Molecular marker related to botrytis cinerea resistance and application thereof

Abstract

The invention provides a molecular marker related to botrytis cinerea resistance and application of the molecular marker. The molecular marker is a 937bp chromosome structure variation SV fragment on a tomato chromosome 9, and the chromosome structure variation SV fragment has a nucleotide sequence as shown in SEQ ID NO: 1, or a nucleotide sequence having more than 90% of homology with the nucleotide sequence. The chromosome structure variation SV of 937bp on the tomato chromosome 9 is used as the molecular marker for detecting the botrytis cinerea resistance, the disease resistance of a tomato material can be quickly distinguished, and a powerful tool is provided for tomato breeding.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and in particular to a molecular marker related to tomato gray mold resistance and an application thereof. Background Art

[0002] As one of the most consumed vegetables in the world, tomatoes are widely grown. In the tomato production process, gray mold is a fungal disease that causes serious damage. Because it develops early, lasts for a long time, and mainly harms the fruit, it causes serious yield and economic losses to tomatoes before and after harvesting. At present, in the process of preventing and controlling gray mold, most of them still rely on chemical control such as spraying chemical pesticides, which not only causes problems such as food safety and environmental pollution, but also causes Botrytis cinerea (the pathogen of gray mold) to develop serious drug resistance. Therefore, in order to solve the current dilemma, screening and cultivating high-quality, stable and highly resistant new tomato varieties is an effective means of preventing and controlling gray mold.

[0003] Mining and identifying genes involved in regulating tomato resistance to gray mold is an important prerequisite for accelerating the development of new tomato resistant varieties. Currently, many genes involved in regulating tomato resistance to gray mold have been identified. For example, SlMPP6 positively regulates tomato resistance to gray mold. Overexpression of SlMPP6 enhances tomato resistance, while knocking out SlMPP6 makes tomato more susceptible to gray mold (such as patent application document CN114807220A). SlBBX20 negatively regulates tomato resistance to gray mold. Knocking out SlBBX20 significantly improves tomato resistance. The expression of SlBBX20 can be induced by Botrytis cinerea in both resistant and susceptible tomato materials (such as patent application document CN112195186A).

[0004] Editing non-coding DNA sequences is a more accurate means of gene regulation. It can adjust the expression level of genes without changing the protein coding sequence, reduce the side effects on other functions of the organism, and is relatively safe. However, in current research, most of the genes found to regulate tomato disease resistance are genes that can be encoded as proteins, rather than non-coding DNA sequences. Therefore, this application intends to provide a new molecular marker or gene marker related to tomato gray mold resistance based on non-coding DNA sequences, so as to further provide technical support for the prevention and treatment of tomato gray mold resistance. Summary of the invention

[0005] The main purpose of the present invention is to provide a molecular marker related to tomato gray mold resistance and its application, so as to provide a new molecular marker related to tomato gray mold resistance.

[0006] In order to achieve the above-mentioned object, according to the first aspect of the present invention, a molecular marker related to tomato gray mold resistance is provided, wherein the molecular marker is a 937bp chromosome structural variation SV fragment on tomato chromosome 9, and the chromosome structural variation SV fragment has a nucleotide sequence as shown in SEQ ID NO:1, or a nucleotide sequence having more than 90% homology with the nucleotide sequence.

[0007] In order to achieve the above object, according to a second aspect of the present invention, there is provided a use of the above-mentioned molecular marker associated with tomato gray mold resistance in detecting and / or regulating tomato gray mold resistance.

[0008] Furthermore, the use of molecular markers to detect tomato gray mold resistance includes: using the genomic DNA of the tomato to be tested as a template, performing PCR amplification on the molecular marker and performing electrophoresis identification; when a band of 937 bp cannot be amplified, the tomato to be tested is resistant to tomato gray mold; when a band of 937 bp is amplified, the tomato to be tested is not resistant to tomato gray mold.

[0009] Furthermore, the primers for PCR amplification of the molecular marker include: a forward primer as shown in SEQ ID NO:5 and a reverse primer as shown in SEQ ID NO:6.

[0010] Furthermore, regulating tomato gray mold resistance using molecular markers includes: silencing or overexpressing a gene negatively regulated by the molecular marker in a tomato material; wherein the nucleotide sequence of the gene is shown in SEQ ID NO:2.

[0011] Furthermore, the overexpression includes: constructing an overexpression vector of the gene and transferring it into Agrobacterium to obtain a positive overexpression engineered bacterium; infecting a tomato material with the positive overexpression engineered bacterium and culturing transgenic seedlings to obtain overexpression positive seedlings; transplanting the overexpression positive seedlings to obtain a tomato plant resistant to tomato gray mold.

[0012] Furthermore, the silencing includes: constructing a gene interference silencing vector and transferring it into Agrobacterium to obtain positive gene silencing engineered bacteria; infecting tomato materials with the positive gene silencing engineered bacteria, culturing transgenic seedlings, and obtaining gene silencing positive seedlings; transplanting the gene silencing positive seedlings to obtain tomato plants susceptible to tomato gray mold.

[0013] In order to achieve the above object, according to the third aspect of the present invention, a kit for detecting tomato gray mold resistance is provided, the kit comprising primers for detecting the above molecular markers associated with tomato gray mold resistance.

[0014] Furthermore, the primers include: a forward primer as shown in SEQ ID NO:5 and a reverse primer as shown in SEQ ID NO:6.

[0015] Furthermore, the kit also includes: a DNA extraction kit and a PCR amplification kit.

