Molecular markers related to Botrytis cinerea resistance in tomato and their applications
By applying molecular markers of chromosomal structural variant SV fragments in tomatoes and regulating SlGMAK gene expression, the environmental problems caused by chemical pesticides to prevent and treat tomato gray mold were solved, and rapid screening and cultivation of disease-resistant plants were achieved, which improved breeding efficiency and safety.
Patent Information
- Application Number
- CN202510233656.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-28
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2045-02-28
AI Technical Summary
The prior art mainly relies on chemical pesticides in preventing and treating tomato gray mold, which leads to food safety and environmental pollution problems, and pathogens develop resistance, and lack effective gene regulation methods to enhance tomato resistance to gray mold.
A molecular marker based on the chromosome structural variant SV fragment of Tomato 9 chromosome 937bp is provided. Tomato grey mold resistance is detected by PCR amplification and electrophoresis identification, and tomato grey mold resistance is enhanced or weakened by regulating the expression of the SlGMAK gene, and disease-resistant plants are cultivated using gene silencing or overexpression technology.
It has achieved rapid and accurate screening and cultivation of tomato-resistant grey mold plants, improved breeding efficiency, reduced chemical pesticide use, and reduced environmental pollution, providing a direct experimental basis for gene editing.
Smart Images

Figure CN119710077B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology, and in particular, to a molecular marker related to tomato gray mold resistance and its application. Background Art
[0002] Tomato, as one of the most consumed vegetables globally, is widely cultivated. During tomato production, gray mold is a relatively serious fungal disease. Because of its early onset, long duration, and mainly harming fruits, it causes serious yield and economic losses both before and after tomato harvest. Currently, during the prevention and control of gray mold, most rely mainly on chemical control such as spraying chemical pesticides. This not only causes problems such as food safety and environmental pollution but also makes Botrytis cinerea (the pathogen of gray mold) develop serious drug resistance. Therefore, to solve the current dilemma, screening and cultivating high-quality, stable, and highly resistant tomato new varieties is an effective means to control gray mold.
[0003] Discovering and identifying genes involved in regulating tomato gray mold resistance is an important prerequisite for accelerating the development of new tomato disease-resistant varieties. Currently, many genes involved in regulating tomato resistance to gray mold have also been identified. For example, SlMPP6 positively regulates tomato resistance to gray mold. Overexpression of SlMPP6 enhances tomato resistance, while knockout of SlMPP6 makes tomato more susceptible to gray mold (such as patent application document CN114807220A). SlBBX20 negatively regulates tomato resistance to gray mold. Knockout of SlBBX20 significantly improves tomato disease resistance; the expression of SlBBX20 can be induced by Botrytis cinerea in both disease-resistant and susceptible tomato materials (such as patent application document CN112195186A).
[0004] Editing non-coding DNA sequences is a more precise gene regulation method. It can adjust the gene expression level without changing the protein-coding sequence, reduce side effects on other functions of the organism, and is relatively safe. However, in current research, most of the genes found to regulate tomato disease resistance are genes that can be encoded into proteins, rather than non-coding DNA sequences. Therefore, this application aims to provide a brand-new molecular marker or gene marker based on non-coding DNA sequences and related to tomato gray mold resistance to further provide technical support for the prevention and control of tomato gray mold resistance. Summary of the Invention
[0005] The main object of the present invention is to provide a molecular marker related to tomato gray mold resistance and its application to provide a new molecular marker related to tomato gray mold resistance.
[0006] To achieve the above object, according to the first aspect of the present invention, a molecular marker related to Botrytis cinerea resistance in tomatoes is provided. The molecular marker is a 937bp chromosomal structural variation SV fragment on chromosome 9 of tomatoes. The chromosomal structural variation SV fragment has a nucleotide sequence as shown in SEQ ID NO:1, or a nucleotide sequence having more than 90% homology with the nucleotide sequence.
[0007] To achieve the above object, according to the second aspect of the present invention, an application of the above-mentioned molecular marker related to Botrytis cinerea resistance in tomatoes in detecting and / or regulating Botrytis cinerea resistance in tomatoes is provided.
[0008] Furthermore, detecting Botrytis cinerea resistance in tomatoes using the molecular marker includes: using the genomic DNA of the tomato to be tested as a template, performing PCR amplification on the molecular marker and performing electrophoresis identification; when a 937bp band cannot be amplified, the tomato to be tested is resistant to Botrytis cinerea; when a 937bp band is amplified, the tomato to be tested is not resistant to Botrytis cinerea.
[0009] Furthermore, the primers for performing PCR amplification on the molecular marker include: a forward primer as shown in SEQ ID NO:5 and a reverse primer as shown in SEQ ID NO:6.
[0010] Furthermore, regulating Botrytis cinerea resistance in tomatoes using the molecular marker includes: silencing or overexpressing the gene negatively regulated by the molecular marker in tomato materials; wherein, the nucleotide sequence of the gene is as shown in SEQ ID NO:2.
[0011] Furthermore, overexpression includes: constructing an overexpression vector of the gene, and transferring it into Agrobacterium to obtain a positive overexpression engineering bacterium; infecting tomato materials with the positive overexpression engineering bacterium, culturing transgenic seedlings, and obtaining overexpression positive seedlings; transplanting the overexpression positive seedlings to obtain tomato plants resistant to Botrytis cinerea.
[0012] Furthermore, silencing includes: constructing an interfering silencing vector of the gene, and transferring it into Agrobacterium to obtain a positive gene silencing engineering bacterium; infecting tomato materials with the positive gene silencing engineering bacterium, culturing transgenic seedlings, and obtaining gene silencing positive seedlings; transplanting the gene silencing positive seedlings to obtain tomato plants susceptible to Botrytis cinerea.
[0013] To achieve the above object, according to the third aspect of the present invention, a kit for detecting Botrytis cinerea resistance in tomatoes is provided. The kit includes primers for detecting the above-mentioned molecular marker related to Botrytis cinerea resistance in tomatoes.
[0014] Furthermore, the primers include: a forward primer as shown in SEQ ID NO:5 and a reverse primer as shown in SEQ ID NO:6.
[0015] Furthermore, the kit further includes: a DNA extraction kit and a PCR amplification kit.
