Respiratory tract pathogen multiple detection kit

Abstract

The invention relates to the field of pathogen detection, in particular to a respiratory tract pathogen nucleic acid detection kit which comprises an adenovirus upstream primer, a downstream primer and an adenovirus probe. The kit comprises a rhinovirus upstream primer, a rhinovirus downstream primer, a rhinovirus probe, a parainfluenza virus type I upstream primer, a parainfluenza virus type I downstream primer and a parainfluenza virus type I probe; a parainfluenza virus type II upstream primer, a parainfluenza virus type II downstream primer and a parainfluenza virus type II probe; the kit comprises a parainfluenza virus type III upstream primer, a parainfluenza virus type III downstream primer and a parainfluenza virus type III probe. The kit provided by the invention can quickly and accurately detect and distinguish the respiratory pathogens, and the actual detection time is only 24-35 minutes, which is far shorter than that of the kit in the prior art.

Description

[0001] This application claims priority to Chinese invention patent application CN 2023112650391 “A Multiplex Detection Kit for Respiratory Pathogens” filed on September 27, 2023, which is incorporated by reference in its entirety. Technical Field

[0002] The present invention relates to the field of pathogen detection, and specifically to a multiplex detection kit for respiratory pathogens. Background Art

[0003] The respiratory tract is one of the three major channels connecting the human body to the outside world. Many pathogens from the outside world can easily enter the respiratory tract and cause a variety of diseases. Respiratory tract infection refers to the infection of the human respiratory system such as the nasal cavity, throat, trachea and bronchi by pathogens. It is divided into upper respiratory tract infection and lower respiratory tract infection. Data from the World Health Organization before the COVID-19 pandemic showed that respiratory tract infections and other diseases caused by them ranked third among the causes of human death.

[0004] Respiratory infections are a common cause of illness and death, and the clinical symptoms and signs caused by most respiratory pathogens are relatively similar (mostly fever, cough or headache, etc.), which makes it very difficult to accurately predict the cause based on clinical symptoms and signs alone. In fact, different causes often correspond to completely different treatment plans. For example, if it is caused by bacteria, antibiotics are needed; if it is caused by a virus, antiviral drugs are needed. If the infection is caused by a rhinovirus, the use of antibiotics will not only have no therapeutic effect, but will destroy the normal microbial flora in the patient's body.

[0005] Adenovirus (ADV) belongs to the Adenoviridae family and is a type of double-stranded DNA virus particle without an envelope, with an icosahedral three-dimensional symmetrical structure. Human adenovirus (hAdV) infection is easily transmitted and can infect all age groups, especially infants and the elderly, as well as immunodeficient and organ transplant patients. Adenovirus infection can cause a variety of diseases, such as: common cold, acute tonsillitis, otitis media, bronchiolitis, pneumonia, conjunctivitis, diarrhea, hepatitis, myocarditis, viral myositis, etc. The clinical symptoms after adenovirus infection are usually fever, sore throat, runny nose, cough, earache, "red eyes", diarrhea, etc. Adenovirus pneumonia is one of the more serious types of community-acquired pneumonia in children, and it is more common in children aged 6 months to 5 years.

[0006] Parainfluenza virus (PIV) is a class of enveloped single-stranded negative-sense RNA viruses, which are divided into types I to IV, of which types I to III are common pathogens that cause acute respiratory infections in children (especially infants and young children). The clinical symptoms of parainfluenza virus infection are usually fever, nasal congestion, sore throat, wheezing, and even respiratory obstruction. Parainfluenza virus type I / parainfluenza virus type II are the most prominent pathogenic factors associated with croup (pharyngitis, laryngitis, inflammation of the glottis and tracheal surface, causing glottic stenosis), and the age of onset is 6 months to 3 years old. Parainfluenza virus type III often causes bronchiolitis and pneumonia in infants and young children under 1 year old, and its incidence rate is second only to respiratory syncytial virus. Parainfluenza virus type IV causes mild upper respiratory tract infections and does not cause serious diseases.

[0007] Rhinovirus (RV) is a type of RNA virus in the genus Enterovirus of the family Picornaviridae, with an icosahedral symmetrical capsid. Rhinovirus is the most common cause of respiratory tract infections in children and adults. In adults, it mainly causes upper respiratory tract infections such as the common cold; in infants and children and patients with chronic respiratory diseases, in addition to upper respiratory tract infections, it can also cause bronchitis and bronchopneumonia.