[0016] By applying the technical solution of the present invention, a 937bp chromosome structural variation SV on tomato chromosome 9 is used as a molecular marker for detecting tomato gray mold resistance, which can quickly distinguish the disease resistance of tomato materials and provide a powerful tool for tomato breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The drawings constituting a part of the present application are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0018] Figure 1 The GWAS identification results in Example 1 are shown. The red framed portion is the most significant SV identified, which is located on chromosome 9;

[0019] Figure 2 The phenotypes of wild and cultivated tomato materials inoculated with Botrytis cinerea in Example 2 are shown. The upper layer is the disease-resistant tomato material, and the lower layer is the disease-susceptible tomato material. The scale is 1 cm.

[0020] Figure 3 The figure shows the DNA electrophoresis gel image of amplifying SVs in different materials in Example 2. M is a DNA marker, the left side of M is the SVs missing in the tomato variety, and the right side of M is the SVs present in the tomato variety;

[0021] Figure 4 A schematic diagram of the vector structure used for transient transcription activity detection in Example 3 is shown;

[0022] Figure 5 The fluorescence signal result diagram of the transiently transcribed SV in Example 3 is shown;

[0023] Figure 6 The figure shows the quantitative analysis of the relative fluorescence activity of transiently transcribed SVs in Example 3; the significance was analyzed by Student's t test two-tailed test, ****P < 0.0001; Error bar, ± SEM (the number of biological replicates was 8);

[0024] Figure 7 The schematic diagram of the structure of the SlGMAK overexpression vector in Example 4 is shown, with the CaMV35S promoter, the OCS terminator, and the resistance of the plant to be screened is kanamycin;

[0025] Figure 8The schematic diagram of the structure of the SlGMAK interference silencing vector in Example 4 is shown, with the CaMV35S promoter, the OCS terminator, and the resistance of the plant to be screened is kanamycin;

[0026] Fig. 9 The Botrytis cinerea infection effect diagram of AC (WT) and SlGMAK overexpression material in Example 5 is shown (leftmost), with a scale of 1 cm; the result diagram of the relative expression of SlGMAK (middle), with Actin as the internal reference and the expression of SlGMAK in AC (WT) as 1, the significance was analyzed by Student's t test two-tailed test, *P < 0.05, Error bar, ± SEM (biological replicates were 3); the result diagram of infection area statistics (rightmost), using the size of the lesion in the ImageJ statistical diagram, the significance was analyzed by Student's t test two-tailed test, *P < 0.05, **P < 0.01; ****P < 0.0001. Error bar, ± SEM (biological replicates were 6);

[0027] Fig.10 The tomato plants in Example 5 in which SlGMAK was not silenced were used as the control (CK), and the effect of SlGMAK silenced materials RNAi-1,2 on Botrytis cinerea infection (far left), with a scale of 1 cm; the result of the relative expression of SlGMAK (middle), with Actin as the internal reference and the expression of SlGMAK in AC (WT) as 1; the result of infection area statistics (far right), using ImageJ to statistically analyze the size of the lesions in the figure, and the significance was analyzed by Student's t test two-tailed test, ***P <0.001; ****P< 0.0001. Error bar, ± SEM (biological replicates were 5);

[0028] Fig.11 The results of the expression detection of SlGMAK in leaves inoculated with Botrytis cinerea and leaves not inoculated with Botrytis cinerea (CK) in Example 5 are shown. Actin was used as an internal reference, and the expression level of SlGMAK in tomato leaves not inoculated with Botrytis cinerea at each time point was taken as 1. The significance was analyzed by Student's t test two-tailed test. *P < 0.05; ****P < 0.0001; Error bar, ± SEM (biological replicate number was 3). DETAILED DESCRIPTION

[0029] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0030] Glossary:

[0031] Chromosome structural variation (SV): refers to sequence changes or position changes in the genome that are greater than a certain threshold (usually 50bp or 1kb), including large fragment insertions, deletions, duplications, inversions, translocations, etc. These variations may affect genome stability, gene dosage changes, or gene expression regulation.

[0032] As mentioned in the background technology, the existing means of preventing and controlling tomato gray mold mainly rely on chemical pesticides, which not only leads to food safety and environmental pollution problems, but also promotes the development of drug resistance in pathogens. Therefore, the present application intends to provide a new molecular marker that can be used to identify resistance to tomato gray mold, so as to provide new ideas for quick and easy prevention and control of tomato gray mold and tomato breeding.

[0033] In a first typical embodiment of the present application, a molecular marker for detecting resistance to tomato gray mold is provided. The molecular marker is a 937bp chromosome structural variation SV fragment on tomato chromosome 9. The chromosome structural variation SV fragment has a nucleotide sequence as shown in SEQ ID NO: 1, or a nucleotide sequence having more than 90% homology with the nucleotide sequence.

[0034] SEQ ID NO: 1:

[0035] 。

[0036] The applicant assembled and analyzed the pan-genome of tomatoes and identified a structural variation (SV) associated with tomato resistance to gray mold, which negatively regulates tomato resistance to gray mold. This molecular marker can be used to quickly screen tomato varieties with gray mold resistance, greatly shortening the cycle of judging resistance through phenotypic observation in traditional breeding, improving breeding efficiency and further providing support for the later use of gene editing and other means to cultivate new disease-resistant tomato varieties.

[0037] In a second typical embodiment of the present application, there is provided an application of the above-mentioned molecular marker associated with tomato gray mold resistance in detecting and / or regulating tomato gray mold resistance.

[0038] In a preferred embodiment, the detection of tomato gray mold resistance using molecular markers includes: using the genomic DNA of the tomato to be tested as a template, performing PCR amplification on the molecular markers and performing electrophoresis identification; when a band of 937 bp cannot be amplified, the tomato to be tested is resistant to tomato gray mold; when a band of 937 bp is amplified, the tomato to be tested is not resistant to tomato gray mold. This method is not only fast and accurate, but also low-cost, suitable for large-scale identification of tomato germplasm resources, and provides strong technical support for the genetic improvement of tomato disease resistance traits.