[0016] Applying the technical solution of the present invention, using a 937bp chromosomal structural variation SV on chromosome 9 of this application as a molecular marker for detecting the resistance of tomatoes to Botrytis cinerea can quickly distinguish the disease resistance of tomato materials, providing a powerful tool for tomato breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] The accompanying drawings forming a part of this application are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:
[0018] Figure 1 Shows the GWAS identification results in Example 1. The red box part is the most significant SV identified, located on chromosome 9;
[0019] Figure 2 Shows the phenotypes of wild and cultivated tomato materials after inoculation with Botrytis cinerea in Example 2. The upper layer is the disease-resistant tomato materials, and the lower layer is the disease-susceptible tomato materials. The scale bar is 1 cm;
[0020] Figure 3 Shows the DNA electrophoresis gel diagram of amplifying SV in different materials in Example 2. M is the DNA Marker. To the left of M is the tomato variety lacking SV, and to the right of M is the tomato variety with SV;
[0021] Figure 4 Shows the schematic diagram of the vector structure for transient transcriptional activity detection in Example 3;
[0022] Figure 5 Shows the fluorescence signal result diagram of transient transcriptional SV in Example 3;
[0023] Figure 6 Shows the quantitative analysis of the relative fluorescence activity of transient transcriptional SV in Example 3; Significance was analyzed by two-tailed Student's t test, ****P < 0.0001; Error bar, ± SEM (the number of biological replicates is 8);
[0024] Figure 7 Shows the schematic diagram of the overexpression vector structure of SlGMAK in Example 4, with the CaMV35S promoter and the OCS terminator. The resistance for screening plants is kanamycin;
[0025] Figure 8Shows the schematic diagram of the SlGMAK interference silencing vector structure in Example 4, with the CaMV35S promoter, OCS terminator, and the resistance for screening plants being kanamycin;
[0026] Figure 9 Shows the effect diagram of Botrytis cinerea infection of AC (WT) and SlGMAK overexpression materials in Example 5 (far left), with the scale bar being 1 cm; the result diagram of the relative expression level of SlGMAK (middle), using Actin as the internal reference, with the expression level of SlGMAK in AC (WT) being 1, and the significance analyzed by two-tailed Student’s t test, *P < 0.05, Error bar, ± SEM (the number of biological replicates is 3); the result diagram of the statistical analysis of the infection area (far right), using ImageJ to statistically analyze the size of the lesions in the figure, with the significance analyzed by two-tailed Student’s t test, *P < 0.05, **P < 0.01; ****P < 0.0001. Error bar, ± SEM (the number of biological replicates is 6);
[0027] Figure 10 Shows the effect diagram of Botrytis cinerea infection of the tomato plants with non-silenced SlGMAK as the control (CK) and SlGMAK-silenced materials RNAi-1, 2 in Example 5 (far left), with the scale bar being 1 cm; the result diagram of the relative expression level of SlGMAK (middle), using Actin as the internal reference, with the expression level of SlGMAK in AC (WT) being 1; the result diagram of the statistical analysis of the infection area (far right), using ImageJ to statistically analyze the size of the lesions in the figure, with the significance analyzed by two-tailed Student’s t test, ***P < 0.001; ****P < 0.0001. Error bar, ± SEM (the number of biological replicates is 5);
[0028] Figure 11 Shows the result diagram of the detection of the expression level of SlGMAK in the leaves inoculated with Botrytis cinerea and non-inoculated with Botrytis cinerea (CK) in Example 5. Using Actin as the internal reference, and taking the expression level of SlGMAK in the tomato leaves not inoculated with Botrytis cinerea at each time point as 1. The significance is analyzed by two-tailed Student’s t test. *P < 0.05; ****P < 0.0001; Error bar, ± SEM (the number of biological replicates is 3). Detailed implementation manners
[0029] It should be noted that, without conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present invention will be described in detail below with reference to the embodiments.
[0030] Glossary:
[0031] Chromosomal structural variation (SV): It refers to sequence changes or position changes in the genome that are longer than a certain threshold (usually 50bp or 1kb), including types such as large fragment insertions, deletions, duplications, inversions, and translocations. These variations may affect genome stability, gene dosage changes, or gene expression regulation.
[0032] As mentioned in the background art, the existing prevention and control methods for tomato gray mold mainly rely on chemical pesticides, which not only cause food safety and environmental pollution problems, but also prompt the pathogen to develop drug resistance. Therefore, this application aims to provide a new molecular marker capable of identifying tomato gray mold resistance, so as to provide new ideas for the prevention and control of tomato gray mold and tomato breeding in a rapid and simple manner.
[0033] In the first typical embodiment of this application, a molecular marker for detecting tomato gray mold resistance is provided. The molecular marker is a 937bp chromosomal structural variation SV fragment on tomato chromosome 9, and the chromosomal structural variation SV fragment has the nucleotide sequence shown in SEQ ID NO:1, or a nucleotide sequence with more than 90% homology to the nucleotide sequence.
[0034] SEQ ID NO:1:
[0035] ATTCTCATGCGGGATGGTAAGGTGATTTAATACGCATCAAGACAAGCAAAAATCCACGAAAAGAACTACCCTACTCACGATCTTGAGCTAGCCGCTGTTGTCTTTGTGTTGAAGATGTGGAGACATTATTTATATGGTGTACATGTTGATGTGTACACTAACCATAAGAGTCTTCTGTATGTACTCACGCAGAAGGAGTCTAATCTTCTTCAGAGAAGATAGCTAGACTTCTCAAGGATTATGAAATGAGTGTGTACGATCACACAGGTAAGGCCAATGTGGTGTCCAATGCATTTAGCAGACTGAGCATGGGCAGCGTTTCACATATTGATGGTGAGAAGAAGGAGCTGGCTAAAGAGGTGCACTAATTGGCAAGATTAGGTGTAAGACTGATAGACTCACCGAGTGGTGGTGTTTCAGTTCACTCAAGGTCTGAGTCCTCATTTGTTGTATATGTTAAAGACAATCAACACCTTGACCCAGTACTGATGGAGTTGAAAGAATTTGTATTGAGTAAGTTGAATGAGTCATTCTCGTTAAGTAGAGATAGCGTACTCAGATATAAGAACAGGTTATGTGTGCCTAATATGAATGAATTGAGGTCAAGTATTTTGCAGAAGGTCATGGTTACCGATATTCCATCCATCTAGGTGGCACCAAAATGTACCAAGACCTTAAAGAGGTCTATTGGTGGTAAGGAATGAAGAGACATATCTCTAAGTTCGTGGAGGAGTGTCCGAACTACCAACAGGTTAAGGCCGAACAACCTAAGCCTGGAGGTCTCACTCAGACGATTAAGATACCAACGTGGAAGTGGGAGGCTATCAATATATATTTTGTGGTTGTTTTGCCAAAGAATAAGAAACTACACGATTCCATTTTAGTTATTGTTAACAGAATTACCAAGTCCTCTCACTTCATACCTCTGAAGTCTACC。
[0036] By assembling and analyzing the tomato pan-genome, the applicant identified a structural variation (SV) related to tomato resistance to Botrytis cinerea, which negatively regulates tomato resistance to Botrytis cinerea. Using this molecular marker can quickly screen out tomato varieties with resistance to Botrytis cinerea, greatly shortening the cycle of judging resistance through phenotypic observation in traditional breeding, improving breeding efficiency, and further providing assistance for cultivating new tomato disease-resistant varieties by means such as gene editing in the later stage.