[0008] Respiratory tract infections are characterized by high susceptibility, rapid spread, and difficulty in control. As mentioned above, the clinical symptoms and signs caused by different pathogens (especially the adenovirus, parainfluenza virus, and rhinovirus mentioned above) are relatively similar, and even misleading, which makes it difficult for medical practitioners to distinguish pathogens without reliable laboratory analysis, leading to misdiagnosis, unnecessary testing, excessive use of antibiotics, accelerated emergence of antimicrobial-resistant infections, and outbreaks and spread of respiratory infections. Therefore, rapid and accurate detection and identification of pathogens is of great clinical significance.

[0009] Current virus detection methods include virus antigen detection, virus antibody detection, virus culture and separation, and virus nucleic acid detection. Rapid detection of viral antigens in respiratory samples is one of the main methods for early diagnosis of viral infection. The method is simple and has low equipment requirements. It is suitable for early and rapid diagnosis of viral infection in clinical practice. However, the test results are easily affected by multiple factors such as sample source and quality, and the timing of sampling, and negative results have no clinical guidance significance. After the body is infected with a virus, IgM appears first, followed by an increase in IgG antibodies. Therefore, an increase in IgM levels has a certain value for the early diagnosis of viral infection; for IgG, only a 4-fold increase in the comparison of double serum IgG in the acute phase and the recovery phase is diagnostically significant, but double serum collection is difficult and has poor feasibility. People with low immune function / using immunosuppressants such as glucocorticoids and infants with viral infections often fail to produce or delay the production of antibodies, resulting in false negative results for viral antibody testing. Cultivating and isolating viruses through samples is the gold standard for diagnosing viral infection. It can confirm the presence of live viruses that can successfully replicate in vitro in the specimens tested, and can isolate most common respiratory viruses. However, this method has a test cycle of about 3-21 days, requires high culture conditions, is prone to failure, and is not conducive to early diagnosis of the disease. Molecular diagnostic technology extracts viral nucleic acids from respiratory samples, and then uses primers and thermostable polymerases to exponentially amplify the target nucleic acid fragments of the virus under appropriate conditions to achieve viral nucleic acid detection. It has high sensitivity and specificity in virus detection and has early diagnostic value. Among them, real-time fluorescence quantitative PCR has great advantages in early virus detection due to its rapid response, strong specificity, and high sensitivity. However, the COVID-19 pandemic has exposed the weaknesses of the molecular diagnostic industry, such as slow speed and low degree of automation.Without including the sample extraction and system configuration time, a PCR amplification often takes 1 to 2 hours. For example, the actual running time of the fluorescent quantitative PCR program disclosed in patent CN113943836A is 96 minutes; although patent CN113789412A claims that amplification can be completed in only 35 minutes, the actual running time of the fluorescent quantitative PCR program disclosed in it is 56 minutes; the actual running time of the PCR program disclosed in the document "Respiratory VirusMultiplex RT-PCR Assay Sensitivities and Influence Factors in Hospitalized Children with Lower Respiratory Tract Infections" is 93 minutes; and the entire pathogen detection process of the document "Increased Detection of Viruses in Children with Respiratory Tract Infection Using PCR" takes 5-6 hours. In other words, the existing technology of using PCR to detect respiratory viruses often sacrifices the detection speed in order to achieve the accuracy of the detection results.

[0010] The speed of nucleic acid testing must race against the virus. A faster detection speed can cut off the virus transmission chain earlier and minimize the scope of virus transmission. If sensitive and rapid diagnostic tests are not available (for example, due to the long turnaround time of laboratory PCR results), medical practitioners usually make immediate treatment decisions based only on physical signs and clinical symptoms, which may cause misdiagnosis of patients and expand the spread of the virus. It should be emphasized that respiratory viruses (especially the adenovirus, parainfluenza virus, and rhinovirus mentioned above) often induce more serious symptoms (such as bronchitis and pneumonia) in infants and young children. In addition, they do not have language skills, so they are often taken to medical facilities for treatment when they have serious symptoms. At this time, if you need to wait for at least 1-2 hours for the PCR results, the patient's condition may be seriously aggravated (for example, the occurrence of complications) and even threatened with death.

[0011] Currently, fast PCR is mainly achieved through the following aspects: 1) based on specific instruments, such as a PCR instrument with an improved temperature control module (for example, to increase the temperature change speed); 2) based on specific consumables, such as improved PCR tubes (for example, to reduce the PCR reaction volume to increase the temperature change speed); 3) based on optimized reagents, such as the screened fast Taq enzyme, and optimizing the reaction system into a system that can facilitate the realization of fast PCR.

