived similar material) carrying the genotype, and a sequence shown in SEQ ID NO: 4.
[0009] The molecular marker IDHMS10 cannot amplify a target band in a rice resource (including but not limited to Yueduocaimiao, Wushansicaimiao, Huanhui422, R608 and R498 and the like and a derived similar material) carrying the genotype. HMS10 R The molecular marker IDHMS10 cannot amplify a target band in a rice resource (including but not limited to Yueduocaimiao, Wushansicaimiao, Huanhui422, R608 and R498 and the like and a derived similar material) carrying the genotype.
[0010] The molecular marker IDHMS10 has an amplified fragment size of 283 bp in a hybrid male sterile maintainer line HB resource (including but not limited to 1892S, Y58S, P88S and Qian211S and the like temperature-sensitive male nuclear sterile line and 1892F and Nipponbare and the like fertile resource and a derived similar material) carrying the genotype, and a sequence shown in SEQ ID NO: 4. HMS10 RS HMS10 HB The amplified band in the hybrid male sterile line with the hybrid genotype is in a hybrid state (a hybrid band of 364 bp and 263 bp).
[0011] In one aspect of the application, the application provides a hybrid male sterile locus HMS10And the application of the co-separation molecular marker IDHMS10 in the molecular breeding and purity identification of the hybrid male sterile line of rice.
[0012] In one embodiment, the hybrid male sterile site of rice HMS10 The application method of the hybrid male sterile line of rice and the molecular marker IDHMS10 is as follows: the hybrid male sterile line of rice carrying HMS10 HB The genotype of the positive temperature-sensitive male nuclear sterile line Quan211S is crossed with the genotype of the reverse temperature-sensitive male sterile line resource RS and the genotype of the hybrid male sterile maintainer line Quan211HB. HMS10 RS The genotype of the reverse temperature-sensitive male nuclear sterile line resource RS is Yanong S or a homologous line and a derived reverse temperature-sensitive male nuclear sterile line. HMS10 R The genotype of the rice resource R is crossed, backcrossed and self-crossed, and the reverse temperature-sensitive male nuclear sterile line Quan211RS and the hybrid male sterile line Quan211HB with the same genetic background as Quan211S are bred by molecular breeding, and the hybrid male sterile line Quan211HS is propagated by crossing the reverse temperature-sensitive male nuclear sterile line Quan211RS as the female parent with the hybrid male sterile maintainer line Quan211HB.
[0013] In one embodiment, the reverse temperature-sensitive male nuclear sterile line resource RS carrying HMS10 RS The genotype of the reverse temperature-sensitive male nuclear sterile line resource RS is Yanong S or a homologous line and a derived reverse temperature-sensitive male nuclear sterile line.
[0014] In one embodiment, the hybrid male sterile maintainer line resource HB carrying HMS10 HB The genotype of the hybrid male sterile maintainer line resource HB includes but is not limited to the positive temperature-sensitive male nuclear sterile lines 1892S, Y58S, P88S and Quan211S, and the fertile resources 1892F and Nipponbare and similar materials derived therefrom.
[0015] In one embodiment, the rice resource carrying HMS10 R The genotype of the rice resource includes but is not limited to Yuhuosimian, Wushansimian, Lunhui422, R608 and R498 and similar materials derived therefrom.
[0016] In one embodiment, the hybrid male sterile site of rice HMS10 The application of the molecular marker IDHMS10 in the seed purity identification of the hybrid male sterile line HS.
[0017] In one embodiment, the reverse temperature-sensitive male nuclear sterile resource RS carrying HMS10 RS The genotype of the reverse temperature-sensitive male nuclear sterile resource RS is Yanong S or a homologous line and a derived reverse temperature-sensitive male nuclear sterile line; and the genotype of the hybrid male sterile maintainer line resource HB includes but is not limited to the positive temperature-sensitive male nuclear sterile lines 1892S, Y58S, P88S and Quan211S, and the fertile resources 1892F and Nipponbare and similar materials derived therefrom. HMS10 HBThe genotype hybrid male sterile maintainer line resource HB includes, but is not limited to, 1892S, Y58S, P88S and Qian211S and the like positive temperature sensitive male sterile line and 1892F and Nipponbare and the like fertile resource and the like similar materials derived therefrom; the genotype hybrid male sterile line resource HB carries HMS10 R The genotype rice resource includes, but is not limited to, Yuehao silk seedling, Wushan silk seedling, Roundabout 422, R608 and R498 and the like and the like similar materials derived therefrom.