[0037] In the second typical embodiment of this application, there is provided an application of the above-mentioned molecular marker related to tomato resistance to Botrytis cinerea in detecting and / or regulating tomato resistance to Botrytis cinerea.
[0038] In a preferred embodiment, detecting tomato resistance to Botrytis cinerea using a molecular marker includes: using the genomic DNA of the tomato to be tested as a template, performing PCR amplification on the molecular marker and performing electrophoresis identification; when a 937bp band cannot be amplified, the tomato to be tested is resistant to Botrytis cinerea; when a 937bp band is amplified, the tomato to be tested is not resistant to Botrytis cinerea. This method is not only fast and accurate, but also low-cost, suitable for large-scale identification of tomato germplasm resources, and provides strong technical support for the genetic improvement of tomato disease-resistant traits.
[0039] To further avoid false positive results caused by non-specific amplification, in a preferred embodiment, the primers for PCR amplification of the molecular marker include: a forward primer as shown in SEQ ID NO:5 and a reverse primer as shown in SEQ ID NO:6.
[0040] SV-F (SEQ ID NO:5): AAGAAGGTTGAGGTAGTGAAGAAT.
[0041] SV-R (SEQ ID NO:6): AGCTTCACATGTGTACCCAAA.
[0042] In a preferred embodiment, regulating tomato resistance to Botrytis cinerea using a molecular marker includes: silencing or overexpressing the gene (SlGMAK gene) negatively regulated by the molecular marker in tomato materials; wherein, the nucleotide sequence of the gene is as shown in SEQ ID NO:2. The amino acid sequence of the protein encoded by the gene is as shown in SEQ ID NO:3.
[0043] The applicant further found that chromosomal structural variation SV can negatively regulate the expression of the gene SlGMAK upstream of it. This gene encodes a receptor kinase LRR-RLK rich in leucine repeats of the VIII subfamily, and the expression of this gene is induced by the infection of Botrytis cinerea. The applicant further analyzed the domain of the SlGMAK protein through the NCBI conserved domain prediction website (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi), and it is a transmembrane protein with two transmembrane regions. The N-terminal LRR repeat domain is the extracellular domain, and the C-terminal kinase domain is the intracellular part. Therefore, by regulating the expression of the SlGMAK gene, the resistance of tomatoes to gray mold can be artificially enhanced or weakened, opening up a new way for the biological control of tomato diseases.
[0044] SEQ ID NO:2:
[0045]
[0046] SEQ ID NO:3:
[0047] MTRFRYFIYVFAAVIHCYMLLVAAQTTEPSEVSALISVKGSLIDNMKHLNNWKRGDPCTSHWTGVFCNISDADGYLHVRELRFMNMNLSGSLSPELGQLSHLQILNFMWNNLSGSIPKEIGSITTLKLLLLNGNQLTGSLADELGNLSNLNRFQIDQNEISGEIPKSFANLNKIRHIHFNNNSLSGQIPHELSNLSTILHLLLDNNNLSGYLPTEFSALADLAILQLDNNNFSGSEIPASYGNLSSLLKLSVRNCSLEGSIPDFSRIANLSYLDLSWNQLSGSIPQNKLSNNMTTIILSHNRLNGSVPKNFSLLPSLQKLSLENNFLNGSVSTDIWQNKIFNTTSRLVIDLRNNSVSNISGAFEPPVNVTLRFQSNPICSSTSIRNIGKYCGPDIGADDDEPSNSTNPTGVCPIHACPTDNYYEYVPASPKPCFCASPLRIGYRLKSPSISYFDPYKQLFESYVTSSLQLDLYQLWIDSFFWEKGPRLRMYLKLFPVVGNNTFNESEILRISEIFASWEFRGSHLFGPYELLNFTLLGPYSHLNPEIKGKKQSKGVVIAFIVAAGAFAAFVSSIVTLLITRRRAKYQNILSRKRLSSSLSIKVDGVKSFTFREMASATNNFDTSTQVGEGGYGSVFRGILADKTIVAIKRAKVGSLQGQKEFLTEIELLSRLHHRNLVVLLGYCDEEGEQMLIYEFMPNGTLRDWLSAKCKKKLKFGARLGIALGASKGILYLHTEADPPIFHRDIKASNILLDSKLTAKVADFGLSRLAPVQDDEGLLPNHVSTMVKGTPGYLDPEYFLTRKMTDKSDVYSLGVVFLEILTGMHPISHGKNIVREVKIAHKSGVMFSIMDKSMGSYPSECAERLMELALKCCQDKPEDRPSMLEVVRTLETTVQMMPYTDTDPLDNKASFSESTSSASFSNTRSGDLFMSSSNVSGGDLISGVTLNITPR。
[0048] In a preferred embodiment, overexpression includes: constructing an overexpression vector of the gene and transferring it into Agrobacterium to obtain a positive overexpression engineering bacterium; infecting tomato materials with the positive overexpression engineering bacterium and culturing transgenic seedlings to obtain overexpression positive seedlings; transplanting the overexpression positive seedlings to obtain tomato plants resistant to Botrytis cinerea. The operation of using the SlGMAK gene for breeding tomato plants resistant to Botrytis cinerea can obtain tomato plants with stable phenotypes resistant to Botrytis cinerea, which provides strong support for subsequent research on Botrytis cinerea of tomatoes.
[0049] In a preferred embodiment, silencing further includes: constructing an interfering silencing vector of the gene and transferring it into Agrobacterium to obtain a positive gene silencing engineering bacterium; infecting tomato materials with the positive gene silencing engineering bacterium and culturing transgenic seedlings to obtain gene silencing positive seedlings; transplanting the gene silencing positive seedlings to obtain tomato plants susceptible to Botrytis cinerea. Through the gene silencing technology, the effect of SlGMAK gene deletion on the resistance of tomatoes to Botrytis cinerea can be studied, further revealing the specific role of this gene in disease defense and providing a powerful tool for gene function research.