[0012] In other words, the implementation of rapid PCR in the prior art requires specific enzymes, specific instruments and matching consumables. How to shorten the time of respiratory pathogen nucleic acid detection on a common instrument platform in the market (for example, based on the existing fluorescent quantitative PCR instrument) without changing the instrument hardware parameters, consumables and reaction reagents has become an urgent issue to be solved. Summary of the invention

[0013] In a first aspect, the present invention provides a respiratory pathogen nucleic acid detection kit, characterized in that the kit comprises:

[0014] An adenovirus upstream primer, whose nucleotide sequence is shown in SEQ ID NO: 1; an adenovirus downstream primer, whose nucleotide sequence is shown in SEQ ID NO: 2; an adenovirus probe, whose nucleotide sequence is shown in SEQ ID NO: 3;

[0015] A rhinovirus upstream primer, whose nucleotide sequence is shown in SEQ ID NO:4; a rhinovirus downstream primer, whose nucleotide sequence is shown in SEQ ID NO:5; a rhinovirus probe, whose nucleotide sequence is shown in SEQ ID NO:6;

[0016] The nucleotide sequence of the upstream primer of parainfluenza virus type I is shown in SEQ ID NO:7; the nucleotide sequence of the downstream primer of parainfluenza virus type I is shown in SEQ ID NO:8; the nucleotide sequence of the parainfluenza virus type I probe is shown in SEQ ID NO:9; the nucleotide sequence of the upstream primer of parainfluenza virus type II is shown in SEQ ID NO:10; the nucleotide sequence of the downstream primer of parainfluenza virus type II is shown in SEQ ID NO:11; the nucleotide sequence of the parainfluenza virus type II probe is shown in SEQ ID NO:12; the upstream primer of parainfluenza virus type III is shown in SEQ ID NO:13; the downstream primer of parainfluenza virus type III is shown in SEQ ID NO:14; the nucleotide sequence of the parainfluenza virus type III probe is shown in SEQ ID NO:15.

[0017] In some embodiments, the kit further comprises: an internal reference upstream primer, whose nucleotide sequence is shown in SEQ ID NO:16; an internal reference downstream primer, whose nucleotide sequence is shown in SEQ ID NO:17; and an internal reference probe, whose nucleotide sequence is shown in SEQ ID NO:18.

[0018] Under the design and exploration of the present invention, the primer sequences (and probe sequences) in the kit provided by the present invention not only ensure the conservatism of the design (conservatism is crucial to the accuracy of detection), but also have a higher annealing temperature. In conjunction with the corresponding PCR amplification program, it actually only takes about 24-35 minutes to achieve specific, accurate and sensitive rapid qualitative detection of the above-mentioned respiratory pathogens.

[0019] Although the number of primers and probes in the kit provided by the present invention is relatively large, due to its high annealing temperature, the formation of dimers between primers and (or) probes can be avoided to a certain extent in actual detection. Therefore, the kit provided by the present invention can simultaneously detect three pathogens causing respiratory tract infections (i.e., adenovirus, rhinovirus and parainfluenza virus (including type I, II, III)) in one tube and in one test, with low cost, high accuracy and sensitivity, and short time consumption. The actual detection time only takes about 24-35 minutes, and the test results can be determined by the Ct value. In addition, the entire detection process is carried out under single-tube closed conditions, avoiding false positives and environmental pollution caused by cross-samples.

[0020] In some embodiments, the 5' end of the probe sequence is labeled with a fluorescent group, and the fluorescent group includes ROX, VIC, FAM or CY5. In some embodiments, the fluorescent groups of each probe sequence should be different and non-interfering, that is, the fluorescent groups used in each probe sequence are different and will not affect the detection of each other, that is, different channels can be used for detection.

[0021] In some embodiments, the 3' end of the probe sequence is labeled with a quencher group, and the quencher group includes BHQ1, BHQ2 or MGB.

[0022] In some embodiments, the 5' end of the adenovirus probe is labeled with a ROX fluorescent group, and the 3' end is labeled with a BHQ2 quenching group; the 5' end of the rhinovirus probe is labeled with a VIC fluorescent group, and the 3' end is labeled with a BHQ1 quenching group; the 5' end of the internal reference probe is labeled with a CY5 fluorescent group, and the 3' end is labeled with a BHQ2 quenching group; the 5' end of the parainfluenza virus type I probe, the parainfluenza virus type II probe, and the parainfluenza virus type III probe are labeled with a FAM fluorescent group at the 5' end, and the 3' end is labeled with an MGB quenching group. The above-mentioned setting of the fluorescent group and the quenching group of the probe sequence of the present invention can further ensure that the detection intensity of each channel remains balanced, that is, the fluorescence intensity of each detection channel will not be too high or too low in individual channels, further avoiding the problem of interference between channels.