[0018] The application fine positioning controls the genetic locus of the HMS trait HMS10 The co-segregation molecular marker IDHMS10 is developed and applied to molecular breeding and purity identification of the hybrid male sterile line, thereby providing technical support for realizing safe seed production of hybrid rice. Beneficial effects
[0019] In summary, the advantages and positive effects of the application are as follows:
[0020] The application combines the molecular marker technology of modern molecular biology with various selection technologies such as hybridization, backcrossing and test crossing in traditional crop genetic breeding, thereby providing a fast, accurate and predictable practical method for crop new variety breeding and new material creation. HMS10 RS The genotype reverse temperature sensitive male sterile line resource Yanong S (YnS) carries HMS10 HB The genotype normal fertile material Yanong HB (YnHB) is hybridized and backcrossed, and the locus HMS10 of the hybrid male sterile rice is fine positioned in the 60 kb physical interval of the 10th chromosome of the rice by using the extremely sterile single plant in the high generation backcross large population. HMS10 The co-segregation molecular marker IDHMS10 is developed. By using the molecular marker IDHMS10, the positive temperature sensitive male sterile line Qian211S with excellent comprehensive agronomic traits is transplanted into the practical hybrid male sterile line Qian211HS with fertility not affected by light and temperature through a molecular breeding strategy; meanwhile, the molecular marker IDHMS10 can also be used for identifying the purity of the hybrid male sterile line, thereby providing technical support for realizing safe seed production of hybrid rice. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 Fine positioning result of the hybrid male sterile locus HMS10.
[0022] Figure 2 Amplification result of the molecular marker IDHMS10 on different functional haplotypes of the locus. HMS10 Amplification result of the molecular marker IDHMS10 on different functional haplotypes of the locus.
[0023] M: DNA marker (bands increasing in size from 100, 200, 300, 400, 500, and 600 bp); YnS ( HMS10 RS Genotype); YnHB ( HMS10 HB Genotype); YnR ( HMS10 R Genotype); YnHS ( HMS10 RS HMS10 HB genotype).
[0024] Figure 3 Amplification results of molecular marker IDHMS10 in different rice materials.
[0025] M: DNA marker (bands increasing in size from 100, 200, 300, 400, 500, and 600 bp); 1892RS carries HMS10 RS Genotypes: 1829S, Y58S, P88S, Quan211S, 1892F, and NIP (Nipponbare) materials carry. HMS10 HB Genotype; 1892HS carrier HMS10 RS HMS10 HB Genotypes; YHSM (Yuehe Simiao), WSSM (Wushan Simiao), L422, R608, and R498 materials carry HMS10 R genotype.
[0026] Figure 4 YnS background HMS10 The fertility performance of three haplotype materials and their interbreeding F1 under long-day high-temperature conditions (plant Bars = 30 cm) and artificial climate chamber conditions of 31℃ and 23℃ (pollen Bars = 50 μm).
[0027] Figure 5 Fertility performance of YnS, Quan211S, and the selected heterozygous male-sterile line Quan211HS under different temperature conditions. Bars=100 μm.
[0028] Figure 6 Application of molecular marker IDHMS10 in the identification of seed purity of the heterozygous male-sterile line Yannong HS. RS:YnS; HB:YnHB; 1-92 represent different individual plants of the Yannong HS hybrid, where * indicates 89, which represents a pseudo-hybrid (YnS self-cross). Detailed Implementation
[0029] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application will be further described in details below with embodiments. The equipment and reagents used in each embodiment and test example can be obtained from commercial channels if not specifically stated. It should be understood that the specific embodiments described herein are only used to explain the present application and not to limit the present application.
[0030] The present application discloses a fine mapping method of a hybrid male sterility site of rice HMS10 and application of a co-segregation molecular marker IDHMS10 thereof, which are specifically shown in the following embodiments.