[0050] In a preferred embodiment, the overexpression vector constructed for the SlGMAK gene is pHELLSGATE8 (as Figure 7 shown), which is modified by excising the PDK intron from the initial vector pHELLSGATE8 (as Figure 8 shown).
[0051] In a preferred embodiment, the interfering silencing vector constructed for the SlGMAK gene is pHELLSGATE8 (as Figure 8 shown).
[0052] In the third typical embodiment of the present application, a kit for detecting the resistance of tomatoes to Botrytis cinerea is provided. The kit includes primers for detecting the above-mentioned molecular markers related to the resistance of tomatoes to Botrytis cinerea. The development of the kit makes molecular marker detection more convenient. Without the need for complex laboratory equipment, rapid detection can be carried out in the field or in a small laboratory, greatly promoting the popularization and application of tomato disease-resistant breeding.
[0053] In order to further improve the accuracy and reliability of the kit detection, in a preferred embodiment, the primers include: a forward primer as shown in SEQ ID NO:5 and a reverse primer as shown in SEQ ID NO:6. In a preferred embodiment, the kit further includes: a DNA extraction kit and a PCR amplification kit.
[0054] The following further describes the present application in detail with specific embodiments, which should not be construed as limiting the scope claimed by the present application.
[0055] The wild tomato variety materials S. galapagense, S. cheesmaniae, S. pennellii, S. chmielewskii, S. habrochaites, S. arcanum, and S. neorickii are from the Tomato Genetic Resource Center in the United States, and the cultivated tomato material S. lycopersicum is from the laboratory's stock. The above eight tomato materials involved in this application have been disclosed in the literature "Fenstemaker, S.; Sim, L.; Cooperstone, J.; Francis, D., Solanum galapagense-derived purple tomato fruit color is conferred by novel alleles of the anthocyanin fruit and atroviolacium loci. Plant Direct 2022, 6 (4), e394", and the public can obtain them from the laboratory of David Francis in the Department of Horticulture and Crop Science at The Ohio State University or the laboratory where the applicant is located. The above materials can only be used for repeating the experiments related to this invention and cannot be used for other purposes.
[0056] Nicotiana benthamiana, with the Latin name Nicotiana benthamiana., is from the laboratory's stock.
[0057] The tested tomatoes and tobacco were all grown in a greenhouse with a temperature of 25°C, a humidity of 50%, and a photoperiod of 16 h light / 8 h darkness.
[0058] V8 agar medium: 36% V8 juice, 0.1% CaCO3, and 2% Bacto agar.
[0059] In Vogel buffer: In a 1 L system, the components are: 15 g of sucrose, 3 g of sodium citrate, 5 g of K2HPO4, 0.2 g of MgSO4·7H2O, 0.1 g of CaCl2·2H2O, and 2 g of NH4NO3.
[0060] Transient transformation buffer: 10 mM MES, 10 mM MgCl2, 150 μM acetosyringone.
[0061] LB medium (1 L): 10 g of NaCl, 5 g of yeast extract, 10 g of tryptone.
[0062] LB plate (1 L): 10 g of NaCl, 5 g of yeast extract, 10 g of tryptone, and Agar is added at 15 g / L to prepare a solid medium.
[0063] Lysis buffer: from the Dual-Luciferase® Reporter Assay Kit (Yeasen Biotech Co., Ltd., Catalog No.: 11402ES).
[0064] 1 / 2 MS solid medium (1 L): 2.2 g of Murashige & Skoog Basal Salt Mixture, 0.5 g of MES. Adjust the pH to 5.8 with KOH. Add Agar at 10 g / L to prepare the solid medium.
[0065] MS liquid medium (1 L): 4.4 g of Murashige & Skoog Basal Salt Mixture, 1 g of MES. Adjust the pH to 5.8 with KOH.
[0066] Induction and differentiation medium: 5 g of Murashige & Skoog Basal Salt Mixture + 0.05 mg / L of auxin + 1.0 mg / L of 6-benzylaminopurine + 3% sucrose (adjust the pH to 5.8 with KOH).
[0067] MS co-culture medium: 4.4 g of Murashige & Skoog Basal Salt Mixture, 1 g of MES. Adjust the pH to 5.8 with KOH. Add Agar at 10 g / L to prepare the solid medium.
[0068] Rooting medium: 1 / 2MS + 0.1 mg / L of 1-naphthylacetic acid + 0.5 mg / L of auxin-like phytohormone IBA (adjust the pH to 5.8 with KOH).
[0069] Example 1 Obtaining Structural Variation SV Related to Tomato's Defense Against Botrytis cinerea
[0070] This example provides a method for obtaining molecular markers related to tomato's resistance to Botrytis cinerea. The specific operation steps are as follows:
[0071] Use EMMAX (v20100307)100 software to perform GWAS analysis on 58,643 high-confidence SVs and the Botrytis cinerea lesions of 209 tomato materials, and screen out 16 significant loci. One of the most significant loci (as Figure 1 shown in the red box) was found to be a structural variation with a size of 937 bp at 33,687,177 on chromosome 9 after viewing the genome (as Figure 1 shown). The GWAS results were calculated by the R software package qqman (https: / / github.com / stephenturner / qqman).
[0072] Example 2 SV-based Molecular Marker for Botrytis cinerea Resistance in Tomato and Its Identification Method
[0073] (1)Inoculation of Botrytis cinerea on Each Tomato Variety Material and Phenotypic Observation
[0074] Preparation of Botrytis cinerea (the pathogen of Botrytis cinerea) inoculum: Collect the sporangia of Botrytis cinerea cultured at 25°C for 10 to 14 days. Botrytis cinerea is cultured in V8 agar medium. The obtained sporangia are centrifuged at 4°C, 5000 rpm for 10 min, and the supernatant is removed. Then, the precipitate is diluted with Vogel buffer to dilute the concentration of sporangia to 5×10 5 cells / mL for standby.
[0075] Inoculation identification: Place 6 layers of moist inoculation paper in the inoculation box tray. Place the tomato leaves of wild and cultivated varieties (variety information is shown in Table 1 below) face up and wrap the base with wet cotton for moisturizing. After dropping 10 μL of the above-mentioned diluted and standby Botrytis cinerea sporangia onto the tomato leaves to complete inoculation, wrap the inoculation box with plastic wrap, place it in an environment of 24°C, and culture it in the dark for 1 day and in the light for 2 days. On the 3rd day, photograph the size of the leaf lesions and analyze the Botrytis cinerea resistance phenotype. The results are as Figure 2 shown.