[0023] In some embodiments, the kit further comprises: DNA polymerase, reverse transcriptase, RNase inhibitor, dNTP, and UNG enzyme.

[0024] In some embodiments, the kit further comprises: a PCR buffer.

[0025] In some embodiments, the kit is used for fluorescent quantitative PCR, which includes a first amplification stage and a second amplification stage, wherein the first amplification conditions of the first amplification stage include a denaturation temperature of 90-99°C, an annealing temperature of 55-65°C, and a number of cycles of 3-15 in each cycle; the second amplification conditions of the second amplification stage include a denaturation temperature of at least 85°C, an annealing temperature of 66-82°C, and a number of cycles of 15-50 in each cycle.

[0026] In some embodiments, the specific conditions of the fluorescent quantitative PCR include: the first amplification conditions include 92-95°C for 1-10s, 56-62°C for 10-15s, and 3-10 cycles; the second amplification conditions include 92-95°C for 1-10s, 68-72°C for 10-15s, and 35-45 cycles.

[0027] When the nucleic acid concentration in the sample is high and / or there are more stringent requirements for the detection speed, the specific conditions of the fluorescent quantitative PCR can be set as follows: the first amplification condition includes 92°C 1s, 62°C 10s, 3 cycles; the second amplification condition includes 92°C 1s, 72°C 10s, 35 cycles. According to the test, under the above conditions, the kit provided by the present invention actually only takes 24 minutes (including reverse transcription and DNA polymerase activation steps, reverse transcription is set at 50°C 2min, and DNA polymerase activation is set at 98°C 30s) to achieve rapid and accurate detection of the above respiratory pathogens.

[0028] In some embodiments, the specific conditions of the fluorescent quantitative PCR can be set as: the first amplification condition includes 92°C 1s, 60°C 12s, and 5 cycles; the second amplification condition includes 92°C 1s, 70°C 12s, and 40 cycles.

[0029] In some embodiments, the actual detection time of the kit includes 24-35 minutes. Those skilled in the art should understand that the specific conditions of fluorescent quantitative PCR can be adjusted according to actual detection requirements and actual detection scenarios (for example, by extending the denaturation / annealing time, etc.).

[0030] In a second aspect, the present invention further provides a method for detecting respiratory pathogens for non-diagnostic purposes, characterized in that it comprises:

[0031] 1) Extract viral nucleic acid from samples;

[0032] 2) performing fluorescent quantitative PCR on the viral nucleic acid using the above kit;

[0033] 3) obtain and analyze the results;

[0034] The fluorescent quantitative PCR includes a first amplification stage and a second amplification stage, wherein the first amplification conditions of the first amplification stage include a denaturation temperature of 90-99°C, an annealing temperature of 55-65°C, and a number of cycles of 3-15 in each cycle; the second amplification conditions of the second amplification stage include a denaturation temperature of at least 85°C, an annealing temperature of 66-82°C, and a number of cycles of 15-50 in each cycle.

[0035] In some embodiments, the specific conditions of the fluorescent quantitative PCR include: the first amplification conditions include 92-95°C for 1-10s, 56-62°C for 10-15s, and 3-10 cycles; the second amplification conditions include 92-95°C for 1-10s, 68-72°C for 10-15s, and 35-45 cycles.

[0036] In some embodiments, the fluorescent quantitative PCR further comprises the steps of reverse transcription and DNA polymerase activation, and the specific conditions of the reverse transcription and DNA polymerase activation include 50-55°C for 2-5 min, and 95-98°C for 30-120 s.

[0037] In some embodiments, the sample comprises one or more of a throat swab, sputum, bronchoalveolar lavage fluid, and blood.

[0038] In some embodiments, the virus concentration includes 250-10 5 copies / mL.

[0039] In some embodiments, when an amplification curve (i.e., a typical S-shaped curve) appears in the detection channel and the Ct value of the amplification curve is ≤36, it indicates that the sample contains the corresponding viral nucleic acid, and the sample is evaluated as a positive result; when there is no amplification curve in the detection channel or the Ct value is greater than 36, and the internal reference channel is positive (Ct value ≤36), it indicates that the corresponding viral nucleic acid is not detected in the sample, and the sample is evaluated as a negative result.