[0031] Genetic analysis of HMS trait, HMS10 fine mapping of the site and application of IDHMS10 marker
[0032] In order to identify the site controlling hybrid male sterility of rice, the reverse temperature-sensitive male nuclear sterile line YnS was used as the female parent to cross and backcross with the normal fertile material YnHB. Among 243 single plants in the BC1F1 backcross generation population, 119 single plants showed hybrid male sterility phenotype, and 124 single plants showed complete male fertility. The segregation of sterile plants and fertile plants was in accordance with 1:1 ( P =0.7484 > 0.05), indicating that the HMS trait is controlled by a single site. The genotypes of 119 HMS single plants were analyzed by molecular markers, and a major site controlling HMS was identified on the 10th chromosome of rice, named HMS10 , which is located between markers ID11087 and ID1329. The HMS10 was further fine mapped in the ~60 kb physical interval between Y13187 and Y13247 using the YnS / YnHB / / YnHB / / / YnHB BC2F1 large population ( Figure 1 ), and a molecular marker IDHMS10 co-segregated with HMS10 was developed, and the forward and reverse primer sequences are shown in SEQ ID NO: 1, SEQ ID NO: 2.
[0033] IDHMS10-F: 5’-TCCGGTCTCCAGTCTTCTAT-3’ (SEQ ID NO: 1)
[0034] IDHMS10-R: 5’-AGTACACTTCTCCAGCTGTTG-3’ (SEQ ID NO: 2)
[0035] Example 2 Molecular identification of functional haplotype of HMS10 site and genetic mode analysis of HMS
[0036] This invention utilizes molecular breeding techniques to [transform / introduce] [a specific variety] derived from L422. RTMS10 L422 The haplotype was introduced into the YnS background, and the specific breeding process was as follows: In the spring of 2016, YnS was used as the female parent in Lingshui, Hainan, and crossed with the fertile material Recurrent 422 (L422). The F1 generation was planted in Hefei in the summer of 2016. During the heading and flowering period, the F1 generation was used as the male parent and backcrossed with YnS. At the end of March 2017, haplotypes carrying YnS were selected from the YnS / / YnS / L422 BC1F1 population in Lingshui, Hainan. RTMS10 L422 The fertile single plants were then backcrossed with YnS. This backcrossing process was repeated until the BC5F1 population carrying YnS was harvested in Lingshui, Hainan in April 2020. RTMS10 L422 Fertile single-plant seeds. Harvested at the end of September 2020, the BC5F2 population carrying homozygous [seeds]. RTMS10 L422 Fertile single-plant seeds. Harvested in late March 2021 in Lingshui, Hainan, BC5F3 generation carrying homozygous seeds. RTMS10 L422 The strain whose main agronomic traits are consistent with those of YnS was named YnR.
[0037] Molecular identification of YnS, YnHB, YnR, and Yannong HS (YnHS) was performed using the molecular marker IDHMS10. The results showed that the primer pair labeled IDHMS10 amplified a fragment of 364 bp in YnS. Figure 2 The sequence is shown in SEQ ID NO: 3; the amplified fragment size in YnHB is 283 bp ( Figure 2 The sequence is shown in SEQ ID NO: 4; no band could be amplified in YnR; heterozygous bands of 364 bp and 263 bp were amplified simultaneously in YnHS. Figure 2 Furthermore, materials such as 1892RS, 1892S, 1892HS, Y58S, P88S, Quan211S, 1892F, Nipponbare, Yuehe Simiao, Wushan Simiao, Lunhui 422, R608, and R498 were amplified using IDHMS10, and the results are as follows. Figure 3As shown, the 283 bp band type can be amplified in 1892S, Y58S, P88S, Quan211S, 1892F and Nipponbare, and these materials and YnS or 1892RS hybrid F1 all show HMS phenotype; Yuehuisaima, Wushansaima, Recurrent422, R608, R498 and other materials similar to YnR cannot amplify the band, and these materials and YnS or 1892RS hybrid F1 all do not show HMS. Therefore, according to the differences in the size and presence or absence of the amplified fragment of IDHMS10 in different types of materials, the haplotype of YnS or its isogenic line and the derived reverse temperature-sensitive male sterile line is named as HMS10 The haplotype of YnR and the derived similar materials including but not limited to Yuehuisaima, Wushansaima, Recurrent422, R608 and R498 and the like is named as HMS10 RS The haplotype of YnHB and the derived similar materials including but not limited to 1892S, Y58S, P88S, Quan211S and the like, and 1892F and Nipponbare and the like is named as HMS10 The haplotype of YnR and the derived similar materials including but not limited to Yuehuisaima, Wushansaima, Recurrent422, R608 and R498 and the like is named as HMS10 HB The haplotype of YnR and the derived similar materials including but not limited to Yuehuisaima, Wushansaima, Recurrent422, R608 and R498 and the like is named as HMS10 The haplotype of YnR and the derived similar materials including but not limited to Yuehuisaima, Wushansaima, Recurrent422, R608 and R498 and the like is named as HMS10 R .