[0039] To further avoid false positive results caused by non-specific amplification, in a preferred embodiment, the primers for PCR amplification of the molecular marker include: a forward primer as shown in SEQ ID NO:5 and a reverse primer as shown in SEQ ID NO:6.

[0040] SV-F (SEQ ID NO: 5): AAGAAGGTTGAGGTAGTGAAGAAT.

[0041] SV-R (SEQ ID NO: 6): AGCTTCACATGTGTACCCAAA.

[0042] In a preferred embodiment, regulating tomato gray mold resistance using molecular markers includes: silencing or overexpressing a gene (SlGMAK gene) negatively regulated by the molecular marker in tomato materials; wherein the nucleotide sequence of the gene is shown in SEQ ID NO: 2. The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 3.

[0043] The applicant further discovered that the chromosome structural variation SV can negatively regulate the expression of its upstream gene SlGMAK, which encodes the receptor kinase LRR-RLK of the VIII subfamily leucine-rich repeat sequence, and the expression of this gene is induced by Botrytis cinerea infection. The applicant further analyzed the SlGMAK protein domain through the NCBI conserved domain prediction website (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi), which is a membrane protein that spans the membrane twice, with the N-terminal LRR repeat domain as the extracellular domain and the C-terminal kinase domain as the intracellular part. Therefore, by regulating the expression of the SlGMAK gene, the resistance of tomatoes to gray mold can be artificially enhanced or weakened, opening up a new way for the biological control of tomato diseases.

[0044] SEQ ID NO:2:

[0045]

[0046] SEQ ID NO:3:

[0047] 。

[0048] In a preferred embodiment, the overexpression includes: constructing an overexpression vector of the gene, and transferring it into Agrobacterium to obtain positive overexpression engineering bacteria; infecting tomato materials with the positive overexpression engineering bacteria, culturing transgenic seedlings, and obtaining overexpression positive seedlings; transplanting the overexpression positive seedlings to obtain tomato plants resistant to gray mold. The operation of breeding tomato gray mold resistance using the SlGMAK gene can obtain phenotypically stable tomato gray mold resistance plants, which provides strong support for subsequent research on tomato gray mold.

[0049] In a preferred embodiment, the silencing further comprises: constructing a gene interference silencing vector and transferring it into Agrobacterium to obtain positive gene silencing engineering bacteria; infecting tomato materials with the positive gene silencing engineering bacteria to culture transgenic seedlings to obtain gene silencing positive seedlings; transplanting the gene silencing positive seedlings to obtain tomato plants susceptible to tomato gray mold. Through gene silencing technology, the effect of SlGMAK gene deletion on tomato gray mold resistance can be studied, further revealing the specific role of this gene in disease defense, and providing a powerful tool for gene function research.

[0050] In a preferred embodiment, the overexpression vector for constructing the SlGMAK gene is pHELLSGATE8 (eg Figure 7 ), which is carried out via the initial vector pHELLSGATE8 (as Figure 8 The PDK intron was removed from the mitochondria (shown).

[0051] In a preferred embodiment, the interference silencing vector for constructing the SlGMAK gene is pHELLSGATE8 (eg Figure 8 as shown).

[0052] In a third typical embodiment of the present application, a kit for detecting resistance to tomato gray mold is provided, the kit comprising primers for detecting the above-mentioned molecular markers related to resistance to tomato gray mold. The development of the kit makes molecular marker detection more convenient, and rapid detection can be performed in the field or in a small laboratory without complex laboratory equipment, which greatly promotes the popularization and application of tomato disease resistance breeding.

[0053] In order to further improve the accuracy and reliability of the kit detection, in a preferred embodiment, the primers include: a forward primer as shown in SEQ ID NO: 5 and a reverse primer as shown in SEQ ID NO: 6. In a preferred embodiment, the kit also includes: a DNA extraction kit and a PCR amplification kit.

[0054] The present application is further described in detail below in conjunction with specific embodiments. These embodiments should not be construed as limiting the scope of protection claimed in the present application.

[0055] The wild tomato variety materials S.galapagense, S.cheesmaniae, S.pennellii, S.chmielewskii, S.habrochaites, S.arcanum and S.neorickii are from the American Tomato Genetic Resource Center, and the cultivated tomato material S.lycopersicum is retained in the laboratory. The above 8 tomato materials involved in this application have been disclosed in the document "Fenstemaker, S.; Sim, L.; Cooperstone, J.; Francis, D., Solanumgalapagense-derived purple tomato fruit color is conferred by novel allelesof the anthocyanin fruit and atroviolacium loci. Plant Direct 2022, 6 (4), e394", and the public can obtain them from the David Francis Laboratory of the Department of Horticulture and Crop Sciences at Ohio State University or the applicant's laboratory. The above materials can only be used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0056] Nicotiana benthamiana., Latin name Nicotiana benthamiana., comes from the laboratory.

[0057] The tested tomatoes and tobacco were grown in a greenhouse with a temperature of 25°C, a humidity of 50%, and a photoperiod of 16 h light / 8 h dark.

[0058] V8 agar medium: 36% V8 juice, 0.1% CaCO3 and 2% Bacto agar.

[0059] In Vogel buffer: for 1 L system, the components are: 15 g sucrose, 3 g sodium citrate, 5 g K2HPO4, 0.2 gMgSO4·7H2O, 0.1 g CaCl2·2H2O and 2 g NH4NO3.