[0040] Beneficial effects:

[0041] Compared with existing kits for detecting respiratory pathogens, the kit provided by the present invention can quickly and accurately detect and distinguish adenovirus, rhinovirus and parainfluenza virus (including types I, II and III) on a commonly used fluorescent quantitative PCR instrument on the market without modifying the probes and primers and adding specific enzymes and specific reagents to the reaction system. The actual detection time is only 24-35 minutes, which is much shorter than other kits based on qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) technology.

[0042] Timely diagnosis is the key to preventing cross-infection and outbreaks of respiratory pathogens. The kit provided by the present invention can simultaneously, quickly and accurately detect common clinical respiratory pathogens (i.e., adenovirus, rhinovirus and parainfluenza virus (including type I, II, III)), and the actual detection time is only 24-35min, which is particularly suitable for POC testing (Point-of-Care Testing), outpatient clinics, emergency departments, and other scenarios where test results need to be obtained quickly. Compared with existing test kits, the kit provided by the present invention helps to help medical practitioners quickly determine appropriate treatment strategies, and to a certain extent avoids misdiagnosis, unnecessary testing, excessive use of antibiotics and accelerates the emergence of antimicrobial resistant infections, as well as serious consequences such as the outbreak and spread of respiratory infections. The kit provided by the present invention also helps patients take effective preventive measures and carry out appropriate antiviral treatment according to the test results, which not only avoids the run on medical resources, but also reduces the risk of transmitting the virus to others. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the prior art descriptions are briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention, and for ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor.

[0044] Figure 1 is the adenovirus nucleic acid amplification curve (sensitivity detection);

[0045] Figure 2 is the rhinovirus nucleic acid amplification curve (sensitivity detection);

[0046] Figure 3 is the nucleic acid amplification curve of parainfluenza virus type I (sensitivity test);

[0047] Figure 4 is the nucleic acid amplification curve of parainfluenza virus type II (sensitivity test);

[0048] Figure 5 is the nucleic acid amplification curve of parainfluenza virus type III (sensitivity detection);

[0049] Figure 6 is the nucleic acid amplification curve of other pathogens (specific detection);

[0050] Figure 7 is the adenovirus nucleic acid amplification curve (repeatability test);

[0051] Figure 8 is the rhinovirus nucleic acid amplification curve (repeatability test);

[0052] Fig. 9 is the nucleic acid amplification curve of parainfluenza virus type I (repeatability test);

[0053] Fig.10 is the nucleic acid amplification curve of parainfluenza virus type II (repeatability test);

[0054] Fig.11 is the nucleic acid amplification curve of parainfluenza virus type III (repeatability test);

[0055] Fig.12 The amplification curves corresponding to the 10 adenovirus-positive samples detected (clinical sample testing);

[0056] Fig.13 This is the amplification curve corresponding to the 17 rhinovirus-positive samples detected (clinical sample testing);

[0057] Fig.14 This is the amplification curve corresponding to the 7 parainfluenza positive samples detected (clinical sample testing);

[0058] Fig.15 It is a schematic diagram of the structure of the primer of the present invention. DETAILED DESCRIPTION

[0059] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0060] Herein "and / or" includes any and all combinations of one or more of the associated listed items.

[0061] Herein, "plurality" means two or more than two, ie, it includes two, three, four, five, etc.

[0062] It should be noted that, in this article, the terms "include", "comprises" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, an element defined by the sentence "comprises a ..." does not exclude the existence of other identical elements in the process, method, article or device including the element.

[0063] As used in this specification, the term "about" typically means + / - 5% of the stated value, more typically + / - 4% of the stated value, more typically + / - 3% of the stated value, more typically + / - 2% of the stated value, even more typically + / - 1% of the stated value, and even more typically + / - 0.5% of the stated value.

[0064] In this specification, certain embodiments may be disclosed in a format of being in a certain range. It should be understood that such description of "being in a certain range" is merely for convenience and brevity, and should not be interpreted as a rigid limitation on the disclosed range. Therefore, the description of the range should be considered to have specifically disclosed all possible sub-ranges and independent numerical values ​​within this range. For example, the description of the range 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as individual numbers within this range, such as 1, 2, 3, 4, 5 and 6. Regardless of the breadth of the range, the above rules apply.

[0065] Embodiment 1

[0066] Primer and probe information

[0067] The primer and probe sequences designed by the present invention are shown in Table 1. The schematic diagram of the structure of the primer is shown in Fig.15 shown.