[0076] (2)SV-based Molecular Marker for Botrytis cinerea Resistance in Tomato and Identification Method
[0077] The nucleotide sequence of the SV variation screened in Example 1 is shown in SEQ ID NO:1. According to its nucleotide sequence, upstream and downstream primers for amplifying the SV sequence are designed, as shown in SEQ ID NO:5 and SEQ ID NO:6 respectively.
[0078] SV-F (SEQ ID NO:5): AAGAAGGTTGAGGTAGTGAAGAAT.
[0079] SV-R (SEQ ID NO:6): AGCTTCACATGTGTACCCAAA.
[0080] Extract the genomic DNA of each inoculated tomato material in the above step (1) (as shown in Table 1 below), and amplify SV according to the forward and reverse primer sequences shown in SEQ ID NO: 5-6. Among them, the PCR reaction system is as follows: 2 μL of each of the forward primer and the reverse primer, 1 μL of the gDNA template, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, 1 μL of dNTP, 25 μL of 2 × Phanta Max Buffer, and ddH2O is added to make up to 50 μL. The PCR amplification program is: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 1 min, final extension at 72°C for 5 min. 34 cycles. The amplification result is as Figure 3 shown.
[0081] (3)Comparison of the identification results between the molecular marker of Botrytis cinerea resistance in tomatoes based on SV and phenotypic observation
[0082] Comparison Figure 2 、 3 and Table 1 below show that the SV sequence cannot be amplified in tomatoes highly resistant to Botrytis cinerea, indicating that SV is absent in the tomato materials highly resistant to Botrytis cinerea (as shown in Table 1 below). The SV sequence can be amplified in tomatoes susceptible to Botrytis cinerea (as shown in Table 1 below), indicating that there is an SV insertion in susceptible tomatoes (as Figure 3 shown).
[0083] It can be seen from this that the identification method of the molecular marker of Botrytis cinerea resistance in tomatoes based on SV is to use the genomic DNA of the tomato to be tested as a template, perform PCR amplification on the molecular marker and perform electrophoresis identification; when the amplification primer cannot amplify the 937bp band, the tomato to be tested is resistant to Botrytis cinerea; when the 937bp band is amplified, the tomato to be tested is not resistant to Botrytis cinerea, that is, the presence of SV inhibits the disease resistance of tomatoes.
[0084] Table 1:
[0085]
[0086] Example 3 Analysis of the transcriptional regulation effect of structural variation SV on its upstream gene
[0087] A gene sequence of 2,856 bp that can encode a protein was found 63,551 bp upstream of the structural variation SV. Its sequence is shown in SEQ ID NO:2, and it translates into 952 amino acids as shown in SEQ ID NO:3, a protein with a size of 105 kDa, which was named SlGMAK. By searching through BLAST in NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), it was found that the SlGMAK protein is annotated as a serine / threonine protein kinase that may be rich in leucine-rich repeats (LRR).
[0088] To detect whether SV has a certain regulatory effect on SlGMAK, the SlGMAK promoter sequence (pGMAK, 2,001 bp in length) was obtained from the tomato gene database (https: / / solgenomics.sgn.cornell.edu / ), as shown in SEQ ID NO:4. The pGreenII 0800-pGMAK-LUC vector and the pGreenII 0800-pGMAK-LUC-SV vector were constructed respectively (as Figure 4 shown), and the specific operations are described as follows:
[0089] The pGMAK fragment with the homologous arms of the pGreenII 0800-LUC vector was amplified by PCR using SEQ ID NO:17 and SEQ ID NO:18 as forward and reverse primers respectively. Subsequently, the pGreenII 0800-LUC vector digested with KpnI and BamHI was fused with the pGMAK fragment containing the homologous arms of this vector, and the pGreenII0800-pGMAK-LUC vector was constructed using a homologous recombination enzyme (Novoprotein, product number C116-02).
[0090] pSlGMAK-LUC-F (SEQ ID NO:17):
[0091] ACTATAGGGCGAATTGGGTACCTGTTGTTGCATTAGTAAA.
[0092] pSlGMAK-LUC-R (SEQ ID NO:18):
[0093] CCGCTCTAGAACTAGTGGATCCCTTGAAGACCTAGAAACA.
[0094] The amplification system is as follows: 2 μL of each of the forward primer and the reverse primer, 1 μL of the gDNA template, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, 1 μL of dNTP, 25 μL of 2 × Phanta Max Buffer, and made up to 50 μL with ddH2O. The PCR amplification program is as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 1 min 30 s, final extension at 72°C for 5 min. 34 cycles.
[0095] Using SEQ ID NO:19 and SEQ ID NO:20 as the forward and reverse primers to perform PCR amplification on the pGreenII 0800-pGMAK-LUC vector, using SEQ ID NO:21 and SEQ ID NO:22 as the forward and reverse primers to perform PCR amplification on the SV sequence, and performing homologous recombination on pGreenII0800-pGMAK-LUC and SV to construct the pGreenII 0800 -pGMAK -LUC-SV vector. The specific amplification method is as described above.
[0096] pSlGMAK -LUC-SV-F1 (SEQ ID NO:19):
[0097] TACCTCTGAAGTCTACCTTCTAGAGAATTCGCTGAAATC.
[0098] pSlGMAK -LUC-SV-R1 (SEQ ID NO:20):
[0099] CTTACCATCCCGCATGAGAATTTACACGGCGATCTTTC.
[0100] pSlGMAK -LUC-SV-F2 (SEQ ID NO:21):
[0101] GAAAGATCGCCGTGTAAATTCTCATGCGGGATGGTAAG.
[0102] pSlGMAK -LUC-SV-R2 (SEQ ID NO:22):
[0103] GATTTCAGCGAATTCTCTAGAAGGTAGACTTCAGAGGTA.
[0104] SEQ ID NO:4:
[0105]
[0106] The above vector was transformed into Agrobacterium tumefaciens GV3101 (p19) (Shanghai Weidi Biotechnology Co., Ltd., catalog number: AC1003S). After culturing at 28 °C for 2 days, monoclonal colonies were selected and cultured overnight at 200 rpm in 2 ml of LB medium (containing 25 μg / ml rifampicin Rif and 50 μg / ml kanamycin Kan). The next day, they were inoculated into 50 ml of LB medium (containing 25 μg / ml rifampicin Rif and 50 μg / ml kanamycin Kan) at a ratio of 1:100. The cells were collected by centrifugation at 5000 rpm for 10 min, resuspended in transient transformation buffer, and the OD value was adjusted to about 1.0, followed by dark treatment for 3 h.