[0038] IDHMS10-364 SEQ ID NO: 3, 364 bp
[0039] TCCGGTCTCCAGTCTTCTATGTCAAGTGTGATTCTTCCTACACATTTTGCAGTAGGAAGATGAACATCCTTGGCCACTACAATAGTTAGAAGTAGAAAAAAGGCCATATCAGAGTTGAGAGATCACTACTTTCACTACCTTCAGTATCTTCTGAATCTGGATATCTCTGAGGCTCGTCCACCATCATATCTTCAATATCTTCTCCTGAATCTGGATATCTCTGATGCTCGTCCACCATCATATTCCTATTTGGTTGGTTGTCCTCCCTTGTGGGAGTTGGTGCCCAGTCTTCTGCAGCAAGCAGTGTTGTATTTAGTCGATAGATAATATATGTACATATATGCAACAGCTGGAGAAGTGTACT
[0040] IDHMS10-283 SEQ ID NO: 4, 283 bp
[0041] TCCGGTCTCCAGTCTTCTATGTCAAGTGTGATTCTTCCTACACATTTTGCAGTAGGAAGATGAACATCCTTGGCCACTACAATAGTTAGAAGTAGAAAAAAGGCCATATCAGAGTTGAGAGATCACTACTTTCACTACCTTCAGTATCGTCCACCATCATATTCCTATTTGGTTGGTTGTCCTCCCTTGTGGGAGTTGGTGCCCAGTCTTCTGCAGCAAGCAGTGTTGTATTTAGTCGATAGATAATATATGTACATATATGCAACAGCTGGAGAAGTGTACT
[0042] To explore the genetic pattern of HMS, the present application crosses YnS, YnHB and YnR with each other in Lingshui, Hainan in March 2022. YnS, YnHB, YnR and F1 of the crosses of the three with each other are planted in Hefei in the 2022 growing season. Pollen fertility is observed under long-day high-temperature conditions and in an artificial climate chamber (average temperatures are 31°C and 23°C, respectively). Microscopic examination shows that only the haplotype HMS10 RS and HMS10 HB The hybrid offspring exhibit male sterility under high- and low-temperature conditions Figure 4 , indicating that the HMS phenotype is HMS10 RS and HMS10 HB caused by genetic interaction.
[0043] PCR reaction system: 100 ng of DNA, 10 μl of 2x PCR Mix, 1 μl of each of the upper and lower upstream primers with a concentration of 10 mM; add ddH2O to 20 μl.
[0044] PCR amplification procedure: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 sec, 56°C annealing for 30 sec, 72°C extension for 30 sec, 32 cycles; 72°C extension for 5 min.