[0068] Table 1 Note: In Table 1, A represents adenovirus, R represents rhinovirus, P represents parainfluenza virus, and RP represents RNase P. The underline represents the interface sequence.

[0069] The sequence of the target nucleic acid is as follows:

[0070] Adenovirus: CCTCGTCAGGCTGTGCTAACTTTGGAGAGTTCGTCTTCGCAGCCCCGCTCAGGCGGCATTGGAACTCTCCAGTTTGTGGAGGAGTTTACTCCCTCTGTCTACTTTAACCCCTTCTCCGGC (SEQ ID NO:19)

[0071] Rhinovirus: CACTCTTGCGAGTGCGAAGCCATATATTTGACAAGGTGTGAAGAGCCCCGTGTGCTCACTTTGAGTCCTCCGGCCCCTGAATGTGGCTAACCTTAACCCTGCAG (SEQ ID NO:20)

[0072] Parainfluenza virus type I: ATACAAAGTTCAGTACAAAGCGGGATCCCAATATTGTTAAACAAGCAAAGCAGAGATCTCACACAATTAATAGAGAAGTCATGCAACAGACAGG (SEQ ID NO:21)

[0073] Parainfluenza virus type II: CCACCCATCAGAGTTCCATATATTGGGTCTAGAACAGAGGAAAGAAGAGTTGCATCAATGGCATATATTAAAGGTGCCACACACAGTTTGAAGGCTGCTCTTAGGG (SEQ ID NO:22)

[0074] Parainfluenza virus type III: TGGAAAGGAAAGGAAGGATACAGAAGAGAGCAATCGATTTACAGAAAGGGCAATTACTCTATTGCAGAATCTTGGTGTAATTCAATCCACATCAAAA (SEQ ID NO:23)

[0075] RNaseP: CTGCGCGGACTTGTGGAGACAGCCGCTCACCTTGGCTATTCAGTTGTTGCTATCAATCATATCGTTGACTTTAAGGAAAAGAAACAGGAAATTGAAAAACCAGTAGCTGTTTCTGAACTCTT (SEQ ID NO:24)

[0076] Amplification system:

[0077] PCR instrument: Biori FQD-96C real-time fluorescence quantitative PCR analyzer

[0078] Amplification Procedure:

[0079] The first amplification stage: 50°C for 2 min, 98°C for 30 s, 1 cycle (reverse transcription and DNase activation); 92°C for 1 s, 60°C for 12 s, 5 cycles;

[0080] The second amplification stage: 92°C for 1 s, 70°C for 12 s (collecting fluorescence), and 40 cycles.

[0081] According to the test, the actual amplification time of the amplification procedure of this embodiment is about 31 minutes.

[0082] Embodiment 2

[0083] Sensitivity test

[0084] Adenovirus culture medium, rhinovirus culture medium, parainfluenza virus type I culture medium, parainfluenza virus type II culture medium, and parainfluenza virus type III culture medium were diluted to 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 After nucleic acid extraction, PCR amplification was performed according to the amplification system and amplification procedure of Example 1, and 2 replicate wells were tested for each concentration. The results are shown in Figure 1-Figure 5 As shown, the primer-probe combination of the present invention can accurately detect 500 copies / mL of adenovirus, rhinovirus, parainfluenza virus type I, parainfluenza virus type II, and parainfluenza virus type III, that is, the sensitivity of the primer-probe combination of the present invention is not less than 500 copies / mL.

[0085] Specifically, Figure 1 There are 6 amplification curves from left to right. The two closest ones are the amplification curves of two replicate wells of adenovirus samples with the same concentration. The concentrations corresponding to the amplification curves are 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 copies / mL. Figure 2 There are 6 amplification curves from left to right. The two closest ones are two duplicate well amplification curves of rhinovirus samples with the same concentration. The concentrations corresponding to the amplification curves are 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 copies / mL. Figure 3There are 6 amplification curves from left to right. The two closest ones are two duplicate well amplification curves of the same concentration of parainfluenza virus type I sample. The concentrations corresponding to the amplification curves are 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 copies / mL. Figure 4 There are 6 amplification curves from left to right. The two closest ones are two duplicate well amplification curves of parainfluenza virus type II samples with the same concentration, 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 copies / mL. Figure 5 There are 6 amplification curves from left to right. The two closest ones are two duplicate well amplification curves of parainfluenza virus type III samples with the same concentration, 5×10 4 copies / mL, 5×10 3 copies / mL, 5×10 2 copies / mL.