[0107] Agrobacterium tumefaciens GV3101 carrying pGMAK-LUC and pGMAK-LUC-SV were respectively injected into tobacco leaves that were one month old. After 24 h in the dark, they were placed in the light for 24 h, and 470 μM potassium salt was injected, and then observed for fluorescence signals under a CDD camera (as Figure 5 shown). The results showed that the fluorescence signal of pGMAK-LUC-SV was significantly lower than that of pGMAK-LUC.
[0108] Subsequently, tobacco samples were collected, 100 μL of lysis buffer was added, and incubated on ice for about 5 min to fully lyse the leaves. Centrifuged at 10000 - 16000 rpm for 1 min, and the supernatant was taken, which was the total plant protein. 20 μL of the extracted plant total protein was added to the culture plate. The firefly luciferase reaction working solution and the Renilla luciferase reaction solution were prepared, that is, the firefly luciferase substrate (50×) and the Renilla luciferase substrate (50×) (from the Dual-Luciferase Reporter Assay Kit, Yeasen Biotech Co., Ltd., catalog number: 11402ES) were respectively diluted to 1× working solution with the corresponding buffer. And incubated to room temperature. 100 μL of the firefly luciferase reaction solution was added to the above culture plate, shaken to mix evenly, and the activity of firefly luciferase was detected using a luminometer GloMax® Discover (Promega). Then 100 μL of the Renilla luciferase reaction solution was added to the above culture plate, shaken to mix evenly, and the activity of Renilla luciferase was detected again using a luminometer GloMax® Discover (Promega). By calculating the relative fluorescence activity (the ratio of LUC to REN), Prism software was used to plot the graph and statistically analyze the differences between groups. The results showed that SV could significantly inhibit the transcription of SlGMAK, that is, negatively regulate the expression of SlGMAK (as Figure 6 shown).
[0109] Example 4 Construction of SlGMAK Expression Vector and Genetic Material
[0110] Primers were designed through the tomato gene database (https: / / solgenomics.sgn.cornell.edu / ), and the forward and reverse primer sequences are shown as SEQ ID NO:11 and SEQ ID NO:12. The amplified gene sequence of SlGMAK is shown as SEQ ID NO:2. The vector pHELLSGATE8 (reserved after being modified in the laboratory) was digested with ECORI for constructing the SlGMAK overexpression vector. The schematic diagram of the vector structure is as Figure 7 shown.
[0111] OE- SlGMAK-F (SEQ ID NO:11):
[0112] GATGACGATGACAAGGAATTCATGACGCGGTTCAGATATTTTATATAT.
[0113] OE- SlGMAK-R (SEQ ID NO:12):
[0114] GTCCTTGTAATCCATGAATTCACGAGGTGTAATATTAAGGGTAACA.
[0115] The PCR amplification system is as follows: 2 μL of each upstream and downstream primer, 1 μL of cDNA template, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, 1 μL of dNTP, 25 μL of 2 × Phanta Max Buffer, and supplemented with ddH2O to 50 μL. The PCR amplification program is: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 2 min, final extension at 72°C for 5 min. 34 cycles.
[0116] Forward and reverse primers SEQ ID NO:13-16 were designed to amplify the SlGMAK gene by the above PCR method. pHELLSGATE8 was digested with XbaI and XholI for constructing the SlGMAK interference silencing vector. The schematic diagram of the vector structure is as Figure 8 shown.
[0117] RNAi -SlGMAK-F1 (SEQ ID NO:13):
[0118] TTTCATTTGGAGAGGACACGCTCGAGGACGCTAGAAACCACAGTCCAAATG.
[0119] RNAi - SlGMAK - R1 (SEQ ID NO:14):
[0120] CAAGCTGGGGTACCGAATTCCTCGAGGTCACACTACATACATAAATCTAGAAGCAG.
[0121] RNAi - SlGMAK - F2 (SEQ ID NO:15):
[0122] AAATCGATAAGCTTGGATCCTCTAGAGTCACACTACATACATAAATCTAGAAGCAG.
[0123] RNAi - SlGMAK - R2 (SEQ ID NO:16):
[0124] ATATCTCATTAAAGCAGGACTCTAGAGACGCTAGAAACCACAGTCCAAATG.
[0125] Recover the above vectors and fragments using 1.0% agarose gel, use the Omaga gel recovery kit for recovery, detect the concentrations of the recovered gene fragments and vector size fragments using NanoDrop, mix the cloned fragments and vectors at a ratio of 3:1, add 10 μL of 2xCE recombinase, add ddH2O to 20 μL, and ligate at 50°C for 20 min.
[0126] Transform the ligation product into Escherichia coli DH5α, and screen for positive clones on a kanamycin - resistant plate. Culture the positive clones in 200 μL of kanamycin - containing LB, PCR - amplify the pHELLSGATE8 - OE - SlGMAK monoclonal using the 35S primer and the primer shown in SEQ ID NO:12, and PCR - amplify the pHELLSGATE8 - RNAi - SlGMAK monoclonal using the 35S primer and the primer shown in SEQ ID NO:16 to obtain positive monoclonal clones.
[0127] The PCR amplification method is as follows: 1 μL of each upstream and downstream primer, 10 μL of DNA Polymerase, 1 μL of bacterial solution as template, and make up to 20 μL with ddH2O. The PCR amplification program is: pre - denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 2 min, final extension at 72°C for 5 min. 34 cycles.
[0128] Send the correctly detected clones to the company for testing. After correct sequencing, return the plasmid and transfer the plasmid into Agrobacterium tumefaciens GV3101 (p19) (Shanghai Weidi Biotechnology Co., Ltd., product number: AC1003S). The transformation method is as follows: Add 1 μL of the plasmid to 100 μL of GV3101 (p19), place it on ice for 5 min, in liquid nitrogen for 5 min, in a water bath at 37 °C for 5 min, on ice for 5 min, add antibiotic-free LB and incubate at 28 °C for 2 - 3 h, then coat it on an LB plate (containing 25 μg / ml rifampicin Rif and 50 μg / ml kanamycin Kan) to screen for positive clones. After culturing at 28 °C for 2 days, select a monoclonal colony and inoculate it into 2 ml of LB medium (containing 25 μg / ml rifampicin Rif and 50 μg / ml kanamycin Kan), and culture it overnight at 200 rpm. Amplify again by the above PCR method for detecting positive clones. After further confirming that the gene is correct, reserve it for genetic transformation.