[0060] Transient transformation buffer: 10 mM MES, 10 mM MgCl2, 150 μM acetosyringone.

[0061] LB medium (1 L): NaCl 10 g, yeast extract 5 g, tryptone 10 g.

[0062] LB plate (1 L): NaCl 10 g, yeast extract 5 g, tryptone 10 g, add Agar at 15 g / L to prepare solid culture medium.

[0063] Lysis buffer: from the dual-luciferase reporter gene assay kit (Yisheng Biotechnology Co., Ltd., catalog number: 11402ES).

[0064] 1 / 2 MS solid medium (1 L): Murashige & Skoog Basal Salt Mixture 2.2 g, MES 0.5 g. Adjust pH to 5.8 with KOH. Add Agar at 10 g / L to prepare solid medium.

[0065] MS liquid medium (1 L): Murashige & Skoog Basal Salt Mixture 4.4 g, MES 1 g. KOH adjusted pH = 5.8.

[0066] Induction differentiation medium: Murashige & Skoog Basal Salt Mixture 5g + auxin 0.05mg / L + 6-benzylaminopurine 1.0 mg / L + 3% sucrose) (pH adjusted to 5.8 with KOH).

[0067] MS co-culture medium: Murashige & Skoog Basal Salt Mixture 4.4 g, MES 1 g. Adjust pH to 5.8 with KOH. Add Agar at 10 g / L to prepare solid culture medium.

[0068] Rooting medium: 1 / 2MS + 1-naphthaleneacetic acid 0.1 mg / L + auxin plant hormone IBA 0.5 mg / L (pH adjusted to 5.8 with KOH).

[0069] Example 1 Obtaining structural variation SV associated with tomato defense against gray mold

[0070] This example provides a method for obtaining molecular markers related to tomato resistance to gray mold, and the specific steps are as follows:

[0071] EMMAX (v20100307)100 software was used to perform GWAS analysis on 58643 high-confidence SVs and gray mold spots of 209 tomato materials, and 16 significant loci were screened. One of the most significant loci (such as Figure 1 As shown in the red box in the middle), after checking the genome, it was found that it was a structural variation of 937 bp at 33687177 on chromosome 9 (as shown in the red box in the middle). Figure 1 GWAS results were calculated using the R package qqman (https: / / github.com / stephenturner / qqman).

[0072] Example 2 SV-based molecular markers for tomato gray mold resistance and identification methods thereof

[0073] (1) Inoculation of various tomato varieties with Botrytis cinerea and phenotypic observation

[0074] Preparation of inoculum of Botrytis cinerea (the pathogen of gray mold): Collect the sporangia of Botrytis cinerea cultured at 25°C for 10 to 14 days. Botrytis cinerea is cultured in V8 agar medium. The obtained sporangia are centrifuged at 4°C and 5000 rpm for 10 min, and the supernatant is removed. Then, the precipitate is diluted with Vogel buffer to a concentration of 5×10 5 / mL for future use.

[0075] Inoculation identification: Place 6 layers of moistened inoculation paper in the inoculation box tray, place the front of wild and cultivated tomato leaves (the variety information is shown in Table 1 below) and wrap the base with wet cotton to keep it moist. After dropping 10 μL of the diluted Botrytis cinerea spores onto the tomato leaves to complete the inoculation, wrap the inoculation box with plastic wrap, place it in a 24°C environment, culture it in the dark for 1 day, culture it in the light for 2 days, and take pictures of the leaf lesion size on the 3rd day to analyze the gray mold resistance phenotype. The results are as follows: Figure 2 shown.

[0076] (2) SV-based molecular markers and identification methods for tomato gray mold resistance

[0077] The nucleotide sequence of SV mutation screened in Example 1 is shown in SEQ ID NO: 1. The upstream and downstream primers for amplifying the SV sequence are designed based on the nucleotide sequence, as shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

[0078] SV-F (SEQ ID NO: 5): AAGAAGGTTGAGGTAGTGAAGAAT.

[0079] SV-R (SEQ ID NO:6): AGCTTCACATGTGTACCCAAA.

[0080] Extract the genomic DNA of each tomato material (as shown in Table 1 below) after inoculation in the above step (1), and amplify the SV according to the forward and reverse primer sequences shown in SEQ ID NO:5-6. The PCR reaction system is as follows: 2 μL each of the forward primer and reverse primer, 1 μL of gDNA template, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, 1 μL of dNTP, 25 μL of 2 × Phanta Max Buffer, and ddH2O to make up to 50 μL. The PCR amplification program is: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, renaturation at 58°C for 15 s, extension at 72°C for 1 min, and complete extension at 72°C for 5 min. 34 cycles. The amplification results are shown in Figure 2. Figure 3 shown.

[0081] (3) Comparison of the identification results of tomato gray mold resistance molecular markers based on SV and phenotypic observation

[0082] contrast Figure 2 , 3 As shown in Table 1, the SV sequence could not be amplified in the tomato with high resistance to gray mold, indicating that SV was missing in the tomato material with high resistance to gray mold (as shown in Table 1). The SV sequence could be amplified in the tomato susceptible to gray mold (as shown in Table 1), indicating that SV was inserted in the susceptible tomato (as shown in Table 1). Figure 3 as shown).

[0083] It can be seen from this that the identification method of the tomato gray mold resistance molecular marker based on SV is to use the genomic DNA of the tomato to be tested as a template, perform PCR amplification on the molecular marker and perform electrophoresis identification; when the amplification primer cannot amplify the 937bp band, the tomato to be tested is resistant to tomato gray mold; when the 937bp band is amplified, the tomato to be tested is not resistant to tomato gray mold, that is, the presence of SV inhibits the disease resistance of tomatoes.