[0086] Embodiment 3

[0087] Specificity test

[0088] According to the amplification system and amplification procedure of Example 1, 1×10 5 copies / mL influenza A virus H1N1 (2009), 1×10 5 copies / mL influenza B virus B / Yamgata, 1×10 6 copies / mL respiratory syncytial virus type A, 1×10 5 copies / mL respiratory syncytial virus type B, 1×10 6 copies / mL human metapneumovirus, 1×10 5 copies / mL mumps virus, 1×10 5 copies / mL cytomegalovirus, 1×10 5 copies / mL enterovirus EV71, 1×10 6 copies / mL Chlamydia pneumoniae and 1×10 7 copies / mL of Streptococcus pneumoniae. The test results were all negative, such as Figure 6 The above results show that the primer-probe combination of the present invention has excellent specificity.

[0089] Embodiment 4

[0090] Repeatability test

[0091] Adenovirus culture medium, rhinovirus culture medium, parainfluenza virus type I culture medium, parainfluenza virus type II culture medium, and parainfluenza virus type III culture medium were diluted to 1×10 5 copies / mL and 1×10 3 After the nucleic acid was extracted, PCR amplification was performed according to the amplification system and amplification procedure of Example 1, and 10 replicate wells were tested for each concentration. The results are shown in Tables 2-6 and Figure 7-Figure 11 As shown, the coefficient of variation (CV) of the Ct values ​​detected with different template concentrations was less than 5% (even less than 1.5%), which clearly shows that the primer-probe combination of the present invention has excellent repeatability.

[0092] Specifically, Figure 7 The 10 amplification curves on the left correspond to adenovirus concentration of 1×10 5 The repeatability test results of 10 copies / mL. The 10 amplification curves on the right correspond to the concentration of adenovirus of 1×10 3 The repeatability test results of 100 copies / mL. Figure 8 The 10 amplification curves on the left correspond to a rhinovirus concentration of 1×10 5 The repeatability test results of 10 copies / mL. The 10 amplification curves on the right correspond to the concentration of rhinovirus of 1×10 3 The repeatability test results of 100 copies / mL. Fig. 9 The 10 amplification curves on the left correspond to the concentration of parainfluenza virus type I of 1×10 5 The repeatability test results of 10 copies / mL. The 10 amplification curves on the right correspond to the concentration of parainfluenza virus type I of 1×10 3 The repeatability test results of 100 copies / mL. Fig.10 The 10 amplification curves on the left correspond to the concentration of parainfluenza virus type II of 1×10 5 The repeatability test results of 10 copies / mL. The 10 amplification curves on the right correspond to the concentration of parainfluenza virus type II of 1×10 3 The repeatability test results of 100 copies / mL. Fig.11 The 10 amplification curves on the left correspond to the concentration of parainfluenza virus type III of 1×10 5 The repeatability test results of 10 copies / mL. The 10 amplification curves on the right correspond to the concentration of parainfluenza virus type III of 1×10 3 The repeatability test results of 100 copies / mL.

[0093] Table 2 Adenovirus repeatability test results (Ct value)

[0094] Table 3 Rhinovirus repeatability test results (Ct value)

[0095] Table 4 Parainfluenza virus type I repeatability test results (Ct value)

[0096] Table 5 Parainfluenza virus type II repeatability test results (Ct value)

[0097] Table 6 Parainfluenza virus type III repeatability test results (Ct value)

[0098] Embodiment 5

[0099] Clinical sample testing

[0100] Nucleic acid was extracted from 60 clinical throat swab samples and tested using the amplification system and amplification procedure of Example 1. Figure 12-14 It showed that 10 adenovirus-positive samples were detected among 60 samples ( Fig.12 ), 17 rhinovirus positive samples ( Fig.13 )、7 parainfluenza positive samples ( Fig.14 ), which are consistent with expectations.

[0101] The embodiments of the present invention are described above in conjunction with the accompanying drawings, but the present invention is not limited to the above-mentioned specific implementation modes, which are merely illustrative rather than restrictive. Under the guidance of the present invention, ordinary technicians in this field can also make many forms without departing from the scope of protection of the present invention and the claims, all of which are within the protection of the present invention.