[0045] Example 3 Application of molecular markers in molecular breeding of hybrid male sterile line Quan211HS
[0046] The present application uses the molecular marker IDHMS10 to convert the positive temperature-sensitive male nuclear sterile line Quan211S into the hybrid male sterile line Quan211HS through a molecular breeding strategy. The specific breeding process is as follows: In the summer of 2019 in Hefei, Quan211S was used as the recurrent parent and was crossed with the male sterile line YnS carrying IDHMS10 and the male sterile line YnR carrying IDHMS10, respectively. TMS5 TMS5 HMS10RS HMS10 RS Genotype of the reverse temperature-sensitive male sterile line YnS and carrying TMS5 TMS5 HMS10 R HMS10 R Genotype of the normal fertile material Recurrent 422 hybridization, backcross and selfing. HMS10 Three functional haplotypes of the site HMS10 RS , HMS10 HB and HMS10 R According to Figure 2 band spectrum determination of amplification products, carrying HMS10 RS Genotype of the amplification fragment size of 364 bp, carrying HMS10 HB Genotype of the amplification fragment size of 283 bp, carrying HMS10 R Genotype of the amplification of the target band, carrying HMS10 RS HMS10 HB Heterozygous genotype amplification band is in a hybrid state (hybrid band of 364 bp and 263 bp). TMS5 Genotype selection according to the band spectrum of amplification products in (ZL202310044830.3). In the backcross population of Quan211S and YnS, the molecular marker IDHMS10 was used to select carrying TMS5 tms5 HMS10 RS HMS10 HB Hybrid genotype of sterile single plant, continue to backcross with Quan211S (every spring in Lingshui, Hainan), after continuous backcrossing for 3-4 generations, obtain the male sterile plant in Quan211S background (YnS-Quan211S-3-1) TMS5 tms5 HMS10 RS HMS10 HB ). In the backcross population of Quan211S and Recurrent 422, the molecular marker IDHMS10 was used to select carrying TMS5 tms5 HMS10 HB HMS10 R Genotype of the fertile single plant, continue to backcross with Quan211S (every spring in Lingshui, Hainan and summer in Hefei), after continuous backcrossing for 3-4 generations, obtain the male fertile plant in Quan211S background (YnS-Quan211S-3-1) TMS5 tms5 HMS10 HB HMS10 R ). The male sterile plant in Quan211S background (YnS-Quan211S-3-1) TMS5 tms5 HMS10 RS HMS10HB ) and male fertile line Q211S (background) (Fig. 1) were crossed, and the reverse temperature-sensitive male sterile line Q211RS (background) was screened in the F2 population using the molecular marker IDHMS10 (Fig. 2). TMS5 tms5 HMS10 HB HMS10 R ) and the hybrid male sterile maintainer line Q211HB (background) (Fig. 3). TMS5 TMS5 HMS10 RS HMS10 RS ) and the hybrid male sterile maintainer line Q211HB (background) (Fig. 3). TMS5 TMS5 HMS10 HB HMS10 HB In the spring of 2023, Q211RS was used as the female parent and crossed with Q211HB in Lingshui, Hainan, and the hybrid male sterile line Q211HS was obtained. In the summer of 2023 in Hefei and in the spring of 2024 in Lingshui, Hainan, the fertility of Q211HS was determined by observing self-pollination and anther morphology, and the results showed that Q211HS exhibited male sterility under both long-day high-temperature and short-day low-temperature conditions (see Fig. 4). Figure 5
[0047] Example 4: Use of molecular marker IDHMS10 for seed purity identification of hybrid male sterile line Yanong HS
[0048] In the spring of 2023, Yanong S was used as the female parent and crossed with Yanong HB in Lingshui, Hainan, for the propagation of Yanong HS. A small amount of the propagated Yanong HS seeds were randomly taken for germination in a 30°C light incubator, and after the sprouts grew to 5-7 cm, the DNA of 92 randomly selected plants was extracted, and the seed purity of Yanong HS was identified using the molecular marker IDHMS10. The PCR reaction system and amplification program were as described in Example 2, and the results showed that 91 out of the 92 single plants were hybrid genotypes (364 bp and 283 bp hybrid bands), and the 89th single plant was a false hybrid, with a genotype identical to that of Yanong S (see Fig. 5). Figure 6 The results indicated that the molecular marker IDHMS10 can be used for rapid identification of the seed purity of hybrid male sterile lines.
[0049] The above content is a further detailed description of the present application in combination with a specific implementation, which cannot be considered as limiting the specific implementation of the present application to these descriptions. For ordinary skilled persons in the technical field to which the present application belongs, without departing from the concept of the present application, a number of simple deductions or substitutions can be made, which should be considered as falling within the protection scope determined by the claims submitted by the present application.