[0084] Table 1:

[0085]

[0086] Example 3 Analysis of the transcriptional regulatory effect of structural variant SV on its upstream gene

[0087] A 2856 bp protein-encoding gene sequence was found 63551 bp upstream of the structural variant SV, and its sequence is shown in SEQ ID NO: 2. The 952 amino acids are shown in SEQ ID NO: 3, and the protein is 105 kDa, which is named SlGMAK. Through BLAST search in NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), it was found that the SlGMAK protein was annotated as a possible leucine rich repeat (LRR) serine / threonine protein kinase.

[0088] To detect whether SV has a certain regulatory effect on SlGMAK, the SlGMAK promoter sequence (pGMAK, length 2001 bp) was obtained from the tomato gene database (https: / / solgenomics.sgn.cornell.edu / ), as shown in SEQ ID NO: 4. The pGreenII 0800-pGMAK-LUC vector and the pGreenII 0800-pGMAK -LUC-SV vector (as shown in Figure 4 The specific operations are as follows:

[0089] The pGMAK fragment with the homology arms of the pGreenII 0800-LUC vector was amplified by PCR using SEQ ID NO: 17 and SEQ ID NO: 18 as forward and reverse primers, respectively. Subsequently, the pGreenII 0800-LUC vector digested with KpnI and BamHI was fused with the pGMAK fragment containing the homology arms of the vector, and the pGreenII0800-pGMAK-LUC vector was constructed using homologous recombinase (Novozyme, catalog number C116-02).

[0090] pSlGMAK-LUC-F (SEQ ID NO:17):

[0091] ACTATAGGGCGAATTGGGTACCTGTTGTTGCATTAGTAAA.

[0092] pSlGMAK-LUC-R (SEQ ID NO:18):

[0093] CCGCTCTAGAACTAGTGGATCCCTTGAAGACCTAGAAACA.

[0094] The amplification system was: 2 μL each of forward primer and reverse primer, 1 μL gDNA template, 1 μL Phanta Max Super-Fidelity DNA Polymerase, 1 μL dNTP, 25 μL 2 × Phanta Max Buffer, and ddH2O to 50 μL. The PCR amplification program was: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 1 min 30 s, and complete extension at 72℃ for 5 min. 34 cycles.

[0095] The pGreenII 0800-pGMAK-LUC-vector was amplified by PCR using SEQ ID NO: 19 and SEQ ID NO: 20 as forward and reverse primers, and the SV sequence was amplified by PCR using SEQ ID NO: 21 and SEQ ID NO: 22 as forward and reverse primers, and pGreenII0800-pGMAK-LUC and SV were homologously recombined to construct the pGreenII 0800-pGMAK-LUC-SV vector. The specific amplification method is as mentioned above.

[0096] pSlGMAK-LUC-SV-F1 (SEQ ID NO:19):

[0097] TACCTCTGAAGTCTACCTTCTAGAGAATTCGCTGAAATC.

[0098] pSlGMAK-LUC-SV-R1 (SEQ ID NO:20):

[0099] CTTACCATCCCGCATGAGAATTTACACGGCGATCTTTC.

[0100] pSlGMAK-LUC-SV-F2 (SEQ ID NO:21):

[0101] GAAAGATCGCCGTGTAAATTCTCATGCGGGATGGTAAG.

[0102] pSlGMAK-LUC-SV-R2 (SEQ ID NO:22):

[0103] GATTTCAGCGAATTCTCTAGAAGGTAGACTTCAGAGGTA.

[0104] SEQ ID NO:4:

[0105]

[0106] The above vector was transformed into Agrobacterium GV3101 (p19) (Shanghai Weidi Biotechnology Co., Ltd., catalog number: AC1003S). After culturing at 28°C for 2 days, a single clone was selected and cultured in 2 ml LB medium (containing 25 μg / ml rifampicin Rif, 50 μg / ml kanamycin Kan) at 200 rpm overnight. The next day, the cells were inoculated into 50 ml LB medium (containing 25 μg / ml rifampicin Rif, 50 μg / ml kanamycin Kan) at a ratio of 1:100. The cells were collected by centrifugation at 5000 rpm for 10 min, and the cells were resuspended in transient transformation buffer, and the OD value was adjusted to about 1.0, and the cells were treated in the dark for 3 h.

[0107] Agrobacterium GV3101 carrying pGMAK-LUC and pGMAK-LUC-SV were injected into tobacco leaves of one month old, respectively. After 24 hours of darkness, the leaves were placed under light for 24 hours, injected with 470 μM potassium salt, and placed under a CDD camera to observe the fluorescence signal (e.g. Figure 5 The results showed that the fluorescence signal of pGMAK-LUC-SV was significantly lower than that of pGMAK-LUC.

[0108] Then collect the tobacco sample, add 100 μL lysis solution, incubate on ice for about 5 min, and fully lyse the leaves. Centrifuge at 10000-16000 rpm for 1 min, take the supernatant, which is the total plant protein. Take 20 μL of extracted total plant protein and add it to the culture plate. Prepare firefly luciferase reaction working solution and sea renilla luciferase reaction solution, that is, firefly luciferase substrate (50 ×) and sea renilla luciferase substrate (50 ×) (from Dual Luciferase Reporter Gene Assay Kit, Yisheng Biotechnology Co., Ltd., Catalog No.: 11402ES) and dilute them to 1× working solution with corresponding buffer. And incubate to room temperature. Add 100 μL of firefly luciferase reaction solution to the above culture plate, shake the plate to mix, and use the luminescence microplate reader GloMax®Discover (Promega) to detect the activity of firefly luciferase. 100 μL of Renilla luciferase reaction solution was added to the above culture plate, the plate was shaken to mix, and the activity of Renilla luciferase was detected again using the luminescence microplate reader GloMax® Discover (Promega). By calculating the relative fluorescence activity (ratio of LUC to REN), using Prism software to plot and statistically analyze the differences between the groups, the results showed that SV could significantly inhibit the transcription of SlGMAK, that is, negatively regulate the expression of SlGMAK (such as Figure 6 as shown).