Claims

1. A respiratory pathogen nucleic acid detection kit, characterized in that: The kit comprises: An adenovirus upstream primer, whose nucleotide sequence is shown in SEQ ID NO: 1; an adenovirus downstream primer, whose nucleotide sequence is shown in SEQ ID NO: 2; an adenovirus probe, whose nucleotide sequence is shown in SEQ ID NO: 3; A rhinovirus upstream primer, whose nucleotide sequence is shown in SEQ ID NO:4; a rhinovirus downstream primer, whose nucleotide sequence is shown in SEQ ID NO:5; a rhinovirus probe, whose nucleotide sequence is shown in SEQ ID NO:6; The nucleotide sequence of the upstream primer of parainfluenza virus type I is shown in SEQ ID NO:7; the nucleotide sequence of the downstream primer of parainfluenza virus type I is shown in SEQ ID NO:8; the nucleotide sequence of the parainfluenza virus type I probe is shown in SEQ ID NO:9; the nucleotide sequence of the upstream primer of parainfluenza virus type II is shown in SEQ ID NO:10; the nucleotide sequence of the downstream primer of parainfluenza virus type II is shown in SEQ ID NO:11; the nucleotide sequence of the parainfluenza virus type II probe is shown in SEQ ID NO:12; the upstream primer of parainfluenza virus type III is shown in SEQ ID NO:13; the downstream primer of parainfluenza virus type III is shown in SEQ ID NO:14; the nucleotide sequence of the parainfluenza virus type III probe is shown in SEQ ID NO:

15.

2. The kit according to claim 1, characterized in that The kit also includes: an internal reference upstream primer, whose nucleotide sequence is shown in SEQ ID NO: 16; an internal reference downstream primer, whose nucleotide sequence is shown in SEQ ID NO: 17; and an internal reference probe, whose nucleotide sequence is shown in SEQ ID NO:

18.

3. The kit according to claim 2, characterized in that The 5' end of the probe sequence is labeled with a fluorescent group, and the fluorescent group includes ROX, VIC, FAM or CY5.

4. The kit according to claim 2, characterized in that The 3' end of the probe sequence is labeled with a quencher group, and the quencher group includes BHQ1, BHQ2 or MGB.

5. The kit according to claim 3, characterized in that The 5' end of the adenovirus probe is labeled with a ROX fluorescent group, and the 3' end is labeled with a BHQ2 quenching group; the 5' end of the rhinovirus probe is labeled with a VIC fluorescent group, and the 3' end is labeled with a BHQ1 quenching group; the 5' end of the internal reference probe is labeled with a CY5 fluorescent group, and the 3' end is labeled with a BHQ2 quenching group; the 5' end of the parainfluenza virus type I probe, the parainfluenza virus type II probe, and the parainfluenza virus type III probe are labeled with a FAM fluorescent group at their 5' ends, and with an MGB quenching group at their 3' ends.

6. The kit according to claim 1, characterized in that The kit also includes: DNA polymerase, reverse transcriptase, RNase inhibitor, and dNTP.

7. The kit according to claim 1, characterized in that The kit is used for fluorescent quantitative PCR, which includes a first amplification stage and a second amplification stage. The first amplification conditions of the first amplification stage include a denaturation temperature of 90-99°C, an annealing temperature of 55-65°C, and a number of cycles of 3-15 in each cycle; the second amplification conditions of the second amplification stage include a denaturation temperature of at least 85°C, an annealing temperature of 66-82°C, and a number of cycles of 15-50 in each cycle.

8. A method for detecting respiratory pathogens for non-diagnostic purposes, characterized in that: include: 1) Extract viral nucleic acid from samples; 2) performing fluorescent quantitative PCR on the viral nucleic acid using the kit according to any one of claims 1 to 7; 3) obtain and analyze the results; The fluorescent quantitative PCR includes a first amplification stage and a second amplification stage, wherein the first amplification conditions of the first amplification stage include a denaturation temperature of 90-99°C, an annealing temperature of 55-65°C, and a number of cycles of 3-15 in each cycle; the second amplification conditions of the second amplification stage include a denaturation temperature of at least 85°C, an annealing temperature of 66-82°C, and a number of cycles of 15-50 in each cycle.

9. The method according to claim 8, characterized in that The specific conditions of the fluorescent quantitative PCR include: the first amplification conditions include 92-95°C for 1-10s, 56-62°C for 10-15s, and 3-10 cycles; the second amplification conditions include 92-95°C for 1-10s, 68-72°C for 10-15s, and 35-45 cycles.

10. The method according to claim 8, characterized in that The fluorescent quantitative PCR also includes the steps of reverse transcription and DNA polymerase activation, and the conditions of reverse transcription and DNA polymerase activation include 50-55° C. for 2-5 minutes and 95-98° C. for 30-120 seconds.

Images