Claims
1. Use of primers for detecting molecular markers in the molecular breeding of hybrid male sterile lines of rice, characterized in that, The molecular marker is a co-segregation molecular marker IDHMS10 of a hybrid male sterile site of rice HMS10 The forward and reverse primer sequences of the molecular marker are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively; wherein the molecular marker is located at HMS10 RS The amplified fragment size in the reverse temperature-sensitive male nuclear sterile line RS resource with the genotype is 364 bp, and the amplified fragment size in the hybrid male sterile maintainer line HB resource with the genotype is 283 bp HMS10 HB The amplified fragment size in the reverse temperature-sensitive male nuclear sterile line RS resource with the genotype is 364 bp, and the amplified fragment size in the hybrid male sterile maintainer line HB resource with the genotype is 283 bp HMS10 R The target band cannot be amplified in the rice resource with the genotype, and the target band can be amplified in the hybrid male sterile line with the genotype HMS10 RS HMS10 HB The amplified bands in the hybrid male sterile line with the hybrid genotype are hybrid bands with sizes of 364 bp and 283 bp.
2. Use of primers for detecting molecular markers in the purity identification of hybrid male sterile lines of rice, characterized in that, The molecular marker is a co-segregation molecular marker IDHMS10 of a hybrid male sterile site of rice HMS10 The forward and reverse primer sequences of the molecular marker are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively; wherein the molecular marker is located in HMS10 RS The amplified fragment size in the genotype of the reverse temperature-sensitive male nuclear sterile line RS resource is 364 bp, and the amplified fragment size in the genotype of the hybrid male sterile maintainer line HB resource is 283 bp HMS10 HB The amplified fragment size in the genotype of the reverse temperature-sensitive male nuclear sterile line RS resource is 364 bp, and the amplified fragment size in the genotype of the hybrid male sterile maintainer line HB resource is 283 bp HMS10 R The purpose band cannot be amplified in the genotype of the rice resource, and the purpose band can be amplified in the genotype of the hybrid male sterile line HMS10 RS HMS10 HB The amplified bands in the hybrid genotype of the hybrid male sterile line are hybrid bands of 364 bp and 283 bp.
3. Use according to claim 1, characterized in that, The molecular breeding is to breed HMS10 HB The genotypes of the reverse temperature-sensitive male nuclear sterile line resources RS and the rice resources R are respectively HMS10 RS The genotypes of the reverse temperature-sensitive male nuclear sterile line resources RS and the rice resources R are respectively HMS10 R The rice resources R are hybridized, backcrossed and selfed, and through the molecular breeding strategy, the Q211RS and Q211HB materials with the same genetic background as Q211S are bred respectively, under the short-day low-temperature condition, the reverse temperature-sensitive male nuclear sterile line Q211RS selected is used as the female parent to hybridize with the hybrid male sterile maintainer line Q211HB to breed seeds, and the hybrid male sterile line Q211HS is propagated.
4. Use according to claim 1 or 2, characterized in that: The carrying HMS10 RS The genotype of the reverse temperature-sensitive male nuclear sterile line resource RS is Yanong S, or a homologous line thereof, or a derived reverse temperature-sensitive male nuclear sterile line.
5. Use according to claim 1 or 2, characterized in that: The carrying HMS10 HB Genotypic hybrid male sterility maintainer line HB resources include 1892S, Y58S, P88S, Qian211S normal temperature male nuclear sterile line, 1892F and Nipponbare and materials derived therefrom.
6. Use according to claim 1 or 2, characterized in that: The carrying HMS10 R Genotypic rice resources include Yuhuosimiao, Wushansimiao, Roundabout 422, R608, and R498 and materials derived therefrom.
Citation Information
Patent Citations
Rice reproducible heterozygosis male sterile line breeding method and application thereof
CN110800606A
A molecular breeding method for converting a positively thermosensitive male-sterile rice line into a fertile heterozygous male-sterile line and its application.
CN115943885B
A molecular breeding method for converting a temperature-sensitive male-sterile rice line into a fertile heterozygous male-sterile line and its application.
CN116019010B