[0129] Use Agrobacterium tumefaciens GV3101 (p19) (Shanghai Weidi Biotechnology Co., Ltd., product number: AC1003S) carrying the successfully constructed vector to perform genetic transformation on tomato materials. The specific genetic transformation steps are as follows:
[0130] (1) Obtaining of sterile seedlings: Soak mature seeds in sterile water for 30 min, disinfect with 75% alcohol for 30 s, disinfect with sodium hypochlorite solution (effective chlorine is 2%) for 15 min, rinse with sterile water 5 - 6 times, and inoculate on 1 / 2 MS solid medium.
[0131] (2) Preparation of explants: Cotyledons will grow about one week after inoculating the seeds. Take the newly expanded cotyledons of the sterile seedlings, remove both ends, cut them into sections from the middle part and place them in the pre-culture medium for 24 h.
[0132] (3) Agrobacterium propagation: Streak the positive glycerol bacteria on the LB solid medium (containing 25 μg / ml rifampicin Rif and 50 μg / ml kanamycin Kan) resistance screening medium. After culturing at 28 °C for two days, pick a monoclonal colony and inoculate it into 5 ml of LB liquid medium for activation. Culture it overnight at 28 °C and 220 rpm until the OD value is about 0.6. Centrifuge at 4 °C and 4000 rpm for 10 min to collect the bacteria. Resuspend the collected bacteria with MS liquid medium and dilute it to an OD value of about 0.4 for the transformation experiment.
[0133] (4) Agrobacterium infection and co-culture: Immerse the pre-cultured explants in the resuspended Agrobacterium liquid, gently shake for 5 min to make the cut surface contact the bacterial liquid as much as possible, blot the surface bacterial liquid with sterile filter paper, and transfer it to the MS co-culture medium for dark culture for 2 - 3 days.
[0134] (5) Bud induction and differentiation: After co-culture, transfer the explants to the induction and differentiation medium screened with kanamycin. Callus-differentiated seedlings will form in about 2 weeks, and subculture once every two weeks.
[0135] (6) Rooting and screening of resistant plants: When the resistant buds grow to 2 - 3 cm, cut the buds and transfer them to the rooting medium. When complete small plants are formed, directly sample for positive seedling detection, or transplant them into plug trays according to the root situation for cultivation management, and then conduct positive seedling detection after true leaves grow.
[0136] Subsequently, extract the RNA of tomato leaves using the TRIzol method. The specific steps are as follows: All consumables and reagents used in the experiment are RNAase-free. Take 50 - 100 mg of tomato leaves and place them in a 2 mL EP tube (sterilized steel beads added in advance). After quick-freezing in liquid nitrogen for at least 10 min, put it into a low-temperature sample grinder, adjust the frequency to 20 - 23, and grind for about 1 min until the sample is completely powdered; add 1 mL of TRIzol solution, shake well up and down, and place at room temperature for 10 min; add 200 μL of chloroform, shake well up and down, place on ice for 5 min, centrifuge at 4℃, 12000 rpm for 10 min; prepare a new 1.5 mL EP tube, take the supernatant after centrifugation and transfer it to the new tube, add an equal volume of pre-cooled isopropanol, invert and mix well, and place at -20℃ for 30 min; take it out and centrifuge at 4℃, 12000 rpm for 10 min; pour out the supernatant, add 1 mL of 75% ethanol to each tube, invert to suspend the precipitate, centrifuge at 4℃, 13000 rpm for 5 min; pour out the supernatant, centrifuge at 4℃, 13000 rpm for 5 min; aspirate the remaining supernatant with a pipette tip, put the tube into a vacuum rotary evaporator, and vacuum for 1 - 2 min until dry; dissolve the precipitate by adding DEPC-treated water according to the amount of RNA precipitate in each tube. Use NanoDrop to detect the concentration and purity of the RNA solution. The RNA is used for the next reverse transcription experiment or stored in an -80℃ refrigerator.
[0137] Subsequently, use the HiScript III RT SuperMix for qPCR (+gDNA wiper) kit to reverse transcribe the RNA samples. The specific method is as follows: Prepare the system: 4 × gDNA wiper Mix 4 μL, RNA 1.2 μg, RNase-free ddH2O to 16 μL. Gently pipette and mix well. Incubate at 42℃ for 2 min. Directly add 4 μL of 5× HiScript III qRT SuperMix to the reaction tube in the previous step, and gently pipette and mix well. Incubate at 37℃ for 15 min, 85℃ for 5 sec.
[0138] qRT-PCR was performed using 2X M5 HiPer SYBR Premix EsTaq plus (with Tli RNaseH), and the PCR system was as follows: 0.4 μL of each forward and reverse primer as shown in SEQ ID NO:9 and SEQ ID NO:10, 2.5 μL of template cDNA, 10 μL of SYBR, and 6.7 μL of ddH2O. The standard two-step PCR amplification procedure: pre-denaturation at 95°C for 30 sec, number of cycles: 1; PCR reaction at 95°C for 5 sec, 60°C for 30 - 34 sec, number of cycles: 40. Using ACT as an internal reference, fluorescence quantitative PCR was performed with primer sequences as SEQ ID NO:7 and SEQ ID NO:8.
[0139] Actin-F (SEQ ID NO:7): TGGTCGGAATGGGACAGAAG.
[0140] Actin-R (SEQ ID NO:8): CTCAGTCAGGAGAACAGGGT.
[0141] SlGMAK-F (SEQ ID NO:9): CTCCTTCCTTCCCTGCAGAA.
[0142] SlGMAK-R (SEQ ID NO:10): ACTAGGCTCGTCGTCATCTG.
[0143] According to the results of fluorescence quantitative PCR, using AC tomatoes as a control with the expression fold set to 1, select the lines with high SlGMAK expression fold (OE-1, 2, 3) (as Figure 9 ) and the tomato lines with SlGMAK interference silencing (RNAi-1, 2) (as Figure 10 ) for phenotypic identification.