[0109] Example 4 Construction of SlGMAK expression vector and genetic material

[0110] Primers were designed using the tomato gene database (https: / / solgenomics.sgn.cornell.edu / ), and the forward and reverse primer sequences are shown in SEQ ID NO: 11 and SEQ ID NO: 12. The SlGMAK gene was amplified and the gene sequence is shown in SEQ ID NO: 2. The vector pHELLSGATE8 (retained after laboratory modification) was cut with ECORI to construct the SlGMAK overexpression vector. The vector structure diagram is shown in Figure 7 shown.

[0111] OE-SlGMAK-F (SEQ ID NO:11):

[0112] GATGACGATGACAAGGAATTCATGACGCGGTTCAGATATTTTATATAT.

[0113] OE-SlGMAK-R (SEQ ID NO:12):

[0114] GTCCTTGTAATCCATGAATTCACGAGGTGTAATATTAAGGGTAACA.

[0115] The PCR amplification system was as follows: 2 μL of upstream and downstream primers, 1 μL of cDNA template, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, 1 μL of dNTP, 25 μL of 2 × Phanta Max Buffer, and ddH2O to 50 μL. The PCR amplification program was as follows: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 2 min, and complete extension at 72°C for 5 min. 34 cycles.

[0116] Design forward and reverse primers SEQ ID NO: 13-16 to amplify the SlGMAK gene using the above PCR method, and digest pHELLSGATE8 with XbaI and XholI to construct the SlGMAK interference silencing vector. The vector structure diagram is shown in Figure 8 shown.

[0117] RNAi-SlGMAK-F1 (SEQ ID NO:13):

[0118] TTTCATTTGGAGAGGACACGCTCGAGGACGCTAGAAACCACAGTCCAAATG.

[0119] RNAi-SlGMAK-R1 (SEQ ID NO:14):

[0120] CAAGCTGGGGTACCGAATTCCTCGAGGTCACACTACATACATAAATCTAGAAGCAG.

[0121] RNAi-SlGMAK-F2 (SEQ ID NO:15):

[0122] AAATCGATAAGCTTGGATCCTCTAGAGTCACACTACATACATAAATCTAGAAGCAG.

[0123] RNAi-SlGMAK-R2 (SEQ ID NO:16):

[0124] ATATCTCATTAAAGCAGGACTCTAGAGACGCTAGAAACCACAGTCCAAATG.

[0125] The above vector and fragments were recovered using 1.0% agarose gel and Omaga gel recovery kit. The concentration of the recovered gene fragment and vector size fragment was detected using NanoDrop. The cloned fragment and vector were mixed in a ratio of 3:1, 10 μL 2xCE recombinase was added, and ddH2O was added to 20 μL and connected at 50℃ for 20 min.

[0126] The ligation product was transformed into E. coli DH5α, and positive clones were screened on kanamycin resistance plates. The positive clones were cultured in 200 μL of kanamycin LB, and pHELLSGATE8-OE-SlGMAK monoclonal clones were amplified by PCR using 35S primers and primers as shown in SEQ ID NO: 12, and pHELLSGATE8-RNAi-SlGMAK monoclonal clones were amplified by PCR using 35S primers and primers as shown in SEQ ID NO: 16 to obtain positive monoclonal clones.

[0127] The PCR amplification method is as follows: 1 μL of upstream and downstream primers, 10 μL of DNA Polymerase, 1 μL of bacterial solution as template, and ddH2O to 20 μL. The PCR amplification program is: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 2min, and complete extension at 72℃ for 5min. 34 cycles.

[0128] The clones that were detected correctly were sent to the company for testing. After sequencing was correct, the plasmids were returned and transformed into Agrobacterium GV3101 (p19) (Shanghai Weidi Biotechnology Co., Ltd., Catalog No.: AC1003S). The transformation method is as follows: add 1 μL of plasmid to 100 μL of GV3101 (p19), place on ice for 5 min, liquid nitrogen for 5 min, 37°C water bath for 5 min, place on ice for 5 min, add non-antibiotic LB and place at 28°C for 2-3 h, then spread it on LB plates (containing 25 μg / ml rifampicin Rif, 50 μg / ml kanamycin Kan) to screen positive clones. After culturing at 28°C for 2 days, select a single clone in 2 ml LB medium (containing 25 μg / ml rifampicin Rif, 50 μg / ml kanamycin Kan) and culture overnight at 200 rpm. Amplify again according to the PCR method for detecting positive clones above, and after further confirming that the gene is correct, use it for genetic transformation.

[0129] Agrobacterium GV3101 (p19) (Shanghai Weidi Biotechnology Co., Ltd., catalog number: AC1003S) carrying the successfully constructed vector was used to genetically transform tomato materials. The specific genetic transformation steps are as follows:

[0130] (1) Obtaining sterile seedlings: Soak mature seeds in sterile water for 30 min, disinfect with 75% alcohol for 30 s, disinfect with sodium hypochlorite solution (effective chlorine is 2%) for 15 min, rinse with sterile water 5-6 times, and inoculate on 1 / 2 MS solid culture medium.