[0144] For the cultivated tomato AC (Wild type, WT) and 3 overexpression lines (OE-1, 2, 3) with relatively high SlGMAK expression levels retained in the laboratory, inoculate with Botrytis cinerea (the pathogen of gray mold), and the specific method is as follows:
[0145] Collect the sporangia of Botrytis cinerea cultured at 25°C for 10 to 14 days. Botrytis cinerea was cultured in V8 agar medium. The obtained sporangia were centrifuged at 4°C, 5000 rpm for 10 min, and the supernatant was removed. Then, the precipitate was diluted with Vogel buffer to dilute the concentration of sporangia to 5×10 5 cells / mL for standby.
[0146] Place 6 layers of moistened inoculation paper in the inoculation box tray. Place the front sides of the tomato leaves of WT and OE-1, 2, 3, and wrap the bases with wet cotton for moisture retention. Drop 10 μL of Botrytis cinerea sporangia onto the tomato leaves, and wrap the inoculation box with plastic wrap. Place it in an environment at 24°C, culture it in the dark for 1 day, and then culture it under light for 2 days. Take pictures of the phenotypes on the 3rd day. Use ImageJ to circle the lesions infected by the pathogen and calculate their areas, and use Prism software to plot graphs and statistically analyze the differences between groups.
[0147] The experimental results showed that compared with the control AC leaves, the Botrytis cinerea lesions of the SlGMAK overexpression lines (OE-1, 2, 3) were significantly smaller, indicating that the SlGMAK overexpression lines had stronger resistance to Botrytis cinerea (as Figure 9 shown).
[0148] Inoculate Botrytis cinerea on the tomato lines with SlGMAK interference silencing (RNAi-1, 2) and the tomato plants without SlGMAK silencing as the control (CK) in the same method as above. Take pictures of the phenotypes and statistically analyze the lesion sizes after 3 days. Analyzing the experimental results, it was found that the Botrytis cinerea lesions of the tomato plants with SlGMAK silencing were significantly larger than those of the control (CK) (as Figure 10 shown).
[0149] Example 5 SlGMAK Positively Regulates Tomato Resistance to Botrytis cinerea
[0150] Inoculate the cultivated tomato AC plants according to the method of inoculating Botrytis cinerea (the pathogen of Botrytis cinerea) described in Example 4. Collect samples after 1 h, 12 h, 24 h, and 72 h of infection, and take the non-inoculated cultivated tomato AC plants as the control (CK) at the same time. Use TRIzol to extract the RNA of tomato leaves and reverse transcribe it into cDNA using the method described above. Perform fluorescence quantitative PCR (qPCR) with the primers shown in SEQ ID NO: 7-10 to detect the expression level of SlGMAK (as Figure 11 shown). The results showed that the expression of SlGMAK was significantly induced by Botrytis cinerea. The specific induction multiples are shown in Table 2 below. In summary, the results showed that SlGMAK can positively regulate the biological process of tomato resistance to Botrytis cinerea.
[0151] Table 2:
[0152]
[0153] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: Using the molecular markers and gene markers of the present application can further improve the accuracy and efficiency of detecting the resistance of tomatoes to Botrytis cinerea, and further provide strong technical support for the genetic improvement of tomato disease-resistant traits. Among them, the structural variation SV negatively regulates the resistance of tomatoes to Botrytis cinerea, can quickly locate germplasm resources with disease-resistant potential, and accelerate the breeding process of disease-resistant varieties. At the same time, through the overexpression and interference silencing of the SlGMAK gene, the mechanism of action of this gene in the resistance of tomatoes to Botrytis cinerea was deeply studied, providing a direct experimental basis for genetic engineering improvement.
[0154] The foregoing is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A molecular marker related to tomato gray mold resistance, characterized in that, The molecular marker is a 937-bp chromosomal structural variation SV fragment on chromosome 9 of tomato, and the chromosomal structural variation SV fragment is a nucleotide sequence shown in SEQ ID NO:
1.
2. Use of the molecular marker related to Botrytis cinerea resistance in tomato according to claim 1 in detecting and / or regulating Botrytis cinerea resistance in tomato, characterized in that, Using the molecular marker to detect the resistance of tomato to Botrytis cinerea is to perform PCR detection using the molecular marker; Using the molecular marker to regulate the resistance of tomato to Botrytis cinerea is to silence or overexpress the gene negatively regulated by the molecular marker; The primers for PCR amplification of the molecular marker include: a forward primer shown in SEQ ID NO: 5 and a reverse primer shown in SEQ ID NO: 6; The nucleotide sequence of the gene is shown in SEQ ID NO:
2.
3. The application according to claim 2, wherein Using the molecular marker to detect the resistance of tomato to Botrytis cinerea is as follows: Using the genomic DNA of the tomato to be tested as a template, performing PCR amplification on the molecular marker and performing electrophoresis identification; When a 937-bp band cannot be amplified, the tomato to be tested is resistant to Botrytis cinerea; When a 937-bp band is amplified, the tomato to be tested is not resistant to Botrytis cinerea.
4. The application according to claim 2, wherein Using the molecular marker to regulate the resistance of tomato to Botrytis cinerea includes: Silencing or overexpressing the gene negatively regulated by the molecular marker in tomato materials.
5. The application according to claim 4, characterized in that, The overexpression includes: Constructing an overexpression vector of the gene and transferring it into Agrobacterium to obtain a positive overexpression engineering bacterium; Infecting tomato materials with the positive overexpression engineering bacterium, culturing transgenic seedlings to obtain overexpression positive seedlings; Transplanting the overexpression positive seedlings to obtain tomato plants resistant to Botrytis cinerea.
6. The application according to claim 4, wherein The silencing includes: Constructing an interference silencing vector of the gene and transferring it into Agrobacterium to obtain a positive gene silencing engineering bacterium; Infecting tomato materials with the positive gene silencing engineering bacterium, culturing transgenic seedlings to obtain gene silencing positive seedlings; Transplanting the gene silencing positive seedlings to obtain tomato plants susceptible to Botrytis cinerea.
7. A kit for detecting the resistance of tomatoes to Botrytis cinerea, characterized in that, The kit includes primers for detecting the molecular marker related to the resistance of tomato to Botrytis cinerea described in claim 1; The primers include: a forward primer shown in SEQ ID NO: 5 and a reverse primer shown in SEQ ID NO:
6.
8. The kit according to claim 7, characterized in that, The kit further includes: a DNA extraction kit and a PCR amplification kit.
Citation Information
Patent Citations
Application of SlBBX20 gene in regulating and controlling resistance of tomatoes to botrytis cinerea
CN112195186A
Application of SlMPP6 gene in regulation and control of botrytis cinerea resistance
CN114807220A