[0131] (2) Preparation of explants: The inoculated seeds will grow cotyledons in about a week. Take the newly unfolded cotyledons of the sterile seedlings, remove the two ends, cut them from the middle, and place them in the preculture medium for 24 hours.

[0132] (3) Propagation of Agrobacterium: Streak the positive glycerol bacteria on LB solid medium (containing 25 μg / ml rifampicin Rif, 50 μg / ml kanamycin Kan) for resistance screening. After culturing at 28°C for two days, pick a single clone and inoculate it into 5 ml LB liquid medium for activation. Cultivate overnight at 28°C and 220 rpm to an OD value of approximately 0.6. Collect the cells by centrifugation at 4000 rpm at 4°C for 10 min. Resuspend the collected cells in MS liquid medium and dilute them to an OD value of approximately 0.4 for use in transformation experiments.

[0133] (4) Agrobacterium infection and co-cultivation: immerse the pre-cultured explants in the resuspended Agrobacterium culture solution and shake gently for 5 min to make the incision contact with the culture solution as much as possible. Use sterile filter paper to absorb the surface culture solution and transfer the explants to MS co-culture medium for dark culture for 2-3 days.

[0134] (5) Bud induction and differentiation: After co-cultivation, the explants are transferred to a kanamycin-selected differentiation medium. Callus differentiation seedlings are formed in about 2 weeks and subcultured every two weeks.

[0135] (6) Rooting and resistant plant screening: When the resistant buds grow to 2-3 cm, cut the buds and transfer them to the rooting medium. When complete plantlets are formed, directly take samples for positive seedling detection, or transplant them into plug trays for cultivation and management depending on the root system, and then conduct positive seedling detection after true leaves grow.

[0136] Subsequently, the TRIzol method was used to extract RNA from tomato leaves. The specific steps are as follows: all consumables and reagents used in the experiment were RNAase-free. 50-100 mg of tomato leaves were placed in a 2 mL EP tube (sterilized steel balls were added in advance), and after quick freezing with liquid nitrogen for at least 10 min, they were placed in a low-temperature proofing box, the frequency was adjusted to 20-23, and proofing was performed for about 1 min until the sample was completely powdered; 1 mL of TRIzol solution was added, and the mixture was shaken up and down, and placed at room temperature for 10 min; 200 μL of chloroform was added, and the mixture was shaken up and down, placed on ice for 5 min, and centrifuged at 4°C, 12000 rpm, for 10 min; a new 1.5 mL EP tube was prepared, and the supernatant was taken to a new tube after centrifugation, and an equal volume of pre-cooled isopropanol was added, and the mixture was mixed upside down, and placed at -20°C for 30 min; after taking it out, it was centrifuged at 4°C, 12000 rpm, for 10 min; the supernatant was discarded, and 1 mL 75% ethanol, invert and suspend the precipitate, centrifuge at 4℃, 13000 rpm, 5 min; pour off the supernatant, centrifuge at 4℃, 13000 rpm, 5 min; suck away the remaining supernatant with a pipette tip, put the tube into a vacuum rotator, vacuum for 1-2 min, until dry; add DEPC-treated water according to the amount of RNA precipitate in each tube to re-dissolve the precipitate. NanoDrop detects the concentration and purity of the solution RNA, and the RNA is used for the next reverse transcription experiment or stored in a -80℃ refrigerator.

[0137] Subsequently, the RNA samples were reverse transcribed using the HiScript III RT SuperMix for qPCR (+gDNA wiper) kit as follows: Prepare the system: 4 × gDNA wiper Mix 4 μL, RNA 1.2 μg, RNase-free ddH2O to 16 μL. Mix by gently pipetting. Incubate at 42°C for 2 min. Add 5 × HiScript III qRT SuperMix 4 μL directly to the reaction tube in the previous step and mix by gently pipetting. Incubate at 37°C for 15 min, and 85°C for 5 sec.

[0138] qRT-PCR was performed using 2X M5 HiPer SYBR Premix EsTaq plus (with Tli RNaseH). The PCR system was as follows: 0.4 μL of each forward and reverse primer as shown in SEQ ID NO:9, SEQ ID NO:10, 2.5 μL of template cDNA, 10 μL of SYBR, and 6.7 μL of ddH2O. The standard two-step PCR amplification procedure was as follows: pre-denaturation at 95°C for 30 sec, cycle number: 1; PCR reaction at 95°C for 5 sec, 60°C for 30-34 sec, and cycle number: 40. Fluorescence quantitative PCR was performed using ACT as an internal reference and primer sequences as shown in SEQ ID NO:7, SEQ ID NO:8.

[0139] Actin-F (SEQ ID NO:7):TGGTCGGAATGGGACAGAAG.

[0140] Actin-R (SEQ ID NO:8): CTCAGTCAGGAGAACAGGGT.

[0141] SlGMAK-F (SEQ ID NO:9): CTCCTTCCTTCCCTGCAGAA.

[0142] SlGMAK-R (SEQ ID NO: 10): ACTAGGCTCGTCGTCATCTG.

[0143] According to the results of fluorescence quantitative PCR, AC tomato was used as the control, and its expression multiple was set to 1. The lines with high SlGMAK expression multiple (OE-1, 2, 3) were selected (such as Fig. 9 ) and SlGMAK knockout-silencing tomato lines (RNAi-1,2) (e.g. Fig.10 ) for phenotypic identification.

[0144] The cultivated tomato AC (Wild type, WT) and three overexpression strains (OE-1, 2, 3) with relatively high SlGMAK expression levels retained in the laboratory were inoculated with Botrytis cinerea (the pathogen of gray mold) as follows:

[0145] The sporangia of Botrytis cinerea cultured at 25°C for 10 to 14 days were collected. Botrytis cinerea was cultured in V8 agar medium. The obtained sporangia were centrifuged at 4°C, 5000 rpm, for 10 min, and the supernatant was removed. The precipitate was then diluted with Vogel buffer to a concentration of 5×10 5 / mL for future use.

[0146] Place 6 layers of moistened inoculation paper in the inoculation box tray, place the front of the tomato leaves of WT and OE-1, 2, and 3, and wrap the base with wet cotton to keep it moist. Drop 10 μL of Botrytis cinerea sporangium onto the tomato leaves and wrap the inoculation box with plastic wrap. Place it in a 24°C environment, culture it in the dark for 1 day, culture it in the light for 2 days, and take pictures on the 3rd day. Use ImageJ to circle the lesions infected by the pathogen and calculate their area. Use Prism software to draw graphs and statistically analyze the differences between groups.

[0147] The experimental results showed that compared with the control AC leaves, the gray mold spots of the SlGMAK overexpression lines (OE-1, 2, and 3) were significantly smaller, indicating that the SlGMAK overexpression lines had stronger resistance to gray mold (e.g. Fig. 9 as shown).

[0148] The same method was used to inoculate gray mold into tomato lines with SlGMAK interference silencing (RNAi-1,2) and tomato plants without SlGMAK silencing as controls (CK). After 3 days, the phenotypes were photographed and the size of the lesions was counted. The experimental results showed that compared with the control (CK), the gray mold lesions of tomato plants with SlGMAK silencing were significantly larger (e.g. Fig.10 as shown).

[0149] Example 5 SlGMAK positively regulates tomato resistance to gray mold

[0150] According to the method described in Example 4, cultivated tomato AC plants were inoculated with Botrytis cinerea (the pathogen of gray mold), and samples were collected after 1 hour, 12 hours, 24 hours, and 72 hours of infection. At the same time, uninoculated cultivated tomato AC plants were taken as controls (CK). Using the method described above, RNA from tomato leaves was extracted using TRIzol and reverse transcribed into cDNA. Fluorescence quantitative PCR (qPCR) was performed using primers shown in SEQ ID NOs: 7-10 to detect the expression level of SlGMAK (as shown in Fig.11 The results showed that the expression of SlGMAK was significantly induced by Botrytis cinerea. The specific induction multiples are shown in Table 2 below. In summary, the results showed that SlGMAK could positively regulate the biological process of tomato resistance to gray mold.

[0151] Table 2:

[0152]

[0153] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: the molecular markers and gene markers of the present application can further improve the accuracy and efficiency of the detection of tomato gray mold resistance, and further provide strong technical support for the genetic improvement of tomato disease resistance traits. Among them, the structural variation SV negatively regulates the resistance of tomatoes to gray mold, which can quickly locate germplasm resources with disease resistance potential and accelerate the breeding process of disease-resistant varieties. At the same time, through the overexpression and interference silencing of the SlGMAK gene, the mechanism of action of this gene in tomato gray mold resistance was deeply studied, providing a direct experimental basis for genetic engineering improvement.

[0154] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A molecular marker associated with resistance to tomato gray mold, characterized in that: The molecular marker is a 937 bp chromosome structural variation SV fragment on tomato chromosome 9, and the chromosome structural variation SV fragment has a nucleotide sequence as shown in SEQ ID NO: 1, or a nucleotide sequence with more than 90% homology to the nucleotide sequence.

2. Use of the molecular marker associated with tomato gray mold resistance as claimed in claim 1 in detecting and / or regulating tomato gray mold resistance.

3. The use according to claim 2, characterized in that: Detecting tomato gray mold resistance using the molecular marker includes: Using the genomic DNA of the tomato to be tested as a template, PCR amplification of the molecular marker is performed and electrophoresis identification is performed; When a band of 937 bp cannot be amplified, the tomato to be tested is resistant to tomato gray mold; When a band of 937 bp is obtained by amplification, the tomato to be tested has no resistance to tomato gray mold.

4. The use according to claim 3, characterized in that: The primers for PCR amplification of the molecular marker include: a forward primer as shown in SEQ ID NO:5 and a reverse primer as shown in SEQ ID NO:

6.

5. The use according to claim 2, characterized in that: Utilizing the molecular marker to regulate tomato gray mold resistance includes: Silencing or overexpressing the gene negatively regulated by the molecular marker in tomato materials; Wherein, the nucleotide sequence of the gene is shown as SEQ ID NO:

2.

6. The use according to claim 5, characterized in that: The overexpression includes: constructing an overexpression vector of the gene and transferring it into Agrobacterium to obtain a positive overexpression engineered bacterium; Infecting tomato materials with the positive overexpression engineering bacteria to culture transgenic seedlings to obtain overexpression positive seedlings; The overexpression positive seedlings are transplanted to obtain tomato plants resistant to tomato gray mold.

7. The use according to claim 5, characterized in that: The silence includes: Constructing an interference silencing vector of the gene and transferring it into Agrobacterium to obtain a positive gene silencing engineered bacterium; Infecting tomato materials with the positive gene silencing engineering bacteria to culture transgenic seedlings to obtain gene silencing positive seedlings; The gene silencing positive seedlings are transplanted to obtain tomato plants susceptible to tomato gray mold.

8. A kit for detecting resistance to tomato gray mold, characterized in that: The kit comprises primers for detecting the molecular markers associated with tomato gray mold resistance according to claim 1.

9. The kit according to claim 8, characterized in that The primers include: a forward primer as shown in SEQ ID NO:5 and a reverse primer as shown in SEQ ID NO:

6.

10. The kit according to claim 8, characterized in that The kit also includes: a DNA extraction kit and a PCR amplification kit.